GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2019-02-19 01:13:52, GGRNA : RefSeq release 92 (Jan, 2019)



Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Ciona intestinalis sphingosine-1-phosphate phosphatase 2 (LOC100182290), mRNA. (1989 bp)
feature order(726..728,747..749,810..818,939..941,957..959, 969..971) /gene="LOC100182290" /note="active site" /db_xref="CDD:239482" ORIGIN // aacctaacaattggtgtgaatattaaacttttgtactccgtgctggcaatgcatttctcttttgtcactcggagcgcttgccggtttgcgctttgtttcttctattctctcgttgagcatacagatcatgcgctctgtcacggggctggcaagaagagattgtaaagcaaacgttcgttggttgctatagtataaataacagcgtgggcgcgcccctttcaacgatagtttgtcggcgctgtgagtggttactaagtttcaatataatggatctgctttggaggtttactgattattttatggactttaacaaggtccgacattttcaagaactatgtggactacaagaggcaaaacttaatttagacagtacatcaaatggcacaataaacgaggaacaagatggaacagaatcgttgtactccagcgccagcaaaaaccacccaaagtcagattt...
position 150
XM_002130226.4 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis 4-trimethylaminobutyraldehyde dehydrogenase (LOC100175707), mRNA. (2015 bp)
position 349
XM_018814644.2 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis uncharacterized LOC100175924 (LOC100175924), mRNA. (2379 bp)
position 511
XM_002130736.4 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis ribosome biogenesis protein bop1-A-like (LOC100177341), mRNA. (2604 bp)
position 1067
XM_002129739.5 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
Ciona intestinalis beta-catenin (cibeta-catenin), mRNA. (2732 bp)
position 2065
Synonym: CTNNB1
NM_001032607.1 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis kinesin-like protein KIF9 (LOC108949619), mRNA. (3039 bp)
position 2564
XM_018812490.2 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis zinc finger (C-x8-C-x5-C-x3-H/C2H2)-1 (zf(c3h/c2h2)-1), transcript variant X2, mRNA. (4736 bp)
position 2648
XM_002126622.4 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis zinc finger (C-x8-C-x5-C-x3-H/C2H2)-1 (zf(c3h/c2h2)-1), transcript variant X1, mRNA. (4760 bp)
position 2648
XM_018817911.2 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis rho guanine nucleotide exchange factor 17-like (LOC100185174), transcript variant X4, mRNA. (7794 bp)
position 330
XM_026840839.1 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis rho guanine nucleotide exchange factor 17-like (LOC100185174), transcript variant X3, mRNA. (7815 bp)
position 330
XM_026840838.1 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis rho guanine nucleotide exchange factor 17-like (LOC100185174), transcript variant X2, mRNA. (7905 bp)
position 330
XM_026840837.1 - Ciona intestinalis (vase tunicate) - NCBI - UCSC
PREDICTED: Ciona intestinalis rho guanine nucleotide exchange factor 17-like (LOC100185174), transcript variant X1, mRNA. (7950 bp)
position 330
XM_026840836.1 - Ciona intestinalis (vase tunicate) - NCBI - UCSC

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI :
lang : en | div : | spe : ci | query_string : caagaagagattg | format : html | download :

0.000 | 0.000 | search_start;
0.071 | 0.071 | count_done; intestinalis (vase tunicate)?to=0&format=json
0.097 | 0.026 | search_done; intestinalis (vase tunicate)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.099 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]