GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2019-02-19 01:13:57, GGRNA : RefSeq release 92 (Jan, 2019)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens INO80 complex subunit C (INO80C), transcript variant 2, mRNA. (987 bp)
H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF JOURNAL Cell 121 (6), 873-885 (2005) PUBMED 15960975 acagcttggagtccaggccgggttttcaagcatcaagacggaagtaacagcggaaaggaagttccaaggcccgcgctgggaaaaaggtggggggaccaggggaagactcggagtgcgatggcggcgcaaattccaattgtggccaccacttccactcccggaatagtccggaacagcaagaagaggccggccagcccttcccacaatggcagcagcggcgggggctatggcgccagtaagaagaaaaaagcgtccgcttccagctttgcgcagggtatcagcatggaagccatgagtgagaataaaatggtgccctctgagtttagcacaggacctgtggaaaaagctgccaaacctttgccatttaaggatcccaactttgtgcactctggccacggtggcgcagtagctggcaagaagaacagaacctggaagaacctgaaacaaatcctcgcttctgaaagggcattgccgtggcaac...
position 177
Synonym: C18orf37; hIes6; IES6
NM_194281.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens uncharacterized LOC100506790 (LOC100506790), long non-coding RNA. (401 bp)
replace="c" /replace="t" /db_xref="dbSNP:1382274323" variation 385 /gene="LOC100506790" /replace="c" /replace="t" /db_xref="dbSNP:782169994" ORIGIN // ctttcttaaaaagcaatctgagtggcctgacaggctttcttagttgagctgtcttcctgaggttgtttggagccgctgcgtcatggataaataactccctaaagccagtcccaacaagcttgcactgaacatcaagaagcctgacaagtccttcaaatgcaagaagcccacccaaaatgtgctggtcaatcaacagacaactgggcaggcacagaagcgacatcaacctgtcaaggtggatatggatgctgtcataaagcaactccagggtgaacatggccttggacaaagagtcatgtggcttatgtgctgaggcctgcccagaattctgagatattaattataattagaacaataaactcctcccatgtttgagctattaaaaaaaaaaaaaaa
position 133
NR_104652.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens INO80 complex subunit C (INO80C), transcript variant 1, mRNA. (1095 bp)
H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF JOURNAL Cell 121 (6), 873-885 (2005) PUBMED 15960975 acagcttggagtccaggccgggttttcaagcatcaagacggaagtaacagcggaaaggaagttccaaggcccgcgctgggaaaaaggtggggggaccaggggaagactcggagtgcgatggcggcgcaaattccaattgtggccaccacttccactcccggaatagtccggaacagcaagaagaggccggccagcccttcccacaatggcagcagcggcgggggctatggcgccagtaagaagaaaaaagcgtccgcttccagctttgcgcagacgtgcctttcgccttccaccatgattgtgaggcctccccagccacgtggaactacgtgcctcttgccttccgccatgattgtgaggcctccccagccgcgtggaaatggtatcagcatggaagccatgagtgagaataaaatggtgccctctgagtttagcacaggacctgtggaaaaagctgccaaacctttgccatttaaggatc...
position 177
Synonym: C18orf37; hIes6; IES6
NM_001098817.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens coiled-coil domain containing 151 (CCDC151), transcript variant 2, mRNA. (1867 bp)
Ciliary Dyskinesia JOURNAL (in) Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K and Amemiya A (Eds.); GENEREVIEWS((R)); (1993) PUBMED 20301301 cacacccacacatgcaccctccggttgccccctgtaagaaactgaggtgccctcccacccgctcgttcacacctacacgaggccggagcaaagagggtgaccggaaggcgagagctctcagtggaacatcaagaagaaccaggagaccatcagtcagctccgcaaggagactaaggcactggaactaaagctgctggacctgctcaagggagatgagaaagtggtccaggcagtgattcgcgaatggaagtgggagaagccatacctgaagaacaggacaggacaggccctggagcacctagaccaccggctgagggagaaggtgaagcagcagaacgccctgcggcaccaggtggtgttgcggcagaggcggctggaggagctccagctgcagcacagcctgcgccttctggagatggcggaggcgcaaaacagacaca...
position 137
Synonym: CILD30
NM_001302453.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L3 (RPL3), transcript variant 2, mRNA. (1201 bp)
PUBMED 7821789 ccagatttggctttatatagcggacccgtaaggccgaccggcctctaccggcgggatttgatggcgtgatgtctcacagaaagttctccgctcccagacatgggtccctcggcttcctgcctcggaagcgcagcagcaggcatcgtgggaaggtgaagagcttccctaaggatgacccgtccaagccggtccacctcacagccttcctgggatacaaggctggcatgactcacatcgtgcgggaagtcgacaggccgggatccaaggtgaacaagaaggaggtggtggaggctgtgaccattgtagagacaccacccatggtggttgtgggcattgtgggctacgtggaaacccctcgaggcctccggaccttcaagactgtctttgctgagcacatcagtgatgaatgcaagaggcgtttctataagaattggcataaatctaagaagaaggcccacctgatggagatccaggtgaacggaggcactgtggccgagaagctggactgggcccgcgagaggcttgagcagcaggtacctgtgaaccaagtgtttgggcaggatgagatgatcgacgtcatcgggg...
position 632
Synonym: ASC-1; L3; TARBP-B
NM_001033853.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microfibril associated protein 3 like (MFAP3L), transcript variant 5, non-coding RNA. (573 bp)
and metastasis JOURNAL Biochim. Biophys. Acta 1842 (9), 1423-1432 (2014) PUBMED 24735981 REMARK GeneRIF: MFAP3L activation promotes colorectal cancer cell invasion and metastasis. catggcctgggcctttgggctccccactgtgaggcctctcacggtgggacccaggctttgggtagctggctccatgctctagcaaagcctcacttagcagtggggaggtcccaagaagagaagcgagatacccatataaagcaagcctgcttagccttccagggtccttcaaatcttaccaaatgaaagccagcttgctccacctactgtcaagccagcatctcattctccccattcttgtctcttaaacaactactcaaaaaaggagagccatgaaagtcaccagcctagaaaattacagtcgacttcatgagcttcatttggatttctcatcatgcaatagcaaagtcacagttattcctactgagatcacaatgatgctgccagagcctcccctgagcttgagagccctcctcttct...
position 112
Synonym: NYD-sp9
NR_125890.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens coiled-coil domain containing 151 (CCDC151), transcript variant 3, mRNA. (1981 bp)
tcagccccaaccccatcatgacatctcctctgtgcagggcggcctccgccaacgccctgcctcctcaggaccaggcttcgacgccctcttccagggtcaagggcagggaggcttcgggcaaacccagccacctccgaggcaagggcacagcccaggcgtggaccccaggccgttccaagggaggatccttccacagaggtgcagggaagccctctgtgcactctcaggtggctgagttacataaaaagatacaactgttagagggtgaccggaaggcgagagctctcagtggaacatcaagaagaaccaggagaccatcagtcagctccgcaaggagactaaggcactggaactaaagctgctggacctgctcaaggccctggagcacctagaccaccggctgagggagaaggtgaagcagcagaacgccctgcggcaccaggtggtgttgcggcagaggcggctggaggagctccagctgcagcacagcctgcgccttctggagatggcggaggcgcaaaacagacacacggaggtggccaaggacgagagcctcaacttggagaaccggctggactccatggaggctgaggtggtgag...
position 431
Synonym: CILD30
NM_001302454.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens translation machinery associated 7 homolog (TMA7), transcript variant 2, mRNA. (574 bp)
REMARK GeneRIF: Expression of gene HSPCO16 resulted in the apoptosis of these cells, which suggested that the apoptosis of dermal papilla cells might be associated with the expression of gene HSPC016 in vitro. agggtggggcagacgctccgtttccggtggcagggtctggggaagcggcggcaggcgccatgtccggccgcgaaggtggcaagaagaagccactgaaacagcccaagaagcaggccaaggagatggacgaggaagataaggctttcaagcagaaacaaaaagaggagcagaagaaactcgaggagctaaaagcgaaggccgcggggaaggggcccttgggtggaattaagaaatctggcaaaaagtaagctgttccttgtgcctgaggagatggtgaccctttatttcatctgtatttaaacctctctattccctgccataacatcttttgccacgtatagctggaattaagtgttgtcttggagctgttgtacatttaagaataaactt...
position 80
Synonym: CCDC72; HSPC016
NM_001329417.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens translation machinery associated 7 homolog (TMA7), transcript variant 3, non-coding RNA. (576 bp)
REMARK GeneRIF: Expression of gene HSPCO16 resulted in the apoptosis of these cells, which suggested that the apoptosis of dermal papilla cells might be associated with the expression of gene HSPC016 in vitro. agggtggggcagacgctccgtttccggtggcagggtctggggaagcggcggcaggcgccatgtccggccgcgaaggtggcaagaagaagccactgaaacagcccaagaagcaggccaaggagatggacgagataaggctttcaagcagaaacaaaaagaggagcagaagaaactcgaggagctaaaagcgaaggccgcggggaaggggcccttggccacaggtggaattaagaaatctggcaaaaagtaagctgttccttgtgcctgaggagatggtgaccctttatttcatctgtatttaaacctctctattccctgccataacatcttttgccacgtatagctggaattaagtgttgtcttggagctgttgtacatttaagaataaac...
position 80
Synonym: CCDC72; HSPC016
NR_137639.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ZNF649 antisense RNA 1 (ZNF649-AS1), long non-coding RNA. (580 bp)
and characterization of putative alternative promoters of human genes JOURNAL Genome Res. 16 (1), 55-65 (2006) PUBMED 16344560 gatgcaatatgtctgcgcccaggggacgcttgctgggagcagccattttcaaccctactgccgtagagcaggcggagtccctcttttcgcgccttaagacagaaacacaaaatgatcctctgacaagtgatgaagaagaatgggaagatgtgaaaatccaagcaagaagaacttaggggaagcaactcaacatctaagaagaaatgaatagggatcagttccaagaagagataaaggggaaatacccaagaactgggatgcttcgtctttggtttcttctggatcctccctaaattttggctaagaaatctgagtctccatttaagagtgttcccagaaatgatgacatccacatccaggaacctcctccttccttcatttgaactctcttgcttctggggagccaggacctatggagtaaaaatcaagttcatttggtgacacattccctccgggcccagatgctgtctctg...
position 163
NR_110733.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens phosphatidylinositol glycan anchor biosynthesis class Y (PIGY), mRNA. (1356 bp)
component JOURNAL Mol. Biol. Cell 16 (11), 5236-5246 (2005) PUBMED 16162815 agggggcggggcctgcccggctggcctggacgaacgggaagccgggagctcggccacgggtggcgaggctgcggtgaggcctggtctccggctgccagaccatgctgagtggagcacgctgcaggctcgcctcagcgctgcggggaacgcgcgcgccgccgtccgcggtcgcccgtaggtgcctgcacgcgtcggggtcgcggcctttggccgaccggggcaagaagactgaggagccgccccgcgacttcgatccggcgctgctggagttcctggtgtgcccgctctccaagaagccgctcagatatgaagcatcaacaaacgaattgattaatgaagagttgggaatagcttatccaatcattgatgggatccctaatatgataccacaggcagctaggatgacacgtcaaagtaagaagcaagaagaagtggagcagcgctagttcataatttaaaaaaattaaaaaaacgcaacagccaacttttcttaataccatataccttttaaaacacagtggcag...
position 221
Synonym: HPMRS6; PIG-Y
NM_001042616.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 310 (LINC00310), transcript variant 2, long non-coding RNA. (673 bp)
Rossier C, Lyle R, Guipponi M, de Souza S, Iseli C, Jongeneel CV, Bucher P, Simpson AJ and Antonarakis SE. TITLE Nineteen additional unpredicted transcripts from human chromosome 21 JOURNAL Genomics 79 (6), 824-832 (2002) PUBMED 12036297 gcagattcttggcagacctctgttgctagagttgtaggcaagtagttggacaaaaagcaagaagctgatcgatgttgctggctttggattctttgtgaacaaatgagacaaggctgcaaattcagaggatcctcccagaagataagatggagcaggtcaccaccttcttccctgcttcacaccctcaggccccgactcttgtctgctgagatcactctccaaaccaatcttcccttacaaagcccttgttgcaggctatgctttctgaggggaacccaggccaagacactaaaatgacacaccaacatgaagacatgaacacaattgcaaagggattggttggattgcatatctctgtgaat...
position 63
Synonym: C21orf82; NCRNA00310
NR_027267.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens family with sequence similarity 230 member G (FAM230G), long non-coding RNA. (712 bp)
coding RNA genes in human chromosomal region 22q11.2 carry a DNA translocation breakpoint/AT-rich sequence JOURNAL PLoS ONE 13 (4), e0195702 (2018) PUBMED 29668722 REMARK Publication Status: Online-Only gtgactcgaagaagccttccaaaaagcgtgtgaaaaggaagccctactctactaccaaggtgacttcagggagcacattcaatgagaatacaagaagatatgctgtgcacaccaaccagtgtaggagacctcatggctcccgggtaaagaagaagaggtacccacaagaagatgacttccatcatacagtcttcagcaatcttgaaagattggacaagcttcagcccactcttgaagcctctgaggagtctctagttcacaaggacagaggagatggagagaggccagtcaacgtgagggtggtgcaggtggcccctctgaggcatgaatctagtaagtattctggaatcacttgccaagaaaacaatctggatgccaagaaaggtgtggcatcctt...
position 91
NR_136572.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cystatin like 1 (CSTL1), mRNA. (736 bp)
tgtctgtaaaggaagcacagggaacaggtggtggctttgtaagacagttggaacccaaggaaggcaggccatcccccaggaaagcctatgttggtgagggttatgatgggagaatgagtgaactgcagcctggcaccaccacaccctggaaggtgcagttgggaagaaagtttctgaggctgtagacatggggatcggatgctggagaaaccccctgctgctgctgattgccctggtcctgtcagccaagctgggtcacttccaaaggtgggagggcttccagcagaagctcatgagcaagaagaacatgaattcaacactcaacttcttcattcaatcctacaacaatgccagcaacgacacctacttatatcgagtccagaggctaattcgaagtcagatgcagctgacgacgggagtggagtatatagtcactgtgaagattggctggaccaaatgcaagaggaatgacacgagcaattcttcctgccccctgcaaagcaagaagctgagaaagagtttaatttgcgagtctttgatatacaccatgccctggataaactatttccagctctggaacaattcctgtctggaggccga...
position 357
Synonym: CTES1; dJ322G13.4; RCET11
NM_138283.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens chromosome 19 open reading frame 33 (C19orf33), transcript variant 1, mRNA. (374 bp)
PUBMED 11080599 ctcttaccgccatggagttcgacctgggagcagccctggagcccacctcccagaagcccggtgtgggggcgggccacgggggagatcccaagctcagtccccacaaagttcagggccggtcggaggcaggggcaggtccgggtccaaagcaaggacaccacagctcttccgactccagcagcagctccagcgattcggacacggatgtgaagtcccacgctgctggctccaagcagcacgagagcatcccgggcaaggccaagaagcccaaagtgaagaagaaggagaagggcaagaaggagaagggcaagaagaaggaggctccccactgaagggccctggacagggctcattaaaccttcctctctgccttc
position 260
Synonym: H2RSP; IMUP; IMUP-1; IMUP-2
NM_033520.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens casein alpha s2-like A, pseudogene (CSN1S2AP), non-coding RNA. (779 bp)
loci and evolution of casein gene family JOURNAL J Mammary Gland Biol Neoplasia 7 (3), 327-345 (2002) PUBMED 12751895 REMARK Review article attttccactgtgtagtccactggtcttctatttgggaaacaaggaccaaacaaccatgaagttcttcatctttacctgccttttggctgttgctctggcacatcatgagataaagcactcctcctcttccagtgagtaatctgccagcatctaccaagaagaaactgcaaataaaatagatacgatgcaatcttctagcagtttatccagtggggaatctgctcaagtatccactgaaaacaatgaactgactaaggaaggaaggatctacttaaagcacatggaatctaccagcatctcccaagaagaatctgctgaagtattccctgagacgaaaaccaaccagtttctccagaagttcactgtcccccagtatgtccaggctgttccccttgtagtctatgagcctgtggaatcacattcaggaaaacacctacccatatattcccatttagaaga...
position 156
Synonym: CSN1S2A
NR_003720.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 1980 (LINC01980), long non-coding RNA. (813 bp)
t" /db_xref="dbSNP:992521387" ORIGIN // gcgccgggatgcgctctcctcttctcatttgccaatttattgcagatccctcctcaaaaaagttttgggactaactcagccccatggagatcaaggtgaattagaaaaacaacaaaacaaaacaagattcattttaacatctcactatctccaactttccctcccctcctcccaccccaggaagaaaagactacgtttgtttctggtgatacattcattgtaggtgggtgggtgacttctagaagaggaaaatcaagaagatttggagaaggagtcttggaagctctggtgaagttttccaaaactgggaaggacagagtctgctcagcctgtgttagtggagaagagggaaggaaactggctggaggccgctggacccacagaggacaatagacaatctcctgctgatgcccactggatccaaagagagaaactctatagaattatgatctaggtttgactgactcctggcaagaagccctacccgccagccaatttggatgaggtcacaggggtcatccatctttccttctatgtgactggtttgctcttgcatatca...
position 259
NR_146630.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens eukaryotic translation initiation factor 3 subunit K (EIF3K), transcript variant 2, mRNA. (820 bp)
tggaaggcgacagaagtcatggcgatgtttgagcagatgagagccaacgtgggcaagttgctcaagggtatcgacaggtacaatcctgagaacctggccaccctggagcgctatgtagagacgcaggccaaggaaaatgcctatgatctggaagccaacctggctgtcctgaagctgtaccagttcaacccagccttctttcagaccacggtcaccgcccagatcctgctgaaggccctcaccaacttgccgcacacagacttcaccctgtgcaagtgcatgatcgaccaggcacatcaagaagaacggccaatccgacagattttgtacctcggggacctgctggagacctgccatttccaggccttctggcaagccctggatgaaaacatggacctcttggaaggtataactggctttgaagactctgtccgaaagtacagccagctaaaggtgtggatgagcaaatacggctggagtgccgacgagtcggggcagatcttcatctgtagccaagaagagagcattaaacccaagaacattgtggagaagattgactttgacagtgtgtccagcatcatggcctcctcccagtaactt...
position 475
Synonym: ARG134; EIF3-p28; EIF3S12; HSPC029; M9; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001
NM_001300992.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L3 (RPL3), transcript variant 1, mRNA. (1296 bp)
cDNA bank JOURNAL Gene 150 (2), 243-250 (1994) PUBMED 7821789 ctctaccggcgggatttgatggcgtgatgtctcacagaaagttctccgctcccagacatgggtccctcggcttcctgcctcggaagcgcagcagcaggcatcgtgggaaggtgaagagcttccctaaggatgacccgtccaagccggtccacctcacagccttcctgggatacaaggctggcatgactcacatcgtgcgggaagtcgacaggccgggatccaaggtgaacaagaaggaggtggtggaggctgtgaccattgtagagacaccacccatggtggttgtgggcattgtgggctacgtggaaacccctcgaggcctccggaccttcaagactgtctttgctgagcacatcagtgatgaatgcaagaggcgtttctataagaattggcataaatctaagaagaaggcctttaccaagtactgcaagaaatggcaggatgaggatggcaagaagcagctggagaaggacttcagcagcatgaagaagtactgccaagtcatccgtgtcattgcccacacccagatgcgcctgct...
position 230
Synonym: ASC-1; L3; TARBP-B
NM_000967.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens PML-RARA regulated adaptor molecule 1 (PRAM1), mRNA. (2195 bp)
promyelocytic leukaemia JOURNAL Oncogene 13 (5), 971-982 (1996) PUBMED 8806687 acagtcacttcctgaaggcagcggccccagctcgggtcccactcatcccatggcccatcacctgcctgcagccatggagagccatcaggacttccggagcatcaaagcaaagttccaggcctctcagccggagcccagcgacctgcccaaaaaacctccgaagcctgagtttggtaaactgaagaagttctcccagcctgagctaagcgagcaccccaagaaggccccgctgcctgagtttggtgcagtgtccttgaagcccccgccgcctgaggtcactgacctccccaagaagcccccgccgcctgaggtcactgacctccccaagaagcccccgccgcctgaggtcactgacctccccaagaagcccccgccgcctgaggtcactgacctccccaagaagccgtccaaactggagttgagtgacctctccaagaagttcccacagctgggggccactccgtttccaaggaagcccctgcagcctgaggtcggtgaggcccctttgaaggcctcgctgc...
position 289
Synonym: PML-RAR; PRAM-1
NM_032152.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens INO80 complex subunit C (INO80C), transcript variant 3, mRNA. (858 bp)
agggcgcgtgcgtaatgtggggcgctgcgcgtgcggtctccgttggggttgaaagacgctgccccgcggagtgaatgactactctttcccttcgtttggacacatgggcttacaacgccttgtgttgtaaggagagaagaagaaggtatcagcatggaagccatgagtgagaataaaatggtgccctctgagtttagcacaggacctgtggaaaaagctgccaaacctttgccatttaaggatcccaactttgtgcactctggccacggtggcgcagtagctggcaagaagaacagaacctggaagaacctgaaacaaatcctcgcttctgaaagggcattgccgtggcaactgaacgatcctaactacttcagtattgatgctcctccatcctttaagccagctaagaagtattctgatgtttcaggtctgcttgccaactacacagacccccagagcaaactgcggttcagcaccattgaagagttttcctacattcggaggctgccctctgacgtcgtcaccggctacctggccctgaggaaggccacgagcatcgttccctgagccccagaaagggagatgaagtggaaagctgtt...
position 285
Synonym: C18orf37; hIes6; IES6
NM_001308064.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens eukaryotic translation initiation factor 3 subunit K (EIF3K), transcript variant 3, mRNA. (890 bp)
gccctggttgtggaaggcgacagaagtcatggcgatgtttgagcagatgagagccaacgtgggcaagttgctcaagggtacaatcctgagaacctggccaccctggagcgctatgtagagacgcaggccaaggaaaatgcctatgatctggaagccaacctggctgtcctgaagctgtaccagttcaacccagccttctttcagaccacggtcaccgcccagatcctgctgaaggccctcaccaacttgccgcacacagacttcaccctgtgcaagtgcatgatcgaccaggcacatcaagaagaacggccaatccgacagattttgtacctcggggacctgctggagacctgccatttccaggccttctggcaagccctggatgaaaacatggacctcttggaaggtataactggctttgaagactctgtccgaaagtttatctgccatgttgtgggtatcacttaccagcacattgaccgctggctgctggccgagatgctcggggatctgtcggacagccagctaaaggtgtggatgagcaaatacggctggagtgccgacgagtcggggcagatcttcatctgtagccaagaagag...
position 467
Synonym: ARG134; EIF3-p28; EIF3S12; HSPC029; M9; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001
NM_001308393.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens chromosome 19 open reading frame 33 (C19orf33), transcript variant 2, mRNA. (540 bp)
replace="a" /replace="g" /db_xref="dbSNP:760502279" variation 431 /gene="C19orf33" /gene_synonym="H2RSP; IMUP; IMUP-1; IMUP-2" /replace="a" /replace="g" /db_xref="dbSNP:79297344" variation 432..449 /gene="C19orf33" /gene_synonym="H2RSP; IMUP; IMUP-1; IMUP-2" /replace="" /replace="aggagaagggcaagaagg" /db_xref="dbSNP:1362655899" variation 432..434 /gene="C19orf33" /gene_synonym="H2RSP; IMUP; IMUP-1; IMUP-2" /replace="" /replace="agg" /db_xref="dbSNP:201239475" variation 433..434 /gene="C19orf33" /gene_synonym="H2RSP; IMUP; IMUP-1; IMUP-2" /replace="" /db_xref="dbSNP:376470958" variation 433 /...
position 409
Synonym: H2RSP; IMUP; IMUP-1; IMUP-2
NM_001317801.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ER membrane protein complex subunit 2 (EMC2), transcript variant 3, mRNA. (895 bp)
agagataaaatgagaaaatggagagaagaaaactcaagaaatagtgagcaaattgtggaagttggagaagaattaattaatgaatatgcttctaagctgggagatgatatttggatcatatatgaacaggtgatgattgcagcactagactatggtcgggatgacttggcattgttttgtcttcaagagctgagaagacagttccctggcagtcacagagtcaagcgattaacaggcatgagatttgaagccatggaaagatatgatgatgctatacagctatatgataggattttacaagaagatccaactaacactgctgcaagaaagcgtaagattgccattcgaaaagcccaggggaaaaatgtggaggccattcgggagctgaatgagtatctggaacaatttgttggagaccaagaagcctggcatgaacttgcagaactttacatcaatgaacatgaaatagaatcagattctcatgcgcattttcttgtgcatgaatatttaaccttgttctcatactacaaacaactgatgagaaacagaatgaagacatttgtctattgtctgtggtctatatatataatgtgatctaga...
position 419
Synonym: KIAA0103; TTC35
NM_001329494.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens taste 2 receptor member 45 (TAS2R45), mRNA. (900 bp)
cagcatattttatttgctcaagattgccaatttctccaaccttacttcgcttaaagaggagagttaagagtgtcattctggtggtgctgttggggcctttgctaggcttgtcatcgtggtaaacatgaatcagattgtatggacaaaagaatatgaaggaaacatgacttggaagatcaaattgaggcgtgcaatgtacctttcagatacgactgtaaccatgctagcaaacttagtaccctttactgtaaccctgatatcttttctgctgttagtctgttctctgtgtaaacatctcaagaagatgcagctccatggcaaaggatctcaagatcccagtaccaaggtccacataaaagttttgcaaactgtgatctccttcttcttgttacgtgccatttactttgtgtctgtaataatatcagtttggagttttaagaatctggaaaacaaacctgtcttcatgttctgccaagctattggattcagctgttcttcagcccacccgttcatcctgatttggggaaacaagaagctaaagcagacttatctttcagttttgtggcaaatgaggtactga
position 618
Synonym: GPR59; T2R45; ZG24P
NM_176886.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens NBPF member 20 (NBPF20), mRNA. (18450 bp)
tgcatggctgttgacataggcagacatcggtgggatcaagtgaaaaaggaggaccaagaggcaacaggtcccaggtgagtctgagaaattgtggagaagtacatgtttaggctcagcagggagctgctggatgagaaagggcctgaagtcttgcaggactcactggatagatgttattcaactccttcaggttgtcttgaactgactgactcatgccagccctacagaagtgccttttacgtattggagcaacagcgtattggcttggctgttgacatggatgaaattgaaaagtaccaagaagtggaagaagaccaagacccatcatgccccaggctcagcagggagctgctggatgagaaagagcctgaagtcttgcaggactcactggatagatgttattcgactccttcaggttatcttgaactgcctgacttaggccagccctacagcagtgctgtttactcattggaggaacagtaccttggcttggctcttgacgtggacagaactaaaaaggaccaagaagaggaagaagaccaaggcccaccatgccccaggctcagcagggagctgctggaggtagtagagcctgaagtc...
position 1621
NM_001278267.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens H1 histone family member X (H1FX), mRNA. (1516 bp)
ggtctctgacccccaactcggtcccctagtccggccccggctccgggccccccaaccctcgctccggcccggcccggcccccaccccagccctgccgcccggccccaggcccggccgcggccgctcccgcctggagccgccgcgcgcccccagcccccctgcaccccctcggcccctcgccttcctcttcccggcgcggccccccggcttccgcgcgccgcccgccaccaatcctcttgctaccatgtccgtggagctcgaggaggccctgccagtgacgaccgccgagggaatggccaagaaggtgaccaaggctggcggctcggcggcgttgtccccatctaagaagaggaagaatagcaagaagaagaaccagccgggcaagtacagccagctggtggtggagaccatccgtaggctgggcgagcgcaacggctcgtcgctggccaagatctacaccgaggccaagaaggttccgtggttcgaccagcagaatgggcgcacctacctcaagtactcgatcaaggcgctggtgcagaacgacacgcttctgcaggtgaagggcaccggcgccaacggttccttcaagctcaaccgcaa...
position 501
Synonym: H1.10; H1X
NM_006026.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens CD8b molecule (CD8B), transcript variant 6, mRNA. (944 bp)
cctcagtaacatgcgcatctactggctgagacagcgccaggcaccgagcagtgacagtcaccacgagttcctggccctctgggattccgcaaaagggactatccacggtgaagaggtggaacaggagaagatagctgtgtttcgggatgcaagccggttcattctcaatctcacaagcgtgaagccggaagacagtggcatctacttctgcatgatcgtcgggagccccgagctgaccttcgggaagggaactcagctgagtgtggttgatttccttcccaccactgcccagcccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccagagacccagaagggcctcaaggggaaggtatatcaggaacctttgtcccccaatgcctgcatggatactacagcaatactacaacctcacagaagctgcttaacccatggatcctgaaaacataggcaagaagcacaggtcctgatgagtggatctttactacttttaccagattcctccctcgctcagagggatcctcccacacacccagcagagacttctctgccaccatcaaccccccaagtcatagggggctc...
position 509
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_001178100.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens peptidylprolyl isomerase like 2 (PPIL2), transcript variant 3, mRNA. (2736 bp)
interacts with the proteinase inhibitor eglin c JOURNAL Biochem. J. 314 (Pt 1), 313-319 (1996) PUBMED 8660300 gtttccggggcgcgccgcggaacccggaagtggtcacggaactcggctgcggctccatggtctgagttgtcagccgttgcgtgctcgctagtcgccgccgccgctccgccatggggaagcgacagcaccaaaaggacaaaatgtacattacctgtgctgaatacactcacttttatggtggcaagaagccagatctcccacaaacaaattttcgtcgtttaccttttgaccactgcagtctctctctgcagccctttgtctacccagtctgcactcccgatggcatcgtctttgacttactgaacattgttccatggcttaagaagtacgggaccaaccccagcaatggagagaagctggacgggaggtccctgatcaagctgaacttttccaagaacagtgaggggaagtaccactgcccagtgctgtttaccgtgttcaccaacaacacccacatcgtggctgtgaggacgaccggcaacgtctacgc...
position 188
Synonym: CYC4; Cyp-60; CYP60; hCyP-60; UBOX7
NM_148176.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens taste 2 receptor member 14 (TAS2R14), mRNA. (954 bp)
ggtacattttctcaagatagccaactaactctactctacctaaagtggagggttaaaaaggtggttttggtgctgcttcttgtgacttcggtcttcttgaaatattgcactgataaacatccatataaatgccagtatcaatggatacagaagaaacaagacttgcagttctgattcaagtaactttacacgattttccagtcttattgtattaaccagcactgtgttcattttcataccctttactttgtccctggcaatgtttcttctcctcatcttctccatgtggaaacatcgcaagaagatgcagcacactgtcaaaatatccggagacgccagcaccaaagcccacagaggagttaaaagtgtgatcactttcttcctactctatgccattttctctctgtccatatcagtttggacctctgaaaggttggaggaaaatctaattattctttcccaggtgatgggaatggcttatccttcatgtcactcatgtgttctgattcttggaaacaagaagctgagacaggcctctctgtcagtgctactgtggctgaggtacatgttcaaagatggggagccctcaggtcacaaaga...
position 627
Synonym: T2R14; TRB1
NM_023922.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sperm autoantigenic protein 17 (SPA17), mRNA. (955 bp)
Sequence and localization of the mouse sperm autoantigenic protein, Sp17 JOURNAL Biol. Reprod. 53 (3), 579-590 (1995) PUBMED 7578682 REMARK Erratum:[Biol Reprod 1995 Nov;53(5):1239] tcgccccttctcggccgccgtagaaagaaaaaacggttacccagcaactagaaaaacaaccggaaccggcggcaccagctcggagagaaaggaggttccataggcagttcttaccaagaagatgtcgattccattctccaacacccactaccgaattccacaaggatttgggaatcttcttgaagggctgacacgcgagattctgagagagcaaccggacaatataccagcttttgcagcagcctattttgagagccttctagagaaaagagagaaaaccaactttgatccagcagaatgggggagtaaggtagaagaccgcttctataacaatcatgcattcgaggagcaagaaccacctgagaaaagtgatcctaaacaagaagagtctcagatatctgggaaggaggaagagaca...
position 130
Synonym: CT22; SP17; SP17-1
NM_017425.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens nucleophosmin/nucleoplasmin 2 (NPM2), transcript variant 3, mRNA. (958 bp)
tgtcctgtacgcgcccggtcgagccccgggctgcgcaccccgctaggagctgcccggccagcccgcttctctgcccggagccatgaatctcagtagcgccagtagcacggaggaaaaggcagtgacgaccgtgctctggggctgcgagctcagtcaggagaggcggacttggaccttcagaccccagctggaggggaagcagagctgcaggctgttgcttcatacgatttgcttgggggagaaagccaaagaggagatgcatcgcgtggagatcctgcccccagcaaaccaggaggacaagaagatgcagccggtcaccattgcctcactccaggcctcagtcctccccatggtctccatggtaggagtgcagctttctcccccagttactttccagctccgggctggctcaggacccgtgttcctcagtggccaggaacgttatgaaaaaaaagctggaaaaagaagaagaggaaataagagccagcgttagagacaagagccctgtgaaaaaggccaaagccacagccagagccaagaagccaggattcaagaaatgaggagccacgccttggggggcacggtgcaaagtgggccttc...
position 456
NM_001286681.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens taste 2 receptor member 30 (TAS2R30), mRNA. (960 bp)
cagcatgttttatttgctcaggattgccaatttctccaaccttacttcgcataaagaggagagttaagagtgttgttctggtgatactgttggggcctttgctaggtttgtcatcgtgataaacatggatgagactgtatggacaaaagaatatgaaggaaacgtgacttggaagatcaaattgaggagtgcaatgtaccattcaaatatgactctaaccatgctagcaaactttgtacccctcactctgaccctgatatcttttctgctgttaatctgttctctgtgtaaacatctcaagaagatgcagctccatggcaaaggatctcaagatcccagcaccaaggtccacataaaagctttgcaaactgtgacctcctttcttctgttatgtgccatttactttctgtccatgatcatatcagtttgtaattttgggaggctggaaaagcaacctgtcttcatgttctgccaagctattatattcagctatccttcaacccacccattcatcctgattttgggaaacaagaagctaaagcagactttcagttttgcggcatgtgaggtactgggtgaaagacagaagccttcgtctcc...
position 618
Synonym: T2R30; T2R47; TAS2R47
NM_001097643.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens CD8b molecule (CD8B), transcript variant 4, mRNA. (981 bp)
cctcagtaacatgcgcatctactggctgagacagcgccaggcaccgagcagtgacagtcaccacgagttcctggccctctgggattccgcaaaagggactatccacggtgaagaggtggaacaggagaagatagctgtgtttcgggatgcaagccggttcattctcaatctcacaagcgtgaagccggaagacagtggcatctacttctgcatgatcgtcgggagccccgagctgaccttcgggaagggaactcagctgagtgtggttgatttccttcccaccactgcccagcccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccagagacccagaagggccggcggaggagagcccggcttcgtttcatgaaacagcctcaaggggaaggtatatcaggaacctttgtcccccaatgcctgcatggatactacagcaatactacaacctcacagaagctgcttaacccatggatcctgaaaacataggcaagaagcacaggtcctgatgagtggatctttactacttttaccagattcctccctcgctcagagggatcctcccacacacccagcagagactt...
position 509
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_172102.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens proteasome activator subunit 1 (PSME1), transcript variant 4, mRNA. (984 bp)
epidermal keratinocytes JOURNAL Electrophoresis 13 (12), 960-969 (1992) PUBMED 1286667 actacccaggaaggcggagctgggtgcgagcgccctaccgctttcgctttcccttcgcggtgcccactccactccttgtgcggcgctaggccccccgtcccggtcatggccatgctcagggtccagcccgaggcccaagccaaggtggatgtgtttcgtgaagacctctgtaccaagacagagaacctgctcgggagctatttccccaagaagatttctgagctggatgcaaaaggagccagctctcaatgaagccaacttgagcaatctgaaggccccattggacatcccagtgcctgatccagtcaaggagaaagagaaagaggagcggaagaaacagcaggagaaggaagacaaggatgaaaagaagaagggggaggatgaagacaaaggtcctccctgtggcccagtgaactgcaatgaaaagatcgtggtccttctgcagcgcttgaagcctgagatcaaggatgtcattgagcagctcaacctggtcaccacctggttgcagctgca...
position 207
Synonym: HEL-S-129m; IFI5111; PA28A; PA28alpha; REGalpha
NM_001281529.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 8053 (MIR8053), microRNA. (75 bp)
REFERENCE 2 (bases 1 to 75) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 gcttttccactggcgattttggaactcaatggcagaaatgtcaagaagagttttatcctttgccgaaagagaaaa
position 42
Synonym: hsa-mir-8053
NR_107020.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens taste 2 receptor member 50 (TAS2R50), mRNA. (1000 bp)
tattttatttgctcaagattgccaatttctccaaccttccttcatttaaagaggagagttaggagtgtcattctggtgatactgttggggactttgataggtttgtcatcttcttgtggcaaacatggatgagagtatgtgggcagaagaatatgaaggaaacatgactgggaagatgaaattgaggaatacagtacatctttcatatttgactgtaactaccctatggagcttcataccctttactctgtccctgatatcttttctgatgctaatctgttctctgtgtaaacatctcaagaagatgcagctccatggagaaggatcgcaagatctcagcaccaaggtccacataaaagctttgcaaactctgatctccttcctcttgttatgtgccattttctttctattcctaatcgtttcggtttggagtcctaggaggctgcggaatgacccggttgtcatggttagcaaggctgttggaaacatatatcttgcattcgactcattcatcctaatttggagaaccaagaagctaaaacacacctttcttttgattttgtgtcagattaggtgctgagtaaaagacctgaaactctc...
position 670
Synonym: T2R50; T2R51; TAS2R51
NM_176890.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 5695 (MIR5695), microRNA. (85 bp)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 caaggcctatctatctagattcttcttggcctctctgagcatgcattcctgagactccaagaagaatctagacagataggccttg
position 58
NR_049880.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 4793 (MIR4793), microRNA. (87 bp)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 tttctcctcgctgcccgcacatcctgctccacagggcagagggaggccaagaagacctctgcactgtgagttggctggctggaggaa
position 48
NR_039956.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens potassium voltage-gated channel subfamily J member 3 (KCNJ3), transcript variant 4, mRNA. (1011 bp)
agaaggagaggcgtctgcagggggcagagaccgcagctacctgccgggtgcgccccccacccaggagcgctcgcttcgccccctttcctcccccgcccccacctccttattggtgctagtttgcagcgcccagctcctgcgccttcgcttcgcgtttgaatctggctcgccccttcgtattatgtctgcactccgaaggaaatttggggacgattatcaggtagtgaccacatcgtccagcggctcgggcttgcagccccaggggccaggccaggaccctcagcagcagcttgtgcccaagaagaagcggcagcggttcgtggacaagaacggccggtgcaatgtacagcacggcaacctgggcagcgagacaagccgctacctctcggacctcttcaccacgctggtggacctcaagtggcgctggaacctcttcatcttcattctcacctacaccgtggcctggcttttcatggcgtccatgtggtgggtgatcgcctacactcggggcgacctgaacaaagcccacgtcggtaactacacgccttgcgtggccaatgtctataacttcccttctgccttcctcttcttcatcgagac...
position 312
Synonym: GIRK1; KGA; KIR3.1
NM_001260510.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens INO80 complex subunit B (INO80B), mRNA. (1181 bp)
protein, PAPA-1, induces growth arrest as a result of cell cycle arrest at the G1 phase JOURNAL Gene 340 (1), 83-98 (2004) PUBMED 15556297 atttctagtcccctttcctcgcaggacctcatgagtaagctgtggcggcgtgggagcacctctggggctatggaggcccctgagccgggagaagccctggagttgagcctggcgggtgcccatggccatggagtgcacaagaaaaaacacaagaagcacaagaagaaacacaagaagaaacaccatcaggaagaagacgccgggcccacgcagccgtcccctgccaagcctcagctcaaactcaaaatcaagcttgggggacaagtcctggggaccaagagtgttcctaccttcactgtgatcccagaggggcctcgctcaccctctccccttatggttgtggataatgaagaggaacctatggaaggagtcccccttgagcagtaccgtgcctggctggatgaagacagtaatctctctccctctccacttcgggacctatcaggagggttagggggtca...
position 150
Synonym: hIes2; HMGA1L4; HMGIYL4; IES2; PAP-1BP; PAPA-1; PAPA1; ZNHIT4
NM_031288.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens taste 2 receptor member 31 (TAS2R31), mRNA. (1021 bp)
tagcctcagcatattttatttgctcaagattgccaatttctccaaccttacttcacttaaagaggagagttaagagtgtcattctggtgatgctgttggggcctttactaggcttgtcaacgtgataaacatgaaagagattgtacggacaaaagaatatgaaggaaacttgacttggaagatcaaattgaggagtgcagtgtacctttcagatgcgactgtaaccacgctaggaaacttagtgcccttcactctgaccctgctatggctgttaatctgttctctgtgtaaacatctcaagaagatgcagctccatggtaaaggatctcaagatcccagcaccaaggtccacataaaagctttgcaaactgtgatccctcttgttatgtgccgtttactttctgtccataatgatatcagtttggagttttgggagtctggaaaacaaacctgtcttcatgttctgcaaagctattagattcagctatccttcaatccacccattcatcctgatttggggaaacaagaagctaaagcagacttttctttcagttttgcggcaagtgaggtactgggtgaaaggagagaagccttcatctc...
position 690
Synonym: T2R31; T2R44; T2R53; TAS2R44
NM_176885.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens charged multivesicular body protein 5 (CHMP5), transcript variant 2, mRNA. (1957 bp)
ctgcaggctctctccgagagcaccaagtccttttgctctccatccccggaagacccggctgaaaatccggaaaaagaatcgggaaacgccaggaggcatattgcgcttgcgcacggaggggccggaagtcgaggcgggagtgactctgcttccgtttctggttttgctctagtgtttgggtttcttcgcggctgctcaagatgaaccgactcttcgggaaagcgaaacccaaggctccgccgcccagcctgactgactgcattggcacggtggacagtagagcagaatccattgacaagaagatttctcgattggatgctgagctagtgaagtataaggatcagatcaagaagatgagagagggtcctgcaaagaatatggtcaagcagaaagccttgcgagttttaaagcaaaagaggatgtatgagcagcagcgggacaatcttgcccaacagtcattcaacatggaacaagccaattataccatccagtctttgaaggacaccaagaccacggttgatgctatgaaactgggagtaaaggaaatgaagaaggcatacaagcaagtgaagatcgaccagattgaggatttacaagacc...
position 296
Synonym: C9orf83; CGI-34; HSPC177; PNAS-2; SNF7DC2; Vps60
NM_001195536.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 578 (MIR578), microRNA. (96 bp)
REFERENCE 3 (bases 1 to 96) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 agataaatctatagacaaaatacaatcccggacaacaagaagctcctatagctcctgtagcttcttgtgctctaggattgtattttgtttatatat
position 36
Synonym: hsa-mir-578; MIRN578
NR_030304.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens taste 2 receptor member 43 (TAS2R43), mRNA. (1027 bp)
cagcatattttatttgctcaagattgccaatttctccaactttacttcacttaaagaggagagttaagagtgtcattctggtgatgttgttggggcctttgctaggcttgtcatcgtgataaacatgaatgagattgtgcggacaaaagaatttgaaggaaacatgacttggaagatcaaattgaagagtgcaatgtacttttcaaatatgactgtaaccatggtagcaaacttagtacccttcactctgaccctactatcttttatgctgttaatctgttctttgtgtaaacatctcaagaagatgcagctccatggtaaaggatctcaagatcccagcaccaaggtccacataaaagctttgcaaactgtgatctccttcctcttgttatgtgccatttactttctgtccataatgatatcagtttggagttttggaagtctggaaaacaaacctgtcttcatgttctgcaaagctattagattcagctatccttcaatccacccattcatcctgatttggggaaacaagaagctaaagcagacttttctttcagggcaaatgaggtactgggtgaaaggagagaagacttcatctcc...
position 702
Synonym: T2R43; T2R52
NM_176884.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens proteasome activator subunit 1 (PSME1), transcript variant 3, mRNA. (1031 bp)
epidermal keratinocytes JOURNAL Electrophoresis 13 (12), 960-969 (1992) PUBMED 1286667 actacccaggaaggcggagctgggtgcgagcgccctaccgctttcgctttcccttcgcggtgcccactccactccttgtgcggcgctaggccccccgtcccggtcatggccatgctcagggtccagcccgaggcccaagccaaggtggatgtgtttcgtgaagacctctgtaccaagacagagaacctgctcgggagctatttccccaagaagatttctgagctggatgcaaaaggagccagctctcaatgaagccaacttgagcaatctgaaggccccattggacatcccagtgcctgatccagtcaaggagaaagagaaagaggagcggaagaaacagcaggagaaggaagacaaggatgaaaagaagaagggggaggatgaagacaaaggtcctccctgtggcccagtgaactgcaatgaaaagatcgtggtccttctgcagcgcttgaagcctgagatcaaggatgtcattgagcagctcaacctggtcaccacctggttgcagctgca...
position 207
Synonym: HEL-S-129m; IFI5111; PA28A; PA28alpha; REGalpha
NM_001281528.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens histone cluster 1 H1 family member t (HIST1H1T), mRNA. (725 bp)
AUTHORS Drabent B, Kardalinou E and Doenecke D. TITLE Structure and expression of the human gene encoding testicular H1 histone (H1t) JOURNAL Gene 103 (2), 263-268 (1991) PUBMED 1889752 catgcttttcgctggttattacatcttgcgtttctctgttgttatgtctgaaaccgtgcctgcagcttctgccagtgctggtgtagccgctatggagaaacttccaaccaagaagcgagggaggaagccggctggcttgataagtgcaagtcgcaaagtgccgaacctctctgtgtccaagttgatcaccgaggccctttcagtgtcacaggaacgagtaggtatgtctttggttgcgctcaagaaggcattggccgctgctggctacgacgtagagaagaataacagccgcatcaaactgtccctcaagagcttagtgaacaagggaatcctggtgcaaaccaggggtactggtgcttccggttcctttaagcttagtaagaaggtgattcctaaatctaccagaagcaaggc...
position 109
Synonym: dJ221C16.2; H1.6; H1FT; H1t
NM_005323.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microRNA 1248 (MIR1248), microRNA. (106 bp)
Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 tttaccttcttgtataagcactgtgctaaaattgcagacactaggaccatgtcttgggcaataatgctagcagagtacacacaagaagaaaagtaacagca
position 87
Synonym: hsa-mir-1248; mir-1248; MIRN1248
NR_031650.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ankyrin repeat and SOCS box containing 17 (ASB17), transcript variant 2, non-coding RNA. (1054 bp)
of destruction and degradation JOURNAL Trends Biochem. Sci. 27 (5), 235-241 (2002) PUBMED 12076535 REMARK Review article aatatttactggttacagtttaaagggcacttctgtttgtggagtaaagcctgccacattgtcaaaatatgtaactggaggattacagtatgcttacctctgattttatttctacagtgctgctataagtaacaatgagtaaatctactaaattatgtggtaagacttcttgtccaagaagcaatatattctgcaatctccttgacaaaattgttaaaagaccctccctacaggggtcagtggggatatcactgttacgaaccaaggatttacagatcactggcaaaaattctgaggtatgtggacttggatggttttgacgcactactcacagattacattgcatttgtggaaaaatcaggataccgttttgaagtaagttttaacctcgacttcactgaaatatgtgtgaatacaattctgtactggggccagaaaaggtaatcctgactttgtggaattgcttctcaagaagacaa...
position 181
Synonym: Asb-17
NR_026546.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ribosomal protein L19 (RPL19), transcript variant 1, mRNA. (737 bp)
L19. A determination from the sequence of nucleotides in a cDNA and from the sequence of amino acids in the protein JOURNAL J. Biol. Chem. 262 (3), 1111-1115 (1987) PUBMED 3542997 gcagataatgggaggagccgggcccgagcgagctctttcctttcgctgctgcggccgcagccatgagtatgctcaggcttcagaagaggctcgcctctagtgtcctccgctgtggcaagaagaaggtctggttagaccccaatgagaccaatgaaatcgccaatgccaactcccgtcagcagatccggaagctcatcaaagatgggctgatcatccgcaagcctgtgacggtccattcccgggctcgatgccggaaaaacaccttggcccgccggaagggcaggcacatgggcataggtaagcggaagggtacagccaatgcccgaatgccagagaaggtcacatggatgaggagaatgaggattttgcgccggctgctcagaagataccgtgaatctaagaagatcgatcgccacatgt...
position 116
Synonym: L19
NM_000981.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/caagaag
lang : en | div : | spe : hs | query_string : caagaag | format : html | download :

0.000 | 0.000 | search_start;
1.025 | 1.025 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:caagaag)?source=Homo sapiens (human)?to=0&format=json
2.108 | 1.083 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:caagaag)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
2.114 | 0.006 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]