GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2022-10-05 18:38:47, GGRNA : RefSeq release 213 (Jul, 2022)



Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Ostrea edulis uncharacterized LOC125647975 (LOC125647975), ncRNA. (1711 bp)
position 115 242 370 753 903 1196
XR_007360156.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125663522 (LOC125663522), ncRNA. (1778 bp)
position 635 762 890 1274 1425 1718
XR_007365579.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125654871 (LOC125654871), ncRNA. (2329 bp)
position 24 170 469 597 981 1108
XR_007362497.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125673183 (LOC125673183), ncRNA. (3176 bp)
position 143 290 568 695 950 1204
XR_007369295.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125652259 (LOC125652259), ncRNA. (3653 bp)
position 73 219 366 517 645 1029 1156
XR_007361522.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125670802 (LOC125670802), transcript variant X2, mRNA. (4970 bp)
position 2163 2309 2456 2735 2863 3247 3374
XM_048906190.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125670802 (LOC125670802), transcript variant X3, mRNA. (5005 bp)
position 2198 2344 2491 2770 2898 3282 3409
XM_048906191.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125670802 (LOC125670802), transcript variant X1, mRNA. (5012 bp)
position 2205 2351 2498 2777 2905 3289 3416
XM_048906189.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125668390 (LOC125668390), ncRNA. (3689 bp)
position 1652 1779 1907 2034 2162 2313
XR_007367554.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis metallo-beta-lactamase domain-containing protein 1-like (LOC125659624), transcript variant X3, mRNA. (4438 bp)
position 2880 3026 3173 3452 3964 4091
XM_048891361.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis metallo-beta-lactamase domain-containing protein 1-like (LOC125659624), transcript variant X2, mRNA. (4456 bp)
position 2898 3044 3191 3470 3982 4109
XM_048891360.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125669815 (LOC125669815), transcript variant X2, mRNA. (3150 bp)
position 2204 2350 2497 2776 2904
XM_048904619.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis metallo-beta-lactamase domain-containing protein 1-like (LOC125659624), transcript variant X1, mRNA. (4482 bp)
position 2924 3070 3217 3496 4008 4135
XM_048891359.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125669815 (LOC125669815), transcript variant X1, misc_RNA. (3165 bp)
position 2204 2350 2497 2776 2904
XR_007368028.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125653567 (LOC125653567), transcript variant X2, ncRNA. (3431 bp)
position 164 315 443 571 1084 1211
XR_007361969.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125653567 (LOC125653567), transcript variant X3, ncRNA. (3526 bp)
position 164 315 443 571 1084 1211
XR_007361970.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125658783 (LOC125658783), ncRNA. (697 bp)
position 99 227 506
XR_007363811.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125653567 (LOC125653567), transcript variant X1, ncRNA. (3593 bp)
position 164 315 443 571 1084 1211
XR_007361968.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125651708 (LOC125651708), transcript variant X4, ncRNA. (5474 bp)
position 1665 1811 1958 2109 2237 2621 2748
XR_007361329.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125651708 (LOC125651708), transcript variant X3, ncRNA. (5477 bp)
position 1668 1814 1961 2112 2240 2624 2751
XR_007361328.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125651708 (LOC125651708), transcript variant X2, ncRNA. (5545 bp)
position 1736 1882 2029 2180 2308 2692 2819
XR_007361327.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125651708 (LOC125651708), transcript variant X1, ncRNA. (5548 bp)
position 1739 1885 2032 2183 2311 2695 2822
XR_007361326.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125654002 (LOC125654002), ncRNA. (2945 bp)
position 693 918 1325 1616
XR_007362148.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125666634 (LOC125666634), mRNA. (4921 bp)
position 1431 1577 1724 1875 2003
XM_048899828.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis myeloid-derived growth factor-like (LOC125649568), mRNA. (4601 bp)
position 2336 2482 2629 2907 3418
XM_048877192.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125677398 (LOC125677398), ncRNA. (4443 bp)
position 3604 3731 3859 3987 4115 4266
XR_007371107.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125673632 (LOC125673632), transcript variant X2, ncRNA. (3877 bp)
position 577 870 1021 1277
XR_007369637.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis carboxypeptidase T-like (LOC125651525), transcript variant X2, mRNA. (6831 bp)
position 5163 5309 5457 5736 5864 6248 6375
XM_048880160.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis carboxypeptidase T-like (LOC125651525), transcript variant X1, mRNA. (7308 bp)
position 5640 5786 5934 6213 6341 6725 6852
XM_048880159.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis two pore channel protein 1-like (LOC125664453), mRNA. (7380 bp)
position 3688 3834 3981 4260 4388 4772 4899
XM_048897216.1 - Ostrea edulis - NCBI
PREDICTED: Haliotis rufescens uncharacterized LOC124143575 (LOC124143575), transcript variant X2, mRNA. (3073 bp)
position 2225 2330
XM_046512601.2 - Haliotis rufescens (red abalone) - NCBI
PREDICTED: Ostrea edulis RING finger protein 145-like (LOC125658441), transcript variant X2, mRNA. (6215 bp)
position 4708 4854 5001 5515 5769 5896
XM_048889708.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis RING finger protein 145-like (LOC125658441), transcript variant X1, mRNA. (6347 bp)
position 4840 4986 5133 5647 5901 6028
XM_048889707.1 - Ostrea edulis - NCBI
PREDICTED: Haliotis rufescens uncharacterized LOC124143575 (LOC124143575), transcript variant X1, mRNA. (3634 bp)
position 2786 2891
XM_046512600.2 - Haliotis rufescens (red abalone) - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125678850 (LOC125678850), ncRNA. (2237 bp)
position 1770 2064 2215
XR_007371629.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125673264 (LOC125673264), transcript variant X4, mRNA. (8223 bp)
position 6454 6600 6747 6898 7026 7409 7537
XM_048909774.1 - Ostrea edulis - NCBI
PREDICTED: Sebastes umbrosus solute carrier family 45 member 3 (LOC119475566), mRNA. (4402 bp)
position 2181 2281 2540 2804
XM_037748436.1 - Sebastes umbrosus (honeycomb rockfish) - NCBI
PREDICTED: Sebastes umbrosus FXYD domain containing ion transport regulator 5 (fxyd5), transcript variant X1, mRNA. (1260 bp)
position 802 1063
XM_037785583.1 - Sebastes umbrosus (honeycomb rockfish) - NCBI
PREDICTED: Epinephelus lanceolatus cysteine-rich and transmembrane domain-containing protein 1-like (LOC117264835), mRNA. (1824 bp)
position 814 1056 1198
XM_033639127.1 - Epinephelus lanceolatus (giant grouper) - NCBI
PREDICTED: Ostrea edulis B-box type zinc finger protein ncl-1-like (LOC125679297), transcript variant X3, mRNA. (4689 bp)
position 3008 3159 3287
XM_048918411.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis multiple epidermal growth factor-like domains protein 6 (LOC125671590), mRNA. (6261 bp)
position 4263 4618 4894 5188
XM_048907403.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125658717 (LOC125658717), ncRNA. (416 bp)
method: Gnomon." /db_xref="GeneID:125658717" ncRNA 1..416 /ncRNA_class="lncRNA" /gene="LOC125658717" /product="uncharacterized LOC125658717" /db_xref="GeneID:125658717" ORIGIN // tcttagtattctaaatctttagttaagtcctaagaattcaaaaaagtaggtcaatgtgacctactttttggtttacacattttgagaacccaagaaatatcaactgacaaagtttgatgattttaagccaattagtatctgaatattgaaatatagctgtcaaattccaatcgtaggtcatggtgacctactttttgatcagcgaactccgaacatgcaagacccatcaactgacaaagtttgatgactgtaggtcaaatagtatctgaaatatataaatatagccgtccaattccaaaagtaggtcaagttgacctactttttggtcgaaacccttcgaacatgcaagacccaacaactgacaaagtttgatgactgtaggtcaaatagtatctgaaaatatataaatatagccg
position 48 175
XR_007363783.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125648501 (LOC125648501), ncRNA. (1444 bp)
uncharacterized LOC125648501" /experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:125648501" ORIGIN // aaaattcaaaaagtaggtcactgtgacctacttttttttaataaatatgtttcgaggcctctagacacatcaacttacaaggtttgatgattctaaacctctcggtatctgaaataacctaaaatgtattcataaatgattagccataaaattcagaaagtaggtcatggtgacatacttttcacatgacgcagttcaaagtcccatgatccatcaactgacaacttttgatgatcataggctcaaaagtgtccaagatatgcatcaaaatccatttaataataattacctgcgaaattcaaaaagtaggtcaccatgacctacttttgagacaacataatattaggtcctaagatgcatcaactgacaaaatttgatgatcctagtccttatactaaacaaaacatcaaagttttaacaaaacaaaatttaaggtcaactttgaagtgaccttgagaccacaccctttgccccag...
position 15 308
XR_007360320.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis DNA damage-induced apoptosis suppressor protein-like (LOC125647704), transcript variant X3, mRNA. (4897 bp)
position 1913 2209 2360 2744
XM_048874485.1 - Ostrea edulis - NCBI
PREDICTED: Gigantopelta aegis uncharacterized LOC121371050 (LOC121371050), mRNA. (1963 bp)
position 1741 1887
XM_041496673.1 - Gigantopelta aegis - NCBI
PREDICTED: Plectropomus leopardus palmitoyltransferase ZDHHC14-like (LOC121955303), transcript variant X3, mRNA. (2994 bp)
position 2449 2733
XM_042503186.1 - Plectropomus leopardus (leopard coralgrouper) - NCBI
PREDICTED: Plectropomus leopardus palmitoyltransferase ZDHHC14-like (LOC121955303), transcript variant X2, mRNA. (3358 bp)
position 2813 3097
XM_042503185.1 - Plectropomus leopardus (leopard coralgrouper) - NCBI
PREDICTED: Plectropomus leopardus palmitoyltransferase ZDHHC14-like (LOC121955303), transcript variant X1, mRNA. (3436 bp)
position 2891 3175
XM_042503184.1 - Plectropomus leopardus (leopard coralgrouper) - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125677350 (LOC125677350), transcript variant X2, ncRNA. (7903 bp)
position 4370 4517 4780 5156 5284
XR_007371039.1 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125659322 (LOC125659322), ncRNA. (2625 bp)
position 136 521 648
XR_007364022.1 - Ostrea edulis - NCBI

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI :
lang : en | div : | spe : | query_string : iubboth:aggtcannrtgacct | format : html | download :

0.000 | 0.000 | search_start;
0.127 | 0.127 | count_done;
1.232 | 1.105 | search_done;,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
1.297 | 0.065 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]