GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-12-06 05:49:16, GGRNA : RefSeq release 208 (Sep, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Theropithecus gelada claudin 17 (CLDN17), mRNA. (720 bp)
family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:328820" ORIGIN // cgaattggactagtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggcccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttattggcatctgtggcatgaagcaggtccagtgcacgggctctaatgagaggaccaaagcataccttctgggaacttcaggagtccttttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagcagcactttt...
position 212
XM_025381204.1 - Theropithecus gelada (gelada) - NCBI
PREDICTED: Pongo abelii claudin 17 (CLDN17), mRNA. (720 bp)
Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:328820" ORIGIN // cgaattgaaccagtcttcaaagtaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtagggactcttgccacaacccttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttccttgttagctctctcgcctgccctggaaacagcccgggccctcatgtgtgtggctgttgctctctccttgatcgccctgcttattggcatctgtggcatgaagcaggtccagtgcacaggctctaacgagagggtcagagcataccttctgggaacttcaggaatcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaacataatcatcagagatttctacaatccagccatccacataggtcagaaacgagagctgggagcag...
position 211
XM_003780355.3 - Pongo abelii (Sumatran orangutan) - NCBI
PREDICTED: Pan paniscus claudin 17 (CLDN17), mRNA. (1222 bp)
cagccaaggagaacatcatcaaagacttctctagaatcaagaggcttccacgttctacatcttgagcatcttctaccactccgaattgaaccagtcttcaaagtaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacccttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagctccttgttggctctcccgcctgccctggaaacagcccgggcccttatgtgtgtggctgttgctctctccttgatcgccctgcttattggcatctgtggcatgaagcaggtccagtgcacaggctctaacgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatataatcatcagagatttctacaacccagccatccacataggtcagaaacgagagctgggagca...
position 363
XM_003813198.3 - Pan paniscus (pygmy chimpanzee) - NCBI
PREDICTED: Colobus angolensis palliatus claudin 17 (CLDN17), mRNA. (718 bp)
Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:304458" ORIGIN // aattggactagtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggtttttgggttccttggcatggtggggactcttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccaacaagccagggtccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttattggcatctgtggcatgaagcaggtccagtgcacgggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccagtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagtagc...
position 210
XM_011926459.1 - Colobus angolensis palliatus - NCBI
PREDICTED: Cercocebus atys claudin 17 (CLDN17), mRNA. (720 bp)
family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:304458" ORIGIN // cgaattggactagtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacgcttctgcctcagtggagagtatcggcttttgtcggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggcccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttcttggcatctgtggcatgaagcaggtccactgcacgggctctaatgagaggaccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagcagcactttt...
position 212
XM_012029893.1 - Cercocebus atys (sooty mangabey) - NCBI
PREDICTED: Mandrillus leucophaeus claudin 17 (CLDN17), mRNA. (720 bp)
family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:304458" ORIGIN // cgaattggactggtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacgcttctgcctcagtggagagtatcggcttttgtcggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggcccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttcttggcatctgtggcatgaagcaggtccagtgcacgggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggccagaaacgagagctgggagcagcactttt...
position 212
XM_011999786.1 - Mandrillus leucophaeus (drill) - NCBI
PREDICTED: Chlorocebus sabaeus claudin 17 (CLDN17), mRNA. (1213 bp)
agccaaggagaacatcatcaaagacttctctagactcaagagccttccacgttctacaacttgagcatcttctaccactccgaattggactagtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggcccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgctctacttattggcatctgtggcatgaagcaggtccagtgcacgggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagca...
position 364
XM_037990589.1 - Chlorocebus sabaeus (Cercopithecus sabaeus) - NCBI
Homo sapiens claudin 17 (CLDN17), mRNA. (1241 bp)
cagccaaggagaacatcatcaaagacttctctagactcaaaaggcttccacgttctacatcttgagcatcttctaccactccgaattgaaccagtcttcaaagtaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacccttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaattgcatccgacaagccagggtccggttgcaatgcaagttctatagctccttgttggctctcccgcctgccctggaaacagcccgggccctcatgtgtgtggctgttgctctctccttgatcgccctgcttattggcatctgtggcatgaagcaggtccagtgcacaggctctaacgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatataatcatcagagatttctacaacccagccatccacataggtcagaaacgagagctgggagca...
position 369
NM_012131.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rhinopithecus roxellana claudin 17 (CLDN17), mRNA. (983 bp)
agccaaggagaacatcatcaaagacttctctagactcaagagccttccacgttctacatcttgagcatcttctaccactctgaattggactagtcttcaaagtaaaagacaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacgcttctgcctcagtggagactatccgcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcacttatgtgtgtggctgttgctctttccttgatcgccctacttattggcatctgtggcatgaagcaggtccagtgcacaggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccagtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagta...
position 375
XM_010364917.2 - Rhinopithecus roxellana (golden snub-nosed monkey) - NCBI
PREDICTED: Macaca mulatta claudin 17 (CLDN17), mRNA. (1528 bp)
agccaaggagaacatcatcaaagacttctctagactcaagagccttccacgttctacatcttgagcatcttctaccactccgaattggactagtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacgacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggcccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttattggcatctgtggcatgaagcaagtccagtgcacgggctctaatgagagggccaaagcatatcttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatgtaatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagca...
position 637
XM_001100305.4 - Macaca mulatta (Rhesus monkey) - NCBI
PREDICTED: Piliocolobus tephrosceles claudin 17 (CLDN17), mRNA. (1219 bp)
agccaaggagaacatcatcaaagacttcgctagactcaagagccttccacgttctacatcttgagcatcttctaccactccgaattggactagttttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttattggcatctgtggcatgaaacaggtccagtgcacgggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccagtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagca...
position 363
XM_023189701.3 - Piliocolobus tephrosceles (Ugandan red Colobus) - NCBI
PREDICTED: Gorilla gorilla gorilla claudin 17 (CLDN17), mRNA. (1222 bp)
cagccaaggagaacatcatcaaagacttctctagactcaagagccttccacgttctacatcttgagcatcttctaccactctgaattgaaccagtcttcaaagtaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacccttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttccttgttggctctcccgcctgccctggaaacagcccgggccctcatgtgtgtggctgttgctctctccttgatcgccctgcttattggcatctgtggcatgaagcaggtccagtgcacaggctctaacgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatatgatcatcagagatttctacaacccagccatccacataggtcagaaacgagagctgggagca...
position 363
XM_004062667.3 - Gorilla gorilla gorilla (western lowland gorilla) - NCBI
PREDICTED: Hylobates moloch claudin 17 (CLDN17), mRNA. (1225 bp)
cagccaagaagaacatcatcaaagacttctctagactcaaaaggcttccacgttctacatcttgagcatcttctaccactccgaattgaatcagtcttcaaagtaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacccttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttccttgttggctctcccgcctgccctggaaacagcccgggccctcatgtgtgtggctgttgctctctccttgatcgccctacttattggcatctgtggcatgaagcaggtccagtgcacaggctctaacgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacggccaatataatcatcagagatttttacaacccagccattcacacaggtcagaaacgagagctgggagca...
position 363
XM_032176304.1 - Hylobates moloch (silvery gibbon) - NCBI
PREDICTED: Nomascus leucogenys claudin 17 (CLDN17), mRNA. (1226 bp)
cagccaagaagaacatcatcaaagacttctctggactcaaaaggcttccacgttctacatcttgagcatcttctaccactccgaattgaaccagtcttcaaagtaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacccttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttccttgttggctctcccgcctgccctggaaacagcccgggccctcatgtgtgtggctgttgctctctccttgatcgccctacttcttggcatctgtggcatgaagcaggtccagtgcacaggctctaacgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccagtataatcatcagagatttctacaacccagccattcacataggtcagaaacgagagctgggagca...
position 363
XM_004092297.3 - Nomascus leucogenys (northern white-cheeked gibbon) - NCBI
PREDICTED: Trachypithecus francoisi claudin 17 (CLDN17), transcript variant X3, misc_RNA. (1283 bp)
agccaaggagaacatcatcaaagacttctccagactcaagagccttccacgttctacatcttgagcatcttctaccactccgaattggactagtcttcacagtaaaagacaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactgttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcacttatgtgtgtggctgttgctctctccttggtcgccctacttattggcatctgtggcatgaagcaggtccagtgcacaggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccagtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagta...
position 381
XR_004442130.1 - Trachypithecus francoisi (Francois's langur) - NCBI
PREDICTED: Trachypithecus francoisi claudin 17 (CLDN17), transcript variant X2, misc_RNA. (1463 bp)
agccaaggagaacatcatcaaagacttctccagactcaagagccttccacgttctacatcttgagcatcttctaccactccgaattggactagtcttcacagtaaaagacaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactgttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcacttatgtgtgtggctgttgctctctccttggtcgccctacttattggcatctgtggcatgaagcaggtccagtgcacaggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccagtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagta...
position 381
XR_004442129.1 - Trachypithecus francoisi (Francois's langur) - NCBI
PREDICTED: Trachypithecus francoisi claudin 17 (CLDN17), transcript variant X1, mRNA. (2134 bp)
agccaaggagaacatcatcaaagacttctccagactcaagagccttccacgttctacatcttgagcatcttctaccactccgaattggactagtcttcacagtaaaagacaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactgttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcacttatgtgtgtggctgttgctctctccttggtcgccctacttattggcatctgtggcatgaagcaggtccagtgcacaggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccagtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagta...
position 381
XM_033232265.1 - Trachypithecus francoisi (Francois's langur) - NCBI
PREDICTED: Papio anubis claudin 17 (CLDN17), mRNA. (4325 bp)
agccaaggagaacatcatcaaagacttctctagactcaagagccttccaccttctacatcttgagcatcttctaccactccgaattggactagtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggcccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttattggcatctgtggcatgaagcaggtccagtgcatgggctctaatgagaggaccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagca...
position 2154
XM_003895558.5 - Papio anubis (olive baboon) - NCBI
PREDICTED: Macaca nemestrina claudin 17 (CLDN17), mRNA. (6513 bp)
agccaaggagaacatcatcaaagacttctctagactcaagagccttccacgttctacatcttgagcatcttctaccactccgaattggactagtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacgacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggcccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttattggcatctgtggcatgaagcaggtccagtgcacgggctctaatgagagggccaaagcatatcttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatgtaatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagca...
position 2146
XM_011726281.1 - Macaca nemestrina (pig-tailed macaque) - NCBI
PREDICTED: Macaca fascicularis claudin 17 (CLDN17), mRNA. (8153 bp)
agccaaggagaacatcatcaaagacttctctagactcaagagccttccacgttctacatcttgagcatcttctaccactccgaattggactagtcttcaaagtaaaaggcaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactcttgccacgacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggcccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcactcatgtgtgtggctgttgctctctccttgatcgccctacttattggcatctgtggcatgaagcaggtccagtgcacgggctctaatgagagggccaaagcatatcttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccggtgagctggacagccaatgtaatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagca...
position 2170
XM_015446931.1 - Macaca fascicularis (crab-eating macaque) - NCBI

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/comp%3aAGAACUUGCAUUGCAACCG
lang : en | div : | spe : | query_string : comp:AGAACUUGCAUUGCAACCG | format : html | download :

0.000 | 0.000 | search_start;
0.086 | 0.086 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CGGTTGCAATGCAAGTTCT)?to=0&format=json
0.106 | 0.021 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CGGTTGCAATGCAAGTTCT)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.110 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]