GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2022-01-24 12:11:01, GGRNA : RefSeq release 209 (Nov, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Oryza sativa Japonica Group uncharacterized LOC107278998 (LOC107278998), transcript variant X7, ncRNA. (1502 bp)
with support for all annotated introns" /db_xref="GeneID:107278998" ncRNA 1..1502 /ncRNA_class="lncRNA" /gene="LOC107278998" /product="uncharacterized LOC107278998, transcript variant X7" /db_xref="GeneID:107278998" ORIGIN // ccgccgcttacaggtgggtcccactccgcactgcaatcccttcccttccgcttcctctctcaatctcttcttgcctcgtctcttcccccaaatcgggcgaatcccaaatcaaccaaaccctagcccgcggcggccaccgcgatggccacctccacgcggctgcggcggcgacggccgcctccgccccttgcatgcctcccccaccgaggagcggtgtgccagtgccagaggcggcggcggcggcgaccggatcatggcgcttctcctgtcggtggacggccgcataaggtgtgggggtgacatcgcgtcggtcgagctcgacggcgtgcggtgacctcctcggcggcgcgttctccctcctccctctcctcgag...
position 61
XR_003238988.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group uncharacterized LOC107278998 (LOC107278998), transcript variant X8, ncRNA. (1562 bp)
with support for all annotated introns" /db_xref="GeneID:107278998" ncRNA 1..1562 /ncRNA_class="lncRNA" /gene="LOC107278998" /product="uncharacterized LOC107278998, transcript variant X8" /db_xref="GeneID:107278998" ORIGIN // ccgccgcttacaggtgggtcccactccgcactgcaatcccttcccttccgcttcctctctcaatctcttcttgcctcgtctcttcccccaaatcgggcgaatcccaaatcaaccaaaccctagcccgcggcggccaccgcgatggccacctccacgcggctgcggcggcgacggccgcctccgccccttgcatgcctcccccaccgaggagcggtgtgccagtgccagaggcggcggcggcggcgaccggatcatggcgcttctcctgtcggtggacggccgcataaggtgtgggggtgacatcgcgtcggtcgagctcgacggcgtgcggtgacctcctcggcggcgcgttctccctcctccctctcctcgag...
position 61
XR_003238989.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group 26S proteasome non-ATPase regulatory subunit 6-like (LOC4336206), mRNA. (1576 bp)
misc_feature 145..1272 /gene="LOC4336206" /note="26S proteasome regulatory complex component, contains PCI domain [Posttranslational modification, protein turnover, chaperones]; Region: RPN7; COG5187" /db_xref="CDD:227514" ORIGIN // ggaggacgaaactagccttctctccttctctctcgtgttctctcccaatctcttcttgcggcggaagcaaagcgagaagcgaggcgactcttctccggcggcggcggcggcggaagcggcggcgagatggacggcggcgtaggcgaggaagggaagcagcagccgcacctggtgctggcgcacaagctgttcctgctctcgcacccggacgtggacgacctcgccaaggtcgacctccgcgccgatgtcctcgccgcagtcaaatccgatgatatggcgtctctgtacgagtcgctgggggccggcggcgtgctggagacggacgctgcgctgctcgcggagatgcgcggcaggatcgaggaggaga...
position 46
XM_015780316.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group uncharacterized LOC107278998 (LOC107278998), transcript variant X1, ncRNA. (1616 bp)
with support for all annotated introns" /db_xref="GeneID:107278998" ncRNA 1..1616 /ncRNA_class="lncRNA" /gene="LOC107278998" /product="uncharacterized LOC107278998, transcript variant X1" /db_xref="GeneID:107278998" ORIGIN // ccgccgcttacaggtgggtcccactccgcactgcaatcccttcccttccgcttcctctctcaatctcttcttgcctcgtctcttcccccaaatcgggcgaatcccaaatcaaccaaaccctagcccgcggcggccaccgcgatggccacctccacgcggctgcggcggcgacggccgcctccgccccttgcatgcctcccccaccgaggagcggtgtgccagtgccagaggcggcggcggcggcgaccggatcatggcgcttctcctgtcggtggacggccgcataaggtgtgggggtgacatcgcgtcggtcgagctcgacggcgtgcggtgacctcctcggcggcgcgttctccctcctccctctcctcgag...
position 61
XR_001540355.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group uncharacterized LOC107278998 (LOC107278998), transcript variant X5, ncRNA. (1621 bp)
with support for all annotated introns" /db_xref="GeneID:107278998" ncRNA 1..1621 /ncRNA_class="lncRNA" /gene="LOC107278998" /product="uncharacterized LOC107278998, transcript variant X5" /db_xref="GeneID:107278998" ORIGIN // tccgccgcttacaggtgggtcccactccgcactgcaatcccttcccttccgcttcctctctcaatctcttcttgcctcgtctcttcccccaaatcgggcgaatcccaaatcaaccaaaccctagcccgcggcggccaccgcgatggccacctccacgcggctgcggcggcgacggccgcctccgccccttgcatgcctcccccaccgaggagcggtgtgccagtgccagaggcggcggcggcggcgaccggatcatggcgcttctcctgtcggtggacggccgcataaggtgtgggggtgacatcgcgtcggtcgagctcgacggcgtgcggtgacctcctcggcggcgcgttctccctcctccctctcctcga...
position 62
XR_003238986.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group uncharacterized LOC107278998 (LOC107278998), transcript variant X3, ncRNA. (1693 bp)
with support for all annotated introns" /db_xref="GeneID:107278998" ncRNA 1..1693 /ncRNA_class="lncRNA" /gene="LOC107278998" /product="uncharacterized LOC107278998, transcript variant X3" /db_xref="GeneID:107278998" ORIGIN // tccgccgcttacaggtgggtcccactccgcactgcaatcccttcccttccgcttcctctctcaatctcttcttgcctcgtctcttcccccaaatcgggcgaatcccaaatcaaccaaaccctagcccgcggcggccaccgcgatggccacctccacgcggctgcggcggcgacggccgcctccgccccttgcatgcctcccccaccgaggagcggtgtgccagtgccagaggcggcggcggcggcgaccggatcatggcgcttctcctgtcggtggacggccgcataaggtgtgggggtgacatcgcgtcggtcgagctcgacggcgtgcggtgacctcctcggcggcgcgttctccctcctccctctcctcga...
position 62
XR_003238985.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group uncharacterized LOC107278998 (LOC107278998), transcript variant X6, ncRNA. (1737 bp)
with support for all annotated introns" /db_xref="GeneID:107278998" ncRNA 1..1737 /ncRNA_class="lncRNA" /gene="LOC107278998" /product="uncharacterized LOC107278998, transcript variant X6" /db_xref="GeneID:107278998" ORIGIN // ttccgccgcttacaggtgggtcccactccgcactgcaatcccttcccttccgcttcctctctcaatctcttcttgcctcgtctcttcccccaaatcgggcgaatcccaaatcaaccaaaccctagcccgcggcggccaccgcgatggccacctccacgcggctgcggcggcgacggccgcctccgccccttgcatgcctcccccaccgaggagcggtgtgccagtgccagaggcggcggcggcggcgaccggatcatggcgcttctcctgtcggtggacggccgcataaggtgtgggggtgacatcgcgtcggtcgagctcgacggcgtgcggtgacctcctcggcggcgcgttctccctcctccctctcctcg...
position 63
XR_003238987.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group uncharacterized LOC9266982 (LOC9266982), mRNA. (1924 bp)
caatgtgcaggagataaaaataagtccaggaatcatgctcttgatatatgaaagaacaccatgtcatgttcctttgaagatattgtcaattgaagatggaagaccactaaaatccttcacgcatttgttgcaccgtaataagaaaattgattttatcgagcaattcaatgaaaagctccttgtcaagcaagaagatgagaaccttcagatacttgatgtacggagttctgagctaattgaagtcagtgttaccaagtttatgactccatcagcattcatttttctgtacgagaacaatctcttcttgacattccgaaacaggacggttgctgtatggaattttcgaggagagctcgtgacctcatttgaagaccatttgctttggcatcaagattgtagcaccaacaatatctacattaccagtgatcaggatctgattatctcatactgcaaatctgaggcaggggttgatgatggtacagtacctccaattgggtctatcaacatgagtgacattatgactggcaaatgcatcgccaagattgctgctaatgatcccaccctccgtattggccctcgcaagaatggtaactctgagag...
position 1198
XM_015765258.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group uncharacterized LOC107278998 (LOC107278998), transcript variant X2, ncRNA. (1989 bp)
with support for all annotated introns" /db_xref="GeneID:107278998" ncRNA 1..1989 /ncRNA_class="lncRNA" /gene="LOC107278998" /product="uncharacterized LOC107278998, transcript variant X2" /db_xref="GeneID:107278998" ORIGIN // tccgccgcttacaggtgggtcccactccgcactgcaatcccttcccttccgcttcctctctcaatctcttcttgcctcgtctcttcccccaaatcgggcgaatcccaaatcaaccaaaccctagcccgcggcggccaccgcgatggccacctccacgcggctgcggcggcgacggccgcctccgccccttgcatgcctcccccaccgaggagcggtgtgccagtgccagaggcggcggcggcggcgaccggatcatggcgcttctcctgtcggtggacggccgcataaggtgtgggggtgacatcgcgtcggtcgagctcgacggcgtgcggtgacctcctcggcggcgcgttctccctcctccctctcctcga...
position 62
XR_003238984.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group kinesin-like protein KIN-7K, chloroplastic (LOC4349100), mRNA. (3700 bp)
ggaatacagaaatccagaatttgaacctcttcttgttcgtctcaaggctaaaattcaagagatgaaggagaaggaaactgattccttgggtgacaaagatggaaattcccatgtctgcaaagtatgttttgaatctgccactgctgcagttttgcttccttgtcggcatttttgcttgtgcaagccttgctcgcttgcctgttcagaatgccctctatgccgtacaagaatcgcagacaggataattaccttcacctaaagtgcatgttatcttaaaaggtaacttgaagcacccaatctcttcttgtaaaatcatcagtggtatatgattcttttttcccctagcaaagaaggtgcctttttatgttccttctgtgtttgtatcccaattctttttttttttggtttgctctatagctttcccagttcaacctgttctttgttgtacgagaagttacaagatataacttctctgcaaatatgtatagatatgcgactcgacagtataatacatttgcttttttttttctcctttggcttttgggaagtaaagcaaccaaagaacatgagatccaagagacagagactggtacactttgc...
position 3389
XM_015759541.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group cadmium/zinc-transporting ATPase HMA2-like (LOC4341965), mRNA. (3942 bp)
gene="LOC4341965" /note="P-type heavy metal-transporting ATPase; Region: P-type_ATPase_HM; cd02079" /db_xref="CDD:319774" ORIGIN // aatcactcggcattgccattagcggtggcggtgatgcttgtcttcgtcatcgtccacatctcgttgatgcgtgctgccgactgccgagtgtcaccgaatccttaataaatactcctcctcgccaccttcgtctcctcctatccccgattcgcacagccaatctcttcttgcttcctcctcctcctcctccagccgccgccgccgacgacgattcttggtagagagattcttgcgttgttttacctgcgtcttgttcttcttgggagttgggtggatcgattgatcgaggttttggaggttggaagaagtgtgtgttgtggtggggggtttgtagagagagagagggcaaaggcacgcaaagagggagagagtgaggagagatggcggcggagggagggaggtgtcagaagagctacttcgacgtgctggggatttgctgcccgtcggaggttcccctcgtcgagaagc...
position 158
XM_015788173.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group starch synthase 3, chloroplastic/amyloplastic (LOC9268758), transcript variant X4, mRNA. (6282 bp)
aaaaccatggcagggttagactatgtttaacttatgacgagcctctctcacacctgatatatgctggctctgacttcatccttgttccatccatctttgaaccttgcggtttgactcaacttgttgccatgcgctatggatccatccctattgttcggaaaaccggaggactttacgacactgttttcgacgtagaccatgacaaagaccgggctcgagttctaggccttgaaccaaatgggttcagctttgatggagctgactgtaatggtgtggattacgccctgaacagagcaatctcttcttggtttgaagcccgcggttggttccactccctctgcaaaagggtcatggagcaagactggtcctggaaccggcctgccctggactacattgaactgtaccattcagctcacaaattttgaggcccccatccaacggtggcaagagaaagcaagcattggcagatactacaaattaaatgaaacatggctcaaagttaaaatattttatctgagctgcagatacaaattaactcaaacatggttcaaagttaagatcttttatctgagctacacatatatatgcagaataaagact...
position 5719
XM_015795185.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group starch synthase 3, chloroplastic/amyloplastic (LOC9268758), transcript variant X1, mRNA. (6462 bp)
aaaaccatggcagggttagactatgtttaacttatgacgagcctctctcacacctgatatatgctggctctgacttcatccttgttccatccatctttgaaccttgcggtttgactcaacttgttgccatgcgctatggatccatccctattgttcggaaaaccggaggactttacgacactgttttcgacgtagaccatgacaaagaccgggctcgagttctaggccttgaaccaaatgggttcagctttgatggagctgactgtaatggtgtggattacgccctgaacagagcaatctcttcttggtttgaagcccgcggttggttccactccctctgcaaaagggtcatggagcaagactggtcctggaaccggcctgccctggactacattgaactgtaccattcagctcacaaattttgaggcccccatccaacggtggcaagagaaagcaagcattggcagatactacaaattaaatgaaacatggctcaaagttaaaatattttatctgagctgcagatacaaattaactcaaacatggttcaaagttaagatcttttatctgagctacacatatatatgcagaataaagact...
position 5899
XM_015795182.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group starch synthase 3, chloroplastic/amyloplastic (LOC9268758), transcript variant X3, mRNA. (7797 bp)
aaaaccatggcagggttagactatgtttaacttatgacgagcctctctcacacctgatatatgctggctctgacttcatccttgttccatccatctttgaaccttgcggtttgactcaacttgttgccatgcgctatggatccatccctattgttcggaaaaccggaggactttacgacactgttttcgacgtagaccatgacaaagaccgggctcgagttctaggccttgaaccaaatgggttcagctttgatggagctgactgtaatggtgtggattacgccctgaacagagcaatctcttcttggtttgaagcccgcggttggttccactccctctgcaaaagggtcatggagcaagactggtcctggaaccggcctgccctggactacattgaactgtaccattcagctcacaaattttgaggcccccatccaacggtggcaagagaaagcaagcattggcagatactacaaattaaatgaaacatggctcaaagttaaaatattttatctgagctgcagatacaaattaactcaaacatggttcaaagttaagatcttttatctgagctacacatatatatgcagaataaagact...
position 7234
XM_015795184.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group starch synthase 3, chloroplastic/amyloplastic (LOC9268758), transcript variant X2, mRNA. (7977 bp)
aaaaccatggcagggttagactatgtttaacttatgacgagcctctctcacacctgatatatgctggctctgacttcatccttgttccatccatctttgaaccttgcggtttgactcaacttgttgccatgcgctatggatccatccctattgttcggaaaaccggaggactttacgacactgttttcgacgtagaccatgacaaagaccgggctcgagttctaggccttgaaccaaatgggttcagctttgatggagctgactgtaatggtgtggattacgccctgaacagagcaatctcttcttggtttgaagcccgcggttggttccactccctctgcaaaagggtcatggagcaagactggtcctggaaccggcctgccctggactacattgaactgtaccattcagctcacaaattttgaggcccccatccaacggtggcaagagaaagcaagcattggcagatactacaaattaaatgaaacatggctcaaagttaaaatattttatctgagctgcagatacaaattaactcaaacatggttcaaagttaagatcttttatctgagctacacatatatatgcagaataaagact...
position 7414
XM_015795183.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/os/comp%3acaagaagagattg
lang : en | div : | spe : os | query_string : comp:caagaagagattg | format : html | download :

0.000 | 0.000 | search_start;
0.077 | 0.077 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:caatctcttcttg)?source=Oryza sativa Japonica Group (Japanese rice)?to=0&format=json
0.104 | 0.027 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:caatctcttcttg)?source=Oryza sativa Japonica Group (Japanese rice)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.106 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]