GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-12-06 04:50:53, GGRNA : RefSeq release 208 (Sep, 2021)



Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Mus musculus homeobox B8 (Hoxb8), transcript variant X3, mRNA. (2267 bp)
position 1837
Synonym: Hox-2.; Hox-2.4
XM_017314297.2 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
PREDICTED: Mus musculus homeobox B8 (Hoxb8), transcript variant X4, mRNA. (2453 bp)
position 2023
Synonym: Hox-2.; Hox-2.4
XM_011248758.3 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
PREDICTED: Mus musculus homeobox B8 (Hoxb8), transcript variant X2, mRNA. (2453 bp)
position 2023
Synonym: Hox-2.; Hox-2.4
XM_017314296.2 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
PREDICTED: Mus musculus homeobox B8 (Hoxb8), transcript variant X1, mRNA. (2456 bp)
position 2026
Synonym: Hox-2.; Hox-2.4
XM_017314295.2 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI :
lang : en | div : | spe : mm | query_string : CCAACAACAUGAAACUGCCUA | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; musculus (house mouse)?to=0&format=json
0.103 | 0.016 | search_done; musculus (house mouse)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.104 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]