GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2020-02-27 20:13:47, GGRNA : RefSeq release 98 (Jan, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens long intergenic non-protein coding RNA 1074 (LINC01074), long non-coding RNA. (555 bp)
dbSNP:759085869" ORIGIN // cagactaggaaattctcctaaatatatctccaacagagtaaacaagagattaggaaacttgtccttcattcaattacacctggcaggtgaatgggagtggagcagtaagagatgctgcttccagtagttttctacctctcaatccttgctattcaaagtatggtccacagtccagcagctttggcatcacctgggaacttgatggaaatgcagataagttcaaattcccactactgatatactgaattagaaacatctgcccttcaagaagatccactggtgataatatgcatattaaagtttgagtagcaccgccattctatatcagcttgcaaaatgaaagcaagaagaaacaaaacaaagcattagccagtttggattttctgaagtgcactaaatgtcaaactcaagaaaaggtagtagaaaataaatttctcttcaaccaagtcattagtatggaatcatctactctgttttgaggcgacaccagccaataccagccacattttcggaatcatcattttctggtgaaataaactgacttgcataatttaa
position 265
NR_149075.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens family with sequence similarity 230 member G (FAM230G), long non-coding RNA. (712 bp)
coding RNA genes in human chromosomal region 22q11.2 carry a DNA translocation breakpoint/AT-rich sequence JOURNAL PLoS ONE 13 (4), e0195702 (2018) PUBMED 29668722 REMARK Publication Status: Online-Only gtgactcgaagaagccttccaaaaagcgtgtgaaaaggaagccctactctactaccaaggtgacttcagggagcacattcaatgagaatacaagaagatatgctgtgcacaccaaccagtgtaggagacctcatggctcccgggtaaagaagaagaggtacccacaagaagatgacttccatcatacagtcttcagcaatcttgaaagattggacaagcttcagcccactcttgaagcctctgaggagtctctagttcacaaggacagaggagatggagagaggccagtcaacgtgagggtggtgcaggtggcccctctgaggcatgaatctagtaagtattctggaatcacttgccaagaaaacaatctggatgccaagaaaggtgtggcatcctt...
position 91
NR_136572.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens family with sequence similarity 74 member A6 (FAM74A6), long non-coding RNA. (775 bp)
ctgctcacaggagatgccttaactgaaaggtgatcagactccacaggagacccagagaagatgtggagggagctcagaggctgtcctggaggagacgtggagacagctcagaggctgtcccagagaagacgtggaaagagctcagaggctgtcccagagaagacgtggagagctcagaggatgtcccagagaagacgtggagagagttcagaggctgtcccggagaagacgtggaaagagctcagaaactcagagactgtcccggagaagacatggaaacagctcagaggctgtctgcaagaagacgtgcagagagttcagaggctgtcccggagaagacatggagagagctcaaaggctgtccacaagaagatgtggagagagttcagaggctgtcgttactgctgcacttggctgctttggataattattgcaatcaattttagtaattcaggtgttaaatcacagtcaagcacctatttacctagtgtggtctgatgaatttcacttctttgatacgagagagctgagagtccatttcctgaggaagaaactcagagaaaacaaatgtaaaatccttaagtaagtcatatttggttg...
position 417
NR_110999.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 2620 (LINC02620), long non-coding RNA. (1014 bp)
gene="LINC02620" /replace="g" /replace="t" /db_xref="dbSNP:1420081411" variation 1011 /gene="LINC02620" /replace="c" /replace="t" /db_xref="dbSNP:1047866110" variation 1013 /gene="LINC02620" /replace="a" /replace="c" /db_xref="dbSNP:1243001703" ORIGIN // ggttgccaaatggtgttttgggctcttcttttcccaagaagagactagcccattgtcaccaatgcagagctggaagctgaaattgttaaggcagaatgaaagggagaaaagcacgtcctgagcaccaagaagaagataactcgaagttaagaagacgtgatggtactttggagaagaaagcaacacctgagtcaaattgcactgagcaacgttctttgttgttgtgagatattgataaatctccaggtcttcaacaaggggagtcgagaataggaaactcatttcaaatcatatctcaggtgacaagaaggttaccatatttgaggcagcctgttgggttgcctg...
position 35
NR_120624.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 7, mRNA. (2011 bp)
ggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccacagatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1173
Synonym: ZNF495; ZSCAN5
NM_001322067.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens uncharacterized LOC105374042 (LOC105374042), long non-coding RNA. (1077 bp)
agcagcaggcagacatctgaaccgtggtacatctagttcttctatttgtctacctataggtgcactcataacattttaatttatttcatgtgttgtcatcgttatcctctgtattactctgagaaagaagatgttacctgtttgtgaaaaagagggtcacagagtatgtgtgaaccaatacttcatttgagacagcctcacatggagaatgcaatgagccattctcttctcacatacagttgaatatgacatttactgcagtttgatcactaagcataagagccaagaactctggaacaagaagaagaagacgaaggaggaggaggagggggagggggaggaggagaaggagaaggaggagaaggagaaggagaaggagacggagaaggaggaagaggaggaggagggccgggcgcagtggctcacgcctgtaatcccagcattttgggaggccgaggcgggcggatcacgaggtcaagagaccgagaccatcctggctaacatggtgaaaccccgtctctactaaaaatacaaaaaattagccgggcatggtggcgggcgtctgtagtcccagctactcgggaggctgaggcaggagaa...
position 509
NR_147411.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ZNF649 antisense RNA 1 (ZNF649-AS1), long non-coding RNA. (580 bp)
and characterization of putative alternative promoters of human genes JOURNAL Genome Res. 16 (1), 55-65 (2006) PUBMED 16344560 gatgcaatatgtctgcgcccaggggacgcttgctgggagcagccattttcaaccctactgccgtagagcaggcggagtccctcttttcgcgccttaagacagaaacacaaaatgatcctctgacaagtgatgaagaagaatgggaagatgtgaaaatccaagcaagaagaacttaggggaagcaactcaacatctaagaagaaatgaatagggatcagttccaagaagagataaaggggaaatacccaagaactgggatgcttcgtctttggtttcttctggatcctccctaaattttggctaagaaatctgagtctccatttaagagtgttcccagaaatgatgacatccacatccaggaacctcctccttccttcatttgaactctcttgcttctggggagccaggacctatggagtaaaaatcaagttcatttggtgacacattccctccgggcccagatgctgtctctg...
position 163
NR_110733.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 8, mRNA. (2136 bp)
ggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccacagatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1298
Synonym: ZNF495; ZSCAN5
NM_001322068.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 15, mRNA. (2179 bp)
acaggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccaatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1341
Synonym: ZNF495; ZSCAN5
NM_001322076.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 10, mRNA. (2182 bp)
ggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccacagatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1344
Synonym: ZNF495; ZSCAN5
NM_001322070.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 14, mRNA. (2304 bp)
acaggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccaatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1466
Synonym: ZNF495; ZSCAN5
NM_001322075.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 6, mRNA. (2307 bp)
ggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccacagatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1469
Synonym: ZNF495; ZSCAN5
NM_001322066.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 11, mRNA. (2477 bp)
ggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccacagatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1621
Synonym: ZNF495; ZSCAN5
NM_001322072.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 1980 (LINC01980), long non-coding RNA. (813 bp)
t" /db_xref="dbSNP:992521387" ORIGIN // gcgccgggatgcgctctcctcttctcatttgccaatttattgcagatccctcctcaaaaaagttttgggactaactcagccccatggagatcaaggtgaattagaaaaacaacaaaacaaaacaagattcattttaacatctcactatctccaactttccctcccctcctcccaccccaggaagaaaagactacgtttgtttctggtgatacattcattgtaggtgggtgggtgacttctagaagaggaaaatcaagaagatttggagaaggagtcttggaagctctggtgaagttttccaaaactgggaaggacagagtctgctcagcctgtgttagtggagaagagggaaggaaactggctggaggccgctggacccacagaggacaatagacaatctcctgctgatgcccactggatccaaagagagaaactctatagaattatgatctaggtttgactgactcctggcaagaagccctacccgccagccaatttggatgaggtcacaggggtcatccatctttccttctatgtgactggtttgctcttgcatatca...
position 259
NR_146630.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens CYCS pseudogene 52 (CYCSP52), non-coding RNA. (310 bp)
REFERENCE 2 (bases 1 to 310) AUTHORS Evans MJ and Scarpulla RC. TITLE The human somatic cytochrome c gene: two classes of processed pseudogenes demarcate a period of rapid molecular evolution JOURNAL Proc. Natl. Acad. Sci. U.S.A. 85 (24), 9625-9629 (1988) PUBMED 2849112 acgggtgatattgagaaaggcaagaagatttgtgttcagaagtgtgcccagtgccacactgtggaaaagggaggcaagcacgagactgggcctaatctccatgtctctttgggtggaagacaggtcaggccactggattctcttacacagatgccaataagaacaaaggcattacctggggagaggataccgatggagtatttggagaatcccaagaagtacatccttggaacaaaaatgatctttgccgacattaaggcagaaaagggcagacttgatagattatctcaaaaaagctactaatggataa
position 21
Synonym: HC6; HCP2
NR_001560.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 8053 (MIR8053), microRNA. (75 bp)
REFERENCE 2 (bases 1 to 75) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 gcttttccactggcgattttggaactcaatggcagaaatgtcaagaagagttttatcctttgccgaaagagaaaa
position 42
Synonym: hsa-mir-8053
NR_107020.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 5695 (MIR5695), microRNA. (85 bp)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 caaggcctatctatctagattcttcttggcctctctgagcatgcattcctgagactccaagaagaatctagacagataggccttg
position 58
NR_049880.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 4793 (MIR4793), microRNA. (87 bp)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 tttctcctcgctgcccgcacatcctgctccacagggcagagggaggccaagaagacctctgcactgtgagttggctggctggaggaa
position 48
NR_039956.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 1248 (MIR1248), microRNA. (106 bp)
Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 tttaccttcttgtataagcactgtgctaaaattgcagacactaggaccatgtcttgggcaataatgctagcagagtacacacaagaagaaaagtaacagca
position 87
Synonym: hsa-mir-1248; mir-1248; MIRN1248
NR_031650.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 5197 (MIR5197), microRNA. (112 bp)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 tatgggattccacagacaatgagtatcaatggcacaaactcattcttgaagccagttcaagaagagactgagtcatcgaatgctctaaatgtcacttcacctcatgt
position 63
NR_049829.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KCNQ5 antisense RNA 1 (KCNQ5-AS1), long non-coding RNA. (1101 bp)
gene="KCNQ5-AS1" /replace="g" /replace="t" /db_xref="dbSNP:564986079" variation 1098 /gene="KCNQ5-AS1" /replace="c" /replace="t" /db_xref="dbSNP:1484038223" variation 1101 /gene="KCNQ5-AS1" /replace="a" /replace="c" /db_xref="dbSNP:1182982299" ORIGIN // gtgaaagtggaaaagaaacagtgggaggaatgagaggcaagaagcagcgggtagcacttttctcggtatcaaagagacgtgaaactaggctacttaacttgtaaaaaaagaacttccagtttcccaagacgcaacattgaattcaatcagaggtaaagattctggactattggattaaatgaggaggcaggagctactatctcttgcagtgtgaaaccagggccggggatgaagatatggacacatctcagctttccagggatgctgtgatgtgggtgagcatgagctttgtctatgggctgaattgcatccctccaaaattcatatgttatggtcctaaccccta...
position 38
NR_046621.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 2, mRNA. (2083 bp)
acaggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccaatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1227
Synonym: ZNF495; ZSCAN5
NM_001322062.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens INO80B-WBP1 readthrough (NMD candidate) (INO80B-WBP1), long non-coding RNA. (2112 bp)
INO80B-WBP1" /replace="a" /replace="g" /db_xref="dbSNP:1270271423" variation 217 /gene="INO80B-WBP1" /replace="a" /replace="g" /db_xref="dbSNP:1457716480" variation 218 /gene="INO80B-WBP1" /replace="a" /replace="g" /db_xref="dbSNP:1217796540" variation 221..247 /gene="INO80B-WBP1" /replace="cacaagaagaaacac" /replace="cacaagaagaaacacaagaagaaacac" /db_xref="dbSNP:769795488" variation 224..231 /gene="INO80B-WBP1" /replace="aagaa" /replace="aagaagaa" /db_xref="dbSNP:777858361" variation 226 /gene="INO80B-WBP1" /replace="a" /replace="g" /db_xref="dbSNP:762697663" variation 229 /gene="INO80B-WBP1" /...
position 214
NR_037849.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nucleolar RNA, H/ACA box 31B (SNORA31B), small nucleolar RNA. (134 bp)
REFERENCE 1 (bases 1 to 134) AUTHORS Jorjani H, Kehr S, Jedlinski DJ, Gumienny R, Hertel J, Stadler PF, Zavolan M and Gruber AR. TITLE An updated human snoRNAome JOURNAL Nucleic Acids Res. 44 (11), 5068-5082 (2016) PUBMED 27174936 atgcatctatttgacagacctggagcagttgctatctgctgctatggtttccaccacagatgcaagaagaacatgtccttgcgctttccgtctgtctaattgtggcagctgagattgaatagaggaatacagga
position 63
NR_145985.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cofilin 1 pseudogene 1 (CFL1P1), non-coding RNA. (2141 bp)
tcacccaggctggagtagagtgacaatgaccactgcagcctccacctcctaggctcaagtgatcctcctgcttcagcacccccacaccaggcaacataacaagacccccatctctacaaaaaattaaaaaagaattatcaggtcagatcctggcagcagctgcagcggctctccttgccatctccttttcacttctggaaacatgggctcccatgtggctgtctttgatgatgtcatcaaggtgttcagtgacatgaaagtgtgcaagtcttcaacactagaaaaggtgaagaagcgcaagaagttgctgctcttctgcctgagtgagtacaagaagtacatcatccttgcggaggccaagaagatcctggtaagtaatgtggaccaaaccattgatgatccctatgccacttttgtcaagatgctgacagtaaggactgccgctacgccccttatgacgccaccaaggacagcaagaagaaggacctggtgtttatcttctgggcctctgagtctgcatccattaagagcaaaatgatctatgccagctccaaagacgtcatcaagaagcagctaggggtcagcactgtcgtcttcttg...
position 533
Synonym: CFLP1
NR_028492.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nucleolar RNA, H/ACA box 116 (SNORA116), small nucleolar RNA. (147 bp)
replace="g" /db_xref="dbSNP:913728035" ORIGIN // REFERENCE 1 (bases 1 to 147) AUTHORS Jorjani H, Kehr S, Jedlinski DJ, Gumienny R, Hertel J, Stadler PF, Zavolan M and Gruber AR. TITLE An updated human snoRNAome JOURNAL Nucleic Acids Res. 44 (11), 5068-5082 (2016) PUBMED 27174936 cttttctcagtggtgcaagaagattaagccacattctggctttagagaggcatttctgagagagatgaaggacacttcgttccccagccccaacctaagcatgtgactgtactcaccttgtcagatgctgttggaacctggctgaca
position 16
NR_145798.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 1724 (LINC01724), long non-coding RNA. (1176 bp)
variation 1166 /gene="LINC01724" /replace="a" /replace="c" /db_xref="dbSNP:954924615" variation 1167 /gene="LINC01724" /replace="a" /replace="t" /db_xref="dbSNP:1029824006" variation 1175 /gene="LINC01724" /replace="c" /replace="g" /db_xref="dbSNP:16839352" ORIGIN // ctgatgggtaagaggcctgggcaagaagatctaacagtgcgtcgagatgaaataaatgttgggaaataactagccagtttatgctacaagatacatgtctttataattgcatttatgatttgtgatttccttttacatcaagaagaagtcagaaaggattacgtatgaaattgaatgggagaaaattgtgatgtgtcaagtagaacagattagacaatgtgaaaatactttcacttcaaccccatgaagattacatagaagaaaatgccagatgaagttccttattgtttctcattcacagaatttatttccactaagttattaaaaaaatg...
position 22
NR_146895.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A), transcript variant 3, mRNA. (2211 bp)
ggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccacagatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgag...
position 1355
Synonym: ZNF495; ZSCAN5
NM_024303.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens small nucleolar RNA, H/ACA box 81 (SNORA81), small nucleolar RNA. (178 bp)
Online-Only REFERENCE 4 (bases 1 to 178) AUTHORS Kiss AM, Jady BE, Bertrand E and Kiss T. TITLE Human box H/ACA pseudouridylation guide RNA machinery JOURNAL Mol. Cell. Biol. 24 (13), 5797-5807 (2004) PUBMED 15199136 accttcttgtataagcactgtgctaaaattgcagacactaggaccatgtcttgggcaataatgcttgcagagtacacacaagaagaaaagtaacagcactagattgtaaagactggggtggacctctttcttaatgtccaatgtcctttgtcttaagatttggtgcaatatct
position 84
Synonym: HBI-61
NR_002989.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens family with sequence similarity 230 member J (FAM230J), long non-coding RNA. (1859 bp)
e0195702 (2018) PUBMED 29668722 REMARK Publication Status: Online-Only gattagggatctcctgcccttggtcgtaagtgccactacctgtgctgagcaaaggtcagagcagattgaaccattgtggtttcattttccctgattttgacttatggggaacctgtgtggctgcattcaaggtgactcgaagaagccttccaaaaagcgtgtgaaaaggaagccctactctactaccaaggtgacttcagggagcacattcaatgagaatacaagaagatatgctgtgcacaccaaccagtgtaggagacctcatggctcccgggtaaagaagaagaggtacccacaagaagatgacttccatcatacagtcttcagcaaccttgaaagattggacaagcttcagcccactcttgaagcctctgaggagtctctagttcacaaggacagaggagatggagagaggccagtcaacgtgaaggtggtgcaggtggcccctctgaggcgtgaatctagagccattgacactggagaatgatacctaccctgaaataactcacttcctgaggaaaaaacgcca...
position 232
Synonym: LINC01660
NR_136569.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens family with sequence similarity 230 member E (FAM230E), long non-coding RNA. (1859 bp)
e0195702 (2018) PUBMED 29668722 REMARK Publication Status: Online-Only gattagggatctcctgcccttggtcctaagtgccactatctgtgctgagcaaaggtcagagcagattgaaccattgtggtttcattttccctgattttgacttatggggaacctgtgtggctgcattcaaggtgactcgaagaagccttccaaaaagcgtgtgaaaaggaagccctactctactaccaaggtgacttcagggagcacattcaatgagaatacaagaagatatgctgtgcacaccaaccagtgtaggagacctcatggctcccgggtaaagaagaagaggtacccacaagaagatgacttccatcatacagtcttcagcaaccttgaaagattggacaagcttcagcccactcttgaagcctctgaggagtctctagttcacaaggacagaggagatggagagaggccagtcaacgtgagggtggtgcaggtggcccctctgaggcgtgaatctagagccattgacactggagaatgatacctaccctgaaataactcacttcctgagaaaaaagcgcca...
position 232
Synonym: LINC01662
NR_136561.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens myosin heavy chain 16 pseudogene (MYH16), non-coding RNA. (2282 bp)
of three novel members of the human sarcomeric myosin heavy chain gene family JOURNAL Mol. Biol. Evol. 19 (4), 375-393 (2002) PUBMED 11919279 accttcattgtaacccactcaaccctggattcttttcgcagaatgggcctgaaagtcattcagcagaacgtgcgcaagttcctgcagctccgtttctggggctggtggaagctgtacaacaaggtcaagccactcctgaatgtggctcggcaagaagaggagatgaaggccaaggaggaggagctcaggaaagccatggcccaaacccaggagttggtaaacaaggtcaaggaactggaggagaagacagccacgctcagccaggagaagaatgacctcaccatccagctgcaggctgagcaagagaacctgatggatgcagaggagcgcctgacatggatgatgaagaccaagatggatctagagagccagatctcagacatgcgggagcggctggaggaggaagagggcatggcggcctcactgagtgccgccaagcgcaagttggaaggggagct...
position 151
Synonym: MHC20; MYH16P; MYH5
NR_002147.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens family with sequence similarity 74 member A3 (FAM74A3), long non-coding RNA. (1883 bp)
variation 493 /gene="FAM74A3" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:572770999" variation 494..633 /gene="FAM74A3" /replace="agagagttcagaggctgtcccggagaagac" /replace="agagagttcagaggctgtcccggagaagacgtggaaagagctcagaaa ctcagagactgtcccggagaagacatggaaacagctcagacgctgtctgcaagaagac gtgcagagagttcagaggctgtcccggagaagac" /db_xref="dbSNP:1564191275" variation 496 /gene="FAM74A3" /replace="a" /replace="g" /db_xref="dbSNP:752871309" variation 497 /gene="FAM74A3" /replace="a" /replace="g" /db_xref="dbSNP:756543837" variation 500 /gene="FAM74A3" /replace="c" /replace="t" /db_xref="...
position 591
NR_026801.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens PAGE family member 5 pseudogene (LOC100421746), non-coding RNA. (510 bp)
variation 490 /gene="LOC100421746" /replace="a" /replace="g" /db_xref="dbSNP:1295694953" ORIGIN // agaagaggtagtatcttcattctttccaccatcttgattctttctctctgactgaggctcagccgtgggaaatatgagtgagcatgtaagaacaagatcccaatcctcagaaagaggaaatgactaagagtcttcccagccagttgtatctgtgattgtccagcagcccactgaggaaaaacgtcaagaagaggagccaccaactgaaaatcagggtattgcacctactggggagatcgaaaatgaagcggcacctgcccttcaaggacctgatgtggaagcttttcaacaggaactggctctgcttaagatagaggatgcacctggagatggtcctgatgtcagggaggggactctgcccactttcgatcccactaaagtgctggaagcaggtaatgggcaaccataggtttaaaccaagacaaatgaagactgaaaccaagaatgttgttcttatgctggaaatttgactgctaacattctcttaataaagttttacag...
position 185
NR_130179.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens coiled-coil domain containing 181 (CCDC181), transcript variant 2, mRNA. (1925 bp)
ccccggccatctctgtgatcccagccgccgcattttacacagcatatttccttcacaaacagaaaatgaatgaaaataaagatactgattcaaagaaaagtgaagaatacgaagatgactttgaaaaggacctggagtggttaattaatgaaaatgaaaaaagtgatgccagcataatagagatggcttgtgagaaggaagagaatattaaccaagacttaaaagagaatgagacagtaatggagcacaccaaacggcattctgatcctgacaaatctttgcaggatgaggtctcaccaagaagaaatgacatcatttctgtaccaggtattcaacctttggatcccatatcagattcagatagtgaaaactctttccaggaatccaaactagaaagccagaaagacttggaggaggaagaggatgaggaagtaaggagatatattatggagaaaattgtacaagctaacaagcttctacagaatcaagaaccggtgaatgataaaagggagcgaaaacttaagttcaaggaccagttagttgatttggaagttcctccactagaagacactactacttttaaaaattattttgaaaacg...
position 443
Synonym: C1orf114
NM_021179.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peptidylprolyl cis/trans isomerase, NIMA-interacting 4 pseudogene 1 (PIN4P1), non-coding RNA. (2366 bp)
gaaaggttactaacaccaagagagacctttggactgcttcatgtcctggaagaaggggaaaaaagagaccctttgggcttctggagctagccctgaaccaaaaaactccctaatcaacctgacttaggtaaaacctttactgagctgggaatctggttcagtctgggattgtcagggactatttcagggcaacagaaggggactggcttttcttgtcataggtcacaaaggcagagagaaccacaccagcatcaccaagatggccaggagtggaaaatgcagacattgagcctaaaacaagaagccatttccttgggagcactgtgatgggggccgcgctcactcactatatgcccaaagcctctggcctgggtggctgctgttcagttgagagtgtaaccagctcctgttttccctgccagggcttgagtcctgtgagaaccttgggaagagagaagagataatgggtagttttaggggatagaataccccttcctcctaccaaatgtaagagaaatccacccccgcaacaagatcttctcaaactgttttgtgctctgaagtgtctaaagataggggagcttttcagcctattctaga...
position 1068
NR_003571.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens transmembrane protein 114 (TMEM114), transcript variant 5, non-coding RNA. (531 bp)
ttgacaccgagcggctggagaggactggcccgggggcgcaggacctgctggggtccatcaatcgcagccagcccgagcctctgagctcccactccggcctctggcggacctgccgggtgcagagcccgtgcacaccgctgatgaaccccttcaggctggagaacgtgacagtcagcgaatcgagccggcaacttctcaagatagggtcttgctgtgttgcccaggctggtctcaaattcctggcttcaagtgatcctcttgcttcagcctcccaaagtgctgggattacaggctgtacaagaagcacagcagcttctgcttctggggagccctcaggaaacttacaatcatggcggaaggtgaaagcccgaactctcatcttgatcgcgatacaaaataaatattggctctatcagaacaaaaaaaaa
position 401
NR_110736.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens AFF1 antisense RNA 1 (AFF1-AS1), long non-coding RNA. (1945 bp)
gggcgacagagtaagactctgtctcagaaaaaaaaaaaaaaaaaggaaaaaaaaagatgatatagtcaaagaaataacattaaatttcttataatttaagatgaatgatttcagattgaaaagtttataaaggtgccaaagagaaaaggaaagatccacactagatacattagaatgaaatgtcaaagtaacatacataaagaagaaattctgaaatcttctagaaagaaagaacatgttatctatgaaggaacaaggatcatattgatattagatttctcaacagcacatgtgctgcaagaagacaaaggagtaatattaagtattgtgaaacaaacctagagcttagaatttcatatttaaaattctaaataaattatcattcaaattgttatagtttgggggccaggtgtggtggctcatgcctataatcccagcactttgggagactaaggcgggcagatcacttgagctcaggagtttgagacgagcctggcaaacacggcaaaaccccatctcaaaatacaaaaattagctagatgtggtggtgcatgcccataatcctagctacttgggaggctgaggcacgagaattgcttg...
position 1217
NR_038841.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens family with sequence similarity 230 member C (FAM230C), long non-coding RNA. (1962 bp)
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002) PUBMED 12477932 gccgagactgcgcttcgtgcgaggcccgggcagcatcggcggcgtggtcagagcgagtctcggagaagatgtggtggcttccgtttgttggtggaggaggtggcaggcctcggcggtgactcgaagaattcttccaaaaagcgtgtgaaaagggagccctactctactaccaaggtgacttcagggagcacattcaatgagaatacaagaagatatgctgtgcacaccaaccagtgtcggagacctcatggctccccggtaaagaagaagatgtacccacaagaagatgacttccatcatacaatcttcagcaaccttgaaagattggacaagcttcagcccactcttgaagcctctgaggagtctctagttcacaaggacagaggagatggagagaggccagtcaacgtgagggtggtgcaggtggcccctctgaggcgtgaatctatgactcctctaccctcaccagagccatccccgggtctgccttattatcccgactactcaggtggagaacc...
position 206
Synonym: LINC00281; NCRNA00281
NR_027278.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens HLA-DQB1 antisense RNA 1 (HLA-DQB1-AS1), long non-coding RNA. (552 bp)
cagagtccagggtgtattgtcatcacctcccccaagatctgtgcaaaggtgaaatcagctcatgaggacacagaacttcagcttgatgcagatgtgtgggaggtggggaacagctgttattcttctggggaatatgaagggttcagtcaggaaattggatgatatctcttcccgaccactagcagcctctttcagtcactggaaaatgcttacaggcagtagccaccatcatgtggcacaaagtgggcatcatcctagtgtctaacatttaagctgtggttctggctccacatttcacaagaagatgccaccaaagttaaggcttggttctggggaacaatgtctggagattcctagaaactggcaaacttctc
position 476
NR_133907.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens CCND2 antisense RNA 1 (CCND2-AS1), transcript variant 3, long non-coding RNA. (553 bp)
PUBMED 27923660 aatgcacagcttctccgcggtcagcgggctggtctctttgagtttggaggccaggaacatgcagacagcacccaggagttgcagatgggacttcggagtcgggaccccagccaagaaacggtccagaagaatctaccataaaaccaacagactcctcctgatctctacctgtgctgtctgcctctctagttccggacactgagagctggtgccctgtggccacctcaagctggaaccctgcaagatcaccaagaagactgcatgcctcgctctagccttcctaagggaaagtagactcctggagagaaattacctgatttcaagagaaacataaaggaccccttaacattccactcgtaaaaatgaagtttggaagaacttctgcaaactctgagtgttttggtcaattgaccttttactgtactaagcaaatctgaagccacaaatacattggggaggaaggtatacccttcacaaaagatccgtcacttagccagatactctgttgccatgcttctttaaataaagcacatttctggta
position 250
Synonym: CCND2-AS2
NR_125790.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens uncharacterized LOC102724596 (LOC102724596), transcript variant 2, long non-coding RNA. (558 bp)
RJ, Elliott P, Abecasis GR, Caulfield M and Munroe PB. CONSRTM Wellcome Trust Case Control Consortium TITLE Genome-wide association study identifies eight loci associated with blood pressure JOURNAL Nat. Genet. 41 (6), 666-676 (2009) PUBMED 19430483 ggtggagaaaggtctgcattacccactggggggatgatgcagcaagaagacccacaccagatgagggcgccttgatattggatttcccagcctccagaactacagagtcttgctctgtcactcgggctggagtacagtgacacaatcacggttcactgcagcctggacctcccaggctcaagtgatccccctgctgcagcctcctgagtagctgggactacaggcctgtgccaccatgtccaggtccggtccactgctaggagatccatatctactctttgggagttctccagaggaaaaaatcaacaggcgggagaaagatactctgctagcttcagattcattagtac...
position 43
NR_110883.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 1461 (LINC01461), long non-coding RNA. (560 bp)
gcttccctgcagagggcgccgcgggcccgcctcgccgagcgcggggtgagatcccagtagcccagagcagcccgcggggcaggcccgggctgccgcggactcctcttgcagaaaagcctttgatgctgtattcttagcacatggaaccctaaaccaaagcctgcactggggcatttgtgagaagcgtgtgtgcaaagcctgagagactccccttttgggcatgctgctgggcaggggtgttctggtttgactttgtacatttggcagttttggagtttgcccaccagatatgccatccaagaagaccaaaagtacagcaggatgattgtgaacaagaccagggacctcagcccttgcaaaaaaaggttgaagactatgtacatgaacgacatt
position 465
Synonym: TCONS_00001552
NR_125761.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 2624 (LINC02624), transcript variant 2, long non-coding RNA. (562 bp)
and initial analysis of more than 15,000 full-length human and mouse cDNA sequences JOURNAL Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002) PUBMED 12477932 gaacagggggagacttgaatcctagagaaaacaaaacaaaacctaacaaaacagaaatgaacccttgatgaacctcttgctctggactggtgccctgaaaatgaatgaaattgttttaaagattaccaagaagatataaaatatcaaatgcggcattaatgtatgtcaaaaagaggaaaaggtgaagatcaggaggcacaacattccaaggatataaaagcaaatgtgaaaatgccataaagtggacatcggcttggcctgttgaaggctgaaaaatccaagcaaagtctatgttgccttcaccagtgttcagatacacctggaagctgctttctgaaaagatggagaccaacccaacagcatcagctcagattcttgtgattataacacagcatgattgctgcttcatgccttctgccatgtgaggacacagt...
position 127
NR_134330.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 824 (LINC00824), transcript variant 2, long non-coding RNA. (1366 bp)
ctataggcacagagaagaataagagagaaacttcaccctaatgaaatttagacttgagttttagaagattttcctggaaagactaagtagagtcaagagttgagataaagtgaaggcatgaaaagcagaatgatgtggaatttaaaagatgaagagctataaacgtgttaatttaattggcacgatctctcgaagacagatccactgcaaccacgaagaagaattatcctttctacacagggccaccacgatgctactacattggccatcacagagcacaatggcatcaccagaaaccaagaagatggtaaggcctggaggtggcagagctgaagagagtacatgacccagcagaagaaataagcacaaatacaaatggtgacagaaaaataagatgtgtcacaactgacttagattccaacaaccacaacagcacagaggaggaagcgaggtggtgctccctggaatgacccaaacacaacaatatctgagcttgctcttgaaggactagcagtttaccaagcaaaatggaaaacagaaattgagtccaggtctagatatcaagaagcacaaagagatccagaaaagaccatggagaat...
position 469
Synonym: LINC01263
NR_121673.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens OCLN pseudogene 1 (OCLNP1), non-coding RNA. (578 bp)
gctggaggaggactggatcagggaatatccacctatcacttcagatcaacaaagacaactgtacaagaggaattttgacactggcctacaggaatacaagagcttacaatcagaacttgatgagatcaataaagaactctcccgtttggataaagaattggatgactatagagaagaaagtgaagagtacatggctgctgctgatgaatacaatagactgaagcaagtgaagggatctgcagattacaaaagtaagaagaatcattgcaagcagttaaacagcaaattgtcacacatcaagaagatggttggagactatgatagacagaaaacatagaaggctgatgccaagttgtttg
position 517
NR_026578.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 566 (LINC00566), long non-coding RNA. (583 bp)
MA. CONSRTM Mammalian Gene Collection Program Team TITLE Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences JOURNAL Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002) PUBMED 12477932 ataattgctgccaaaatcatcacaagctgtacgtcatcaaggctccctttgcactcccaagaagaactgttcattttaaacaaaagtgatgagaattcctccagaggtgggaacagagaaaacttcatgcttggtaaagcacctgaggcacccattacaatctgggacaagatgaggacatcaacactcatgctgtattccacatgggaggccaagtcaacgcaagatgaaagagatataagagccaggcgcggtagctgacacctgtaatcccagcactttgggaagctgaggtgggaggctcacttgaggccaggagatcaagaccagcctaaccaacaaagcaagaccaagaccccttctcta...
position 58
NR_131903.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens uncharacterized LOC100507464 (LOC100507464), long non-coding RNA. (271 bp)
LOC100507464" /replace="a" /replace="t" /db_xref="dbSNP:971274865" variation 236 /gene="LOC100507464" /replace="c" /replace="t" /db_xref="dbSNP:1463840050" variation 264 /gene="LOC100507464" /replace="a" /replace="g" /db_xref="dbSNP:1309090139" ORIGIN // gagatcaaggaagaggaacacgataaaatgcttatggctccaagaagaaatagggtgagagataggaccacaaattgtttactcatttcaaccagtaaacatgtcctgcaatgtcaatctgtctttctgccacagcagttctgcgcctcctgagttgtttccatctccctccagtcattcaggaccaccaatgagatttgtgatatttggaaaactgccacccagtgcctccttttcctaatctgctgaataaagttaataagactaaaaa
position 41
NR_134294.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens tubulin tyrosine ligase like 6 (TTLL6), transcript variant 2, mRNA. (2542 bp)
ccacagctacaacgtggagcagatatggagggatattgaggacgtcatcatcaagaccctcatctcggcccaccccatcatcaggcataactaccacacctgcttccccaaccacacactcaacagcgcctgctttgagatcctgggctttgacattttgttggaccacaaactcaaaccctggctgctggaggtcaaccactctccaagcttctccaccgactctcggttggataaagaggtgaaagatggtctgctgtatgacaccttagtcctgatcaacctggaaagctgtgacaagaagaaagtcttggaggaggagagacaacgggggcagttcctgcagcagtgttgttctcgggagatgaggattgaggaagccaagggtttccgggccgtgcagttaaagaaaactgaaacgtatgagaaggaaaactgtggagggttccgactgatttatcccagtctgaattcggagaagtatgagaagccaggacaacaactccctcttccagaatactgttgcttccagggctcgggaggagtatgcccggcaactgatccaggagctgagactaaaacgggagaaaaagcccttcc...
position 452
Synonym: TTL.6
NM_173623.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens bridging integrator 2 (BIN2), transcript variant 7, mRNA. (2069 bp)
dbSNP:1459121448" variation 550 /gene="BIN2" /gene_synonym="BRAP-1" /replace="c" /replace="g" /db_xref="dbSNP:577030938" variation 553 /gene="BIN2" /gene_synonym="BRAP-1" /replace="a" /replace="g" /db_xref="dbSNP:1412983865" variation 556..580 /gene="BIN2" /gene_synonym="BRAP-1" /replace="gccaagaagaaagatgaggccaaga" /replace="gccaagaagaaagatgaggccaagaagaaagatgaggccaaga" /db_xref="dbSNP:766068626" variation 557 /gene="BIN2" /gene_synonym="BRAP-1" /replace="a" /replace="c" /db_xref="dbSNP:192943143" variation 560 /gene="BIN2" /gene_synonym="BRAP-1" /replace="a" /replace="g" /db_xref="dbSNP...
position 558
Synonym: BRAP-1
NM_001364781.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/caagaag
lang : en | div : | spe : hs | query_string : caagaag | format : html | download :

0.000 | 0.000 | search_start;
1.012 | 1.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:caagaag)?source=Homo sapiens (human)?to=0&format=json
1.998 | 0.986 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:caagaag)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
2.004 | 0.006 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]