GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2020-02-27 20:46:51, GGRNA : RefSeq release 98 (Jan, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens microRNA 5197 (MIR5197), microRNA. (112 bp)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 tatgggattccacagacaatgagtatcaatggcacaaactcattcttgaagccagttcaagaagagactgagtcatcgaatgctctaaatgtcacttcacctcatgt
position 63
NR_049829.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 1500 (LINC01500), long non-coding RNA. (752 bp)
tgtgattaaggttaagaactttgagaagggaagattatcctggattatacaggtcgacgtttatttctttctgaactttcctggaggatcatcggccatactccagcagaagggtggatttgaaaaaataacgtttccacggcaacagtggcagcaattcaaaggaagacgttggagaattcacatgctattttagctggctctgtgattgcaatcacacaaatcattacattccagcgagatcccatcaacagaaggccatttcagtctgtcaagcaggcatgaatactgtaagcaagaagagaaaagttacaataaattgacatttatagttgaa
position 711
NR_110547.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 491 (LINC00491), transcript variant 4, long non-coding RNA. (1513 bp)
ccctagtgagatgaacccggtacctcagatggaaatgcagaaatcaccagtcttctgcgtcgctcacgctgggagctgtagaccggagctgttcctattcggccatcttgtctcctcccgtgaactggaaattccctgtctccccttaaccagcactggaagcagatgggaagagaatagctgtgactgactcacactctaacccagcaaccctcagcatacaagtgggagaccataaagcaagaccccaaaagaggccaaaggtctgataattgctgggagaaggtccactatccaagaagagaagaggaaaaggaattaaagtctccaagcactggggatgcaagaagagagttgcacaggagagaaagaagaagttgtccacggggtgaccctgcaattggagggaaatgcatgtggatatgtgcagggagtctaggaagtgaagccttagtgatcatttacaagaatgagggttaggtaaaataagggatgcaaagccacctgtagtctattctaacctcactccatcactctatacaatctgtgttttatcatctgaaatgttaagtaaagacctgtttgggtcttcttcagaat...
position 417
NR_103756.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 491 (LINC00491), transcript variant 3, long non-coding RNA. (1584 bp)
ggagctgtagaccggagctgttcctattcggccatcttgtctcctcccgtgggcttttggctcaattctgaataaacagtgaacatccatgtgggagcaatgaggaggaactgtagcatctgaactggaaattccctgtctccccttaaccagcactggaagcagatgggaagagaatagctgtgactgactcacactctaacccagcaaccctcagcatacaagtgggagaccataaagcaagaccccaaaagaggccaaaggtctgataattgctgggagaaggtccactatccaagaagagaagaggaaaaggaattaaagtctccaagcactggggatgcaagaagagagttgcacaggagagaaagaagaagttgtccacggggtgaccctgcaattggagggaaatgcatgtggatatgtgcagggagtctaggaagtgaagccttagtgatcatttacaagaatgagggttaggtaaaataagggatgcaaagccacctgtagtctattctaacctcactccatcactctatacaatctgtgttttatcatctgaaatgttaagtaaagacctgtttgggtcttcttcagaat...
position 488
NR_103755.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 491 (LINC00491), transcript variant 2, long non-coding RNA. (1647 bp)
aattctgaataaacagtgaacatccatgtgggagcaatgaggaggaactgtagcatctggaacagtccaaaaaggaagctgggagtcagcccatcacgaggttgcttgatcagaatcacatgaactggaaattccctgtctccccttaaccagcactggaagcagatgggaagagaatagctgtgactgactcacactctaacccagcaaccctcagcatacaagtgggagaccataaagcaagaccccaaaagaggccaaaggtctgataattgctgggagaaggtccactatccaagaagagaagaggaaaaggaattaaagtctccaagcactggggatgcaagaagagagttgcacaggagagaaagaagaagttgtccacggggtgaccctgcaattggagggaaatgcatgtggatatgtgcagggagtctaggaagtgaagccttagtgatcatttacaagaatgagggttaggtaaaataagggatgcaaagccacctgtagtctattctaacctcactccatcactctatacaatctgtgttttatcatctgaaatgttaagtaaagacctgtttgggtcttcttcagaat...
position 551
NR_103754.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 491 (LINC00491), transcript variant 1, long non-coding RNA. (1662 bp)
tactagtgaactaggataatccattgtgtatctcaacctccttcactaccctgtgaaagtcacatgtgagaagaagcatcacagatgattccatggagaacatcctggaagttctccaaatgaactggaaattccctgtctccccttaaccagcactggaagcagatgggaagagaatagctgtgactgactcacactctaacccagcaaccctcagcatacaagtgggagaccataaagcaagaccccaaaagaggccaaaggtctgataattgctgggagaaggtccactatccaagaagagaagaggaaaaggaattaaagtctccaagcactggggatgcaagaagagagttgcacaggagagaaagaagaagttgtccacggggtgaccctgcaattggagggaaatgcatgtggatatgtgcagggagtctaggaagtgaagccttagtgatcatttacaagaatgagggttaggtaaaataagggatgcaaagccacctgtagtctattctaacctcactccatcactctatacaatctgtgttttatcatctgaaatgttaagtaaagacctgtttgggtcttcttcagaat...
position 566
NR_103753.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 2620 (LINC02620), long non-coding RNA. (1014 bp)
gene="LINC02620" /replace="g" /replace="t" /db_xref="dbSNP:1420081411" variation 1011 /gene="LINC02620" /replace="c" /replace="t" /db_xref="dbSNP:1047866110" variation 1013 /gene="LINC02620" /replace="a" /replace="c" /db_xref="dbSNP:1243001703" ORIGIN // ggttgccaaatggtgttttgggctcttcttttcccaagaagagactagcccattgtcaccaatgcagagctggaagctgaaattgttaaggcagaatgaaagggagaaaagcacgtcctgagcaccaagaagaagataactcgaagttaagaagacgtgatggtactttggagaagaaagcaacacctgagtcaaattgcactgagcaacgttctttgttgttgtgagatattgataaatctccaggtcttcaacaaggggagtcgagaataggaaactcatttcaaatcatatctcaggtgacaagaaggttaccatatttgaggcagcctgttgggttgcctg...
position 35
NR_120624.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens family with sequence similarity 90 member A27, pseudogene (FAM90A27P), non-coding RNA. (496 bp)
TITLE The DNA sequence and biology of human chromosome 19 JOURNAL Nature 428 (6982), 529-535 (2004) PUBMED 15057824 ttacgacgaatgacagagaaaaggagcgaagtccaagtccccagcagcagcagagcgaagctccgacgcagacatttcccagaactccccaagagaaaatgcaggaagcctggaaggagccagcagaagattgtttgttcctgaggcatcctaccatgccactgcctgtccacaccaccaagaagagatctgtcctgggccctgtgtccacaggtccaccgcctgtcaacaaacccgagatgagattactctgcccttcgggtcacaacgattcacctcaactgagcacctgtggacccaccaaaggacatggcagggacgttactgcctccctgctccctgttctgaagagctcccaccagacccccactctcagtgccaggctgccagccaacaggcctgacatgtcctcccatggtgctctccagcctgccatgcaggcgcttgccctgggtcctggccttaaatcccaggcagaaatcaa...
position 179
NR_046365.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long non-coding RNA uc.134 (UC.134), long non-coding RNA. (1867 bp)
Online-Only REFERENCE 2 (bases 1 to 1867) AUTHORS Bejerano G, Pheasant M, Makunin I, Stephen S, Kent WJ, Mattick JS and Haussler D. TITLE Ultraconserved elements in the human genome JOURNAL Science 304 (5675), 1321-1325 (2004) PUBMED 15131266 gccatagactattttctctaagcttatgagccgaaacataatatgcttacaagaagagacattagaactcataactttatactgactaatgttcaaatacaattatgttaggtatccatttgcttctgacatcacaaaagaacagatcacaaaagacttggacttaagctgtctgcttttccttgcataataagtcccctggttcagggaatccagtcattatagaatttagcctaactgcttctaatccatgtaggacattaaagatgaaaactagtaaagaattaaccatgagaggaaataaaagattaattcaagtcagtcatcaccgtatctatatcttaagaagttaatagt...
position 50
NR_148407.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), transcript variant 8, non-coding RNA. (1033 bp)
acatgtatctggagagaggagaaccagcctggggactcaagatatattaaagactatgctcatggacatcaattctttcctgtcctttagggcagtattcaggccacacggttcaataacgggaaagaatgtcgtcacatgattgcatcatgttcttcaaaatgaaatctattgaacagtataaacaacaaagaacatcatttgtcagaatgacctgggggaaatagtccagtgaaactaagcaaagggaactttataccgtgagggaaaatcaatggattgtaacagaaccctgcaagaagagacatagctttcaagttccagagacctagaggtgactgagaagcaggatgtaccagaaactgggcttcttgttctacttatctagcgcccttttcacagtgttgtatatgtaaataaataataaagcagtgtgaaaaaaaaaaaaaaaa
position 872
NR_144386.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 2136 (LINC02136), long non-coding RNA. (529 bp)
tgcagccccttgcactcgcggagtcatctacgcaaggtcgggctctgcaggcagcagcttctggtctcaccccgggcttgtgcgcacacctggggacatgtgggaaggtcgctcttgcggccactgagcggcctggcctcagggaacgagccccgcgccgggaagaaagctgcctgccgggagcgcagcctattggggacccgggacccgagccaccgcggctcaccaagaggcggtggggccctgcggtgcgtgtgggacgccgggcaggcagactctgagcacggccaggaggcaagaagagattgaagggaaatctcaaggggctccagagactactacgatggtgcaaagtcacagaagccctgggaaaagcaggtagaatggagttgccatgacattgagcctcacctagatgccagttccagatattggcagactgctggcctcctgaggagcacaggaaggggcctggcagactggtgatcctggttggagatgaagaggggctgatta
position 309
NR_146574.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 1841 (LINC01841), long non-coding RNA. (573 bp)
of putative alternative promoters of human genes JOURNAL Genome Res. 16 (1), 55-65 (2006) PUBMED 16344560 acgagcgggggtggggaagagaagagggcacagaggccagcggatgagagagacaccagggagcctgggatgcctgcccgaggctctggccacgcccatgccctgcctgtcccgctaagcacacagaggaaaggccatgtgaggacacagcaagaaggcggccatctgcaagccaagaagagagtcctcaccaggaaccaactctgctgacaccttgctgttggacttccagcctctataaatgttcacaagcacaccactgtttacacccatctagaaggcccctcccagctgacatctttctgcctacctttcaggaagacagacgaaactctctgccttcaggtggggcaagactgctgatggctggaacaggagcttggcacctccaccctgacccagacacaagcctgtctgtcccactcaaatcgagctggccagagactacaactgtgttggttcccaagacatagaaaagccagaagaggtcgggc...
position 174
NR_134908.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ZNF649 antisense RNA 1 (ZNF649-AS1), long non-coding RNA. (580 bp)
of human genes JOURNAL Genome Res. 16 (1), 55-65 (2006) PUBMED 16344560 gatgcaatatgtctgcgcccaggggacgcttgctgggagcagccattttcaaccctactgccgtagagcaggcggagtccctcttttcgcgccttaagacagaaacacaaaatgatcctctgacaagtgatgaagaagaatgggaagatgtgaaaatccaagcaagaagaacttaggggaagcaactcaacatctaagaagaaatgaatagggatcagttccaagaagagataaaggggaaatacccaagaactgggatgcttcgtctttggtttcttctggatcctccctaaattttggctaagaaatctgagtctccatttaagagtgttcccagaaatgatgacatccacatccaggaacctcctccttccttcatttgaactctcttgcttctggggagccaggacctatggagtaaaaatcaagttcatttggtgacacattccctccgggcccagatgctgtctctgctgctgtaaactctcctgcagtcaaggccaagcaatatatctaagcatccctttg...
position 222
NR_110733.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens BIRC6 antisense RNA 2 (BIRC6-AS2), long non-coding RNA. (601 bp)
atcatgccattgcactccagcctgggccacaagagtgaaactccgtctcaaaaaaattacagctgacccttgaacaacacaggtttgaactgcactagtccacttatatacagattttctgccagcctgagacagcaagaccaacctcatcacttcttcctcattaggctactcaacatgaagactctgagtatgaagacttttatgatgatccacttccatttaatgaacaatgaagacattttctgggaaaactggtacttctgtcatcactacagcagaagatgttaagaagcaagaagagaagaaaaagaagaatctatcttgactatgttaggtatagctggaacagtacttaacctcttagtgattgttttggtctacatccataccacactctgaaggtctcgttcaagggactgcattcagggcaaaacctggctctaacaagaaagatttagaaactatcctttaaaagcacacctccagaatattaagacatacatcccagggtaactcccttgctctaagagcaattactatatgatgcttccagtttgaggaataaaattataacaaagcaaaaaaaaaaaaaaa
position 300
Synonym: linc-birc6; megamind
NR_125793.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 237 (LINC00237), long non-coding RNA. (630 bp)
translocation suggests LINC00237 as a candidate gene for MOMO (macrosomia, obesity, macrocephaly, and ocular abnormalities) syndrome JOURNAL Am. J. Med. Genet. A 158A (11), 2849-2856 (2012) PUBMED 23034868 aaccggactgggctgcgcgcggagccccctcttcccgtgcacagtgcggggcgaggcttggcgagcggtgggtctgcgccttcccaagaagagactggggcagcatgaatgtgctggaagattagaggctgctgatgctgaaggaaggagaaacgaggaggaagtgtccctgtggacaagtcatctcccttcatttaagccagggaaggctgggaggtatgaatttgaagctggacacgttgctgctccccttaaagtttggattattttactaaagaagaagagaacaggtactgtgtaattaattggcaggaggagtttgctgccataaacacttgatgtgtgaatccacgctagttccctagcttctaagcctcagtttactcatctgtca...
position 85
Synonym: NCRNA00237
NR_147212.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), transcript variant 6, non-coding RNA. (1195 bp)
acatgtatctggagagaggagaaccagcctggggactcaagatatattaaagactatgctcatggacatcaattctttcctgtcctttagggcagtattcaggccacacggttcaataacgggaaagaatgtcgtcacatgattgcatcatgttcttcaaaatgaaatctattgaacagtataaacaacaaagaacatcatttgtcagaatgacctgggggaaatagtccagtgaaactaagcaaagggaactttataccgtgagggaaaatcaatggattgtaacagaaccctgcaagaagagacatagctttcaagttccagagacctagaggtgactgagaagcaggatgtaccagaaactgggcttcttgttctacttatctagcgcccttttcacagtgttgtatatgtaaataaataataaagcagtgtgaaaaaaaaaaaaaaaa
position 1034
NR_144385.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), transcript variant 7, non-coding RNA. (1200 bp)
acatgtatctggagagaggagaaccagcctggggactcaagatatattaaagactatgctcatggacatcaattctttcctgtcctttagggcagtattcaggccacacggttcaataacgggaaagaatgtcgtcacatgattgcatcatgttcttcaaaatgaaatctattgaacagtataaacaacaaagaacatcatttgtcagaatgacctgggggaaatagtccagtgaaactaagcaaagggaactttataccgtgagggaaaatcaatggattgtaacagaaccctgcaagaagagacatagctttcaagttccagagacctagaggtgactgagaagcaggatgtaccagaaactgggcttcttgttctacttatctagcgcccttttcacagtgttgtatatgtaaataaataataaagcagtgtgaaaaaaaaaaaaaaaa
position 1039
NR_144387.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens pseudouridine synthase like 1 (PUSL1), transcript variant 3, non-coding RNA. (1238 bp)
variation 1112 /gene="PUSL1" /replace="a" /replace="g" /db_xref="dbSNP:1246621828" variation 1114 /gene="PUSL1" /replace="a" /replace="g" /db_xref="dbSNP:968112460" variation 1115 /gene="PUSL1" /replace="c" /replace="t" /db_xref="dbSNP:147996649" variation 1116..1135 /gene="PUSL1" /replace="accaagaagagagtaccaag" /replace="accaagaagagagtaccaagaagagagtaccaag" /db_xref="dbSNP:374360798" variation 1116 /gene="PUSL1" /replace="a" /replace="g" /db_xref="dbSNP:1305817724" variation 1117 /gene="PUSL1" /replace="c" /replace="t" /db_xref="dbSNP:906933237" variation 1120 /gene="PUSL1" /replace="a" /...
position 1118
NR_144369.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens chromosome 6 open reading frame 52 (C6orf52), transcript variant 2, mRNA. (701 bp)
DE, Schnerch A, Schein JE, Jones SJ and Marra MA. CONSRTM Mammalian Gene Collection Program Team TITLE Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences JOURNAL Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002) PUBMED 12477932 gattttccaagaagagaataagtaaagatgccacatgaggaggttctcactgcaaggagaaaaaaatcgggggcaagcaggcatatctcaggaagtctcccctctgctattagagtgaagcaggagttccagcccagccagagttaccgctatggcaactggtatgcgcgacagcacggctcttaccttctttctggctacagctatggctgtgcagtggatggaaatggaaaggactgctgcgcatgagacccctgaacacacagctggaactctggttatgcctaagtgaccccctgtgccatctgcctgccatcctg...
position 8
NM_001354357.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 2328 (LINC02328), long non-coding RNA. (750 bp)
tgctgtggtccacagcttcattccttgaagcccgtgagacacgaacgcttccattgagaaaaaccttccatcagaagaagacttctcgtctcagtgggactgctgagttgaatggtgcctgaagctttggtagtgtaactgtaagagtcctggaattggaaaagcaaatccagaagttgagttccatgacgctgtttgcctttggacttgcatcatttataaattcatcgaggatgagaaaattgattaacacaaaatcttttcatgtcttttctgatgagagactagctgaatccaagaagagaagcccttgaagagtgtattctattctagacaagcattcacacattggcttctttggtgccagattaaagaatgaagaaaggatcaaattgagacatccaggggggaagagttccctggcaaaactccaatctgcctgagcactgaggtggagccacagaagtccgggtcatttgcacctgggaggagcctggcccctcctcttcctgtgtggaatctgggatttaatctgtgaggagggaaggccaagggcaggaagcacaggctctcacttcactaagagtctctgtttccccc...
position 385
NR_110155.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens uncharacterized LOC105374972 (LOC105374972), transcript variant 2, long non-coding RNA. (758 bp)
tcattctttgccctatgttatatggcttagaccaaagcctgagacatttaaccaatttataaatattaaatgcagaaggcatactttatcagttcctggaaacatcaaagaagctggaaggggaatggaaattggatggcactttgtggaggtcactttgctgacagtcaagtattcaaagatctcctaagatacccggtctttaaagtattatacaaaatatcaggcccagtcccaaggcgcaacttgtgccagcagcccgcgccagcagcctgcaccagcaaaatagcagtagcaagaagagagccagcagaagacacctaccctggccggaagacgcgtacccctgaagattgaggaagaggccatccgggtacaacgtagcagttacgtcagactaagacacttcctgtttataggagactataaaacctttgccctgtcctcactaggggctgacaccattttagtcctcagaccgcctgcacccaggcgctcattaaaacagcatgttgcttccaccgcctcatgttgtctgttggcgcgctctcggggttcgaaccagtacaagaaccttagatatatgatactgcacctaat...
position 319
NR_134614.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens pseudouridine synthase like 1 (PUSL1), transcript variant 1, mRNA. (1343 bp)
variation 1239 /gene="PUSL1" /replace="a" /replace="g" /db_xref="dbSNP:1246621828" variation 1241 /gene="PUSL1" /replace="a" /replace="g" /db_xref="dbSNP:968112460" variation 1242 /gene="PUSL1" /replace="c" /replace="t" /db_xref="dbSNP:147996649" variation 1243..1262 /gene="PUSL1" /replace="accaagaagagagtaccaag" /replace="accaagaagagagtaccaagaagagagtaccaag" /db_xref="dbSNP:374360798" variation 1243 /gene="PUSL1" /replace="a" /replace="g" /db_xref="dbSNP:1305817724" variation 1244 /gene="PUSL1" /replace="c" /replace="t" /db_xref="dbSNP:906933237" variation 1247 /gene="PUSL1" /replace="a" /...
position 1245
NM_001346116.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 1584 (LINC01584), long non-coding RNA. (863 bp)
Genome-wide contribution of genotype by environment interaction to variation of diabetes-related traits JOURNAL PLoS ONE 8 (10), e77442 (2013) PUBMED 24204828 REMARK Publication Status: Online-Only agttgagtgtgaagacctgaggtatcaggggtaggggttgctctgcttgtgtaagtcccatagtgtgaaggccagagaaccaagagatggtcaagaagagagagagcatcacgacctgtgcagactccccagcatcataacaggaaggtcccacgatcacgagcacattgccttcagcatccagcactgaatatggtgaattgcactctgaagagcttcctaagcttgtaagaaagtgattctgaaaagctcaacattttggtagaatggagagatttgacattgcttctgctccaaaagcaaaagacttgggaagggcaccctgggagttgagaacatccaccacagagaggcctggcgtaaaggagatgggactcacacccaagaggatgcatttccata...
position 92
NR_120368.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microfibril associated protein 3 like (MFAP3L), transcript variant 5, non-coding RNA. (535 bp)
cancer cell invasion and metastasis JOURNAL Biochim. Biophys. Acta 1842 (9), 1423-1432 (2014) PUBMED 24735981 REMARK GeneRIF: MFAP3L activation promotes colorectal cancer cell invasion and metastasis. actgtgaggcctctcacggtgggacccaggctttgggtagctggctccatgctctagcaaagcctcacttagcagtggggaggtcccaagaagagaagcgagatacccatataaagcaagcctgcttagccttccagggtccttcaaatcttaccaaatgaaagccagcttgctccacctactgtcaagccagcatctcattctccccattcttgtctcttaaacaactactcaaaaaaggagagccatgaaagtcaccagcctagaaaattacagtcgacttcatgagcttcatttggatttctcatcatgcaatagcaaagtcacagttattcctactgagatcacaatgatgctgccagagcctcccctgagcttgagagccctcctcttctaagc...
position 87
Synonym: NYD-sp9
NR_125890.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens SUZ RNA binding domain containing 1 pseudogene (LOC100130075), non-coding RNA. (1058 bp)
caccagcaacggtgtggtcagcagccccaagtccgctagcaggcccgcccttccagtcaagtccctggcacagtgggaagccgagtacaccgaggccaggaagcggatcctgggcagcgccaacccgaggagaagcaggagaaacccatcctcgataggtcttcctctgatcttcttcccttcaggccaaccaggatctcctaacccgaagacagcagacagcccaataatgtgatcagacagcctctgggtcctgatgggtcacacggcttcaaacagcgcagataaatgcaggcaagaagagatggcgcgactgccgcgtcaacgcgtcctgggtcgtccgccaagggttgcactaccgtggcagacagctggacttgagcagcgggaacttgacttacttgcctggtgatccccgttgctccgcccactgtgaccttgaatcccatgcactgtgacctccccccttctcctccttcccactgtgattggcactttgacaaggactgtcccaagtcaatggaaagggaaaaagggtgagggttaggagaaggttggggggaacccaccaattactcagagtagagagtcagacagggc...
position 499
NR_073494.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 2446 (LINC02446), transcript variant 2, long non-coding RNA. (1080 bp)
LINC02446" /replace="a" /replace="g" /db_xref="dbSNP:1289257608" variation 1077 /gene="LINC02446" /replace="a" /replace="c" /db_xref="dbSNP:1178994164" ORIGIN // gcttggcccactctcactctgtggagtgtacatttgtttccataaatctgtgccattgttttgtttgtgcatttcatccaattgtttgttcaaaatgccaagaatctggacaccctccaccagtaacaggcaagaagagaatagaggcaaagcaagccactccagaagtcctctagccagctttgtctttagtttgatggccagagaggaaatccaagccaaaagctccttttggagacaagaatattctgacagcacctcctacgatgtgacagagtcaaagaagaaaatatacaagagaactctgctatagaaaattacaaattcaaaccatgggaaaatggggaatagaaaaattatctctttagacagagaaaagattataaatactgaaaattgtcatttctataaatgtcattgctcttctgttttacattg...
position 140
NR_146456.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens CD8b molecule (CD8B), transcript variant 4, mRNA. (924 bp)
tctactggctgagacagcgccaggcaccgagcagtgacagtcaccacgagttcctggccctctgggattccgcaaaagggactatccacggtgaagaggtggaacaggagaagatagctgtgtttcgggatgcaagccggttcattctcaatctcacaagcgtgaagccggaagacagtggcatctacttctgcatgatcgtcgggagccccgagctgaccttcgggaagggaactcagctgagtgtggttgatttccttcccaccactgcccagcccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccagagacccagaagggccggcggaggagagcccggcttcgtttcatgaaacagcctcaaggggaaggtatatcaggaacctttgtcccccaatgcctgcatggatactacagcaatactacaacctcacagaagctgcttaacccatggatcctgaaaacataggcaagaagcacaggtcctgatgagtggatctttactacttttaccagattcctccctcgctcagagggatcctcccacacacccagcagagacttctctgccaccatcaacc...
position 471
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_172102.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens CD8b molecule (CD8B), transcript variant 6, mRNA. (944 bp)
tctactggctgagacagcgccaggcaccgagcagtgacagtcaccacgagttcctggccctctgggattccgcaaaagggactatccacggtgaagaggtggaacaggagaagatagctgtgtttcgggatgcaagccggttcattctcaatctcacaagcgtgaagccggaagacagtggcatctacttctgcatgatcgtcgggagccccgagctgaccttcgggaagggaactcagctgagtgtggttgatttccttcccaccactgcccagcccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccagagacccagaagggcctcaaggggaaggtatatcaggaacctttgtcccccaatgcctgcatggatactacagcaatactacaacctcacagaagctgcttaacccatggatcctgaaaacataggcaagaagcacaggtcctgatgagtggatctttactacttttaccagattcctccctcgctcagagggatcctcccacacacccagcagagacttctctgccaccatcaaccccccaagtcatagggggctcaagttctgccctggtga...
position 509
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_001178100.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 2240 (LINC02240), long non-coding RNA. (1353 bp)
tgacatcatgttttccctccccaaagaagccaccaaatggcaacacataattagtatgaaataacactattcagaacaattcttaggtgctaaatactttgttatctacaaagaacacatatttgaaaaacgtcaacttttgaaaagactcaaatagagtgtttgaatatgtgtcatgtttagaatctggtctgtttcatagggaatgttcttgctgtcaataccactgtgtgttacctcttcactgggaaggagtccatatgtctcagatttgcccttgaccacagacatttgccaagaagagacaagaaatgtgtcctcatttgtacagatgtacggagaagaaagctcatcattttcaaaaaacaactaaaatgccttctctgtactgaacattatgtgtgtggattacagagtggaataagagggatgcaacctggccttaataagggagaggtgttcatggcacacgtatacctttgtaacaaacctgcacattctgcacatgcatctcagaacttaaagtaaaataaaaaataaaaataaagaagtgaaaaaaaaaaaaaaaaaa
position 1078
NR_109887.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens uncharacterized LOC105374924 (LOC105374924), transcript variant X3, ncRNA. (193 bp)
dbSNP:1254737885" variation 178 /gene="LOC105374924" /replace="a" /replace="g" /db_xref="dbSNP:907775032" variation 192 /gene="LOC105374924" /replace="a" /replace="g" /db_xref="dbSNP:1472753202" ORIGIN // cagagctagactgcagaagaaaaagagaaagagaggggagaagaggtcaagtgtggaaacagcaagaaggctgctgtctgcaagccaagaagagagccctcgccagaaaccaaattatccagaccctggatattggatttccagcctccagaatgatacggctaagaccgcaggcatggtggcatgcagccgg
position 86
XR_002959113.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens uncharacterized LOC105374924 (LOC105374924), transcript variant X3, ncRNA. (193 bp)
dbSNP:1254737885" variation 178 /gene="LOC105374924" /replace="a" /replace="g" /db_xref="dbSNP:907775032" variation 192 /gene="LOC105374924" /replace="a" /replace="g" /db_xref="dbSNP:1472753202" ORIGIN // cagagctagactgcagaagaaaaagagaaagagaggggagaagaggtcaagtgtggaaacagcaagaaggctgctgtctgcaagccaagaagagagccctcgccagaaaccaaattatccagaccctggatattggatttccagcctccagaatgatacggctaagaccgcaggcatggtggcatgcagccgg
position 86
XR_926468.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens CD8b molecule (CD8B), transcript variant 2, mRNA. (1014 bp)
tctactggctgagacagcgccaggcaccgagcagtgacagtcaccacgagttcctggccctctgggattccgcaaaagggactatccacggtgaagaggtggaacaggagaagatagctgtgtttcgggatgcaagccggttcattctcaatctcacaagcgtgaagccggaagacagtggcatctacttctgcatgatcgtcgggagccccgagctgaccttcgggaagggaactcagctgagtgtggttgatttccttcccaccactgcccagcccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccagagacccagaagggcccactttgtagccccatcacccttggcctgctggtggctggcgtcctggttctgctggtttccctgggagtggccatccacctgtgctgccggcggaggagagcccggcttcgtttcatgaaacagcctcaaggggaaggtatatcaggaacctttgtcccccaatgcctgcatggatactacagcaatactacaacctcacagaagctgcttaacccatggatcctgaaaacataggcaagaagcacaggtcctgatg...
position 471
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_172213.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cancer susceptibility 8 (CASC8), transcript variant 2, long non-coding RNA. (1412 bp)
gggtctcccatgaccattttatttaagatttcaactactttgccagtatttcacttctcctcccttgatcttttcttccaagcactcactgccctcttgcacactgtatcttttacttatttatcttgttcagtttctgcctgcctcacctgcctcaccacagtgtacatttcacgagggcagggattttgtctgttttgttgattgctgtagccctggcatcttgggcagtgccagcacctgttagcattaaatacatatttactgaatgaatgagtggcttcatgcttaaaagcaagaagagagaccttcatagagaagtaggaaaatgaattgttgcacaaataaagggccatgtaatgagagagagagagcaagagaaagagcaaacaattaaggagcagcagtggcttcctgcaggggagaccaatgccttctgtcctcagcggaaacagcttggcattcttccaattgatgaatggcatggaccaggagcactagttatcttcagcttctgagcatccgaataaataaacatacaaatgcataacataaaataaattcaaattacaaatgagaaaaccaatctaggttaccggc...
position 416
Synonym: CARLo-1; CARLO1; LINC00860
NR_024393.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens testis expressed 47 (TEX47), mRNA. (1039 bp)
agaacaccagaggactggcagttgggagcctgatggaggacaagtagggcctcgaggacaggtgcgtgacagaagcacaggaaaaaaaagaaaaatgaagaaataaaaacacgagttcatcagtaaagaggtaccctggcagcataaatattatgataagctaaaagctggaatcatctggaaaaataaataagactcctcatgtccttttcggtccataaccagaagggcagcaaaaggcctttgccactggaacctcttcctccaagtcccacgtagcaattacctgcactttcaagaagagaaacaacgactacacctaaagaaattccttcttgataggatgtttctagtggccaagatacaagcaaatgtagaaagaaaagatgttgctgactactatgaacaaatgtttcagtcagttttgaaacatcacctaggagaagcagtgacaggattgctgctcatctatcccacttccattctgcatatcctcgagtcctccagcgacactctctacaaagttcttttagattatattggccatgtcaaagatgaaacagtaattcaacaaatgaaaattatagtcatttctcataa...
position 302
Synonym: C7orf62
NM_152706.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KRBOX1 antisense RNA 1 (KRBOX1-AS1), long non-coding RNA. (2142 bp)
accatgggcaaagtgagagcagtcagtttacccaagaaatattcatcccctgtccagcagagcttaacactgtcccaggaaaacagcatgactacatcaatcagagggaaaagtgtgattcgaaaaatcaagaaattcaccttctcacgatgtagaaaactgaaaagtgcatggcctcacccttacaacaacaaaaaacagccagataatctaaaattttctcttgaacacatcagaaagctaagatctgggggcaaacgacttaatctaaaatctgatgtaagacaggcactttcaagaagagatggttgtaagcacttgtttacataggacagatgccattggatgccatgtaagctgttaaggagaaatcagctaaaatgtttaatgagttgctgaggtccaagtgttggctagcctgagaatatagagactacagaactcctgtgaaccacagacacaagcagaatttccacccacttgtatattcttctctatggacatcatcaaatgtgtgcacacacacatacacacatacaattgaaggtaaggcaagaagaatcttatgaaaaccttcccgctagaaaagacatgaatccc...
position 1229
NR_122033.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens CD8b molecule (CD8B), transcript variant 3, mRNA. (1068 bp)
tctactggctgagacagcgccaggcaccgagcagtgacagtcaccacgagttcctggccctctgggattccgcaaaagggactatccacggtgaagaggtggaacaggagaagatagctgtgtttcgggatgcaagccggttcattctcaatctcacaagcgtgaagccggaagacagtggcatctacttctgcatgatcgtcgggagccccgagctgaccttcgggaagggaactcagctgagtgtggttgatttccttcccaccactgcccagcccaccaagaagtccaccctcaagaagagagtgtgccggttacccaggccagagacccagaagggcccactttgtagccccatcacccttggcctgctggtggctggcgtcctggttctgctggtttccctgggagtggccatccacctgtgctgccggcggaggagagcccggcttcgtttcatgaaacaactaagattacatccactggagaaatgttccagaatggactactgaatatacaggcctcaaggggaaggtatatcaggaacctttgtcccccaatgcctgcatggatactacagcaatactacaacctcacaga...
position 471
Synonym: CD8B1; LEU2; LY3; LYT3; P37
NM_172101.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens coiled-coil domain containing 191 (CCDC191), transcript variant 4, mRNA. (3815 bp)
atatgacaagtttgatgatttatgtggctatttggaggaagaagaggaaagtaccaccgttcaaaaatttatagaccatctgctccataaaaatgtggtagattctgcaatgatggaagatcttggaaggaaggaaaaccaagacaagaagcagcagaaggatcctcgtcttaccatggagatgagacataagcaggtaaaagaaaatcgcttaagacgtgagaaagaactggagtaccagagaatagaaaagaccctgaaaaaatcggccttcttggaggctcagtgtctggtgcaagaagagaagaaaaggaaggctctggaggccaagaaagaggaagaggagattcaaagggagatggtgaagctgcggagggagataattgagaggagacgcactgtgaaagcagcatggaaaatagagaagaaaaggcaagaagagaattctcaaaatagttcagaaaaagtcatgtttcaaagtactcacattcttccagatgaggaaaaaatggtgaaggaaagaaaaaggaaattgaaagaagtattaatccaaactttcaaagaaaatcaacagtgtcaaaaacggtatttcgctgcctg...
position 660
Synonym: KIAA1407
NM_001353767.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens long intergenic non-protein coding RNA 2495 (LINC02495), long non-coding RNA. (1485 bp)
c" /replace="t" /db_xref="dbSNP:925701795" ORIGIN // gagctgccggagcgtgcgcactgggccagcgggcggccggggcagggctggggtcccggcgctgagcgcccccagccgcgccgggcagcctggcgcctcgctgagtcggagcaacccccggcaggagctttcaggctctggtcaagcctcgggacccgggaagctatccctgccctcgggggctcgagcctggagtggggcttgcagaaaaggaaagggggctggcctaaaggcaagaagagaaaccccccgagggaccttgctgttccgtgttcctacgacagggtacatgatattcctgaatgagcagagaagtcagctgagggccacacaccccgatctgcctttcacagaaatcatgaagatgctggctgttcagtgggcccagctgtctcaggataaaaagggggagatgaactcaatgacctctactgcgggacctccaggcagctcttcagctccctgtgcaacaagaaggaacctgctgcaaaggcagcacctgcagcgcctctcaggtaaccagcctgggccaggcggctcagccgca...
position 234
NR_037863.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens G protein nucleolar 2 (GNL2), transcript variant 3, mRNA. (2217 bp)
gaccgggccaccatccggcgcctgaatatgtataggcaaaaggagcgcaggaacagtcgtggtaaaataattaaacccctgcaatatcaatcaacggtggcttctggcacagtggcaagagtagagccaaatattaaatggtttggaaacacacgtgtgattaagcagtcatcattacaaaaatttcaagaggaaatggatacagttatgaaggatccatacaaagttgtcatgaagcaaagcaagttaccaatgtctcttctccatgatcgaatccggcctcataaatgaagctcaagaagagatctataaaaagggacagtccaaaagaatatggggtgagctctacaaggtgatagattcatcagatgttgtagttcaagttcttgatgctagagatccaatgggtactcgttcccctcacattgaaacttacctgaagaaggaaaaaccttggaaacacctcagtacttaacaaatgtgaccttgttccaacctgggcaacaaaacggtgggttgctgtcctctcccaggattatccaacacttgctttccatgcaagccttactaacccgtttggcaagggagcattcattcagc...
position 558
Synonym: HUMAUANTIG; Ngp-1; NGP1; Nog2; Nug2
NM_001323624.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens transmembrane protein 25 (TMEM25), transcript variant 5, mRNA. (1546 bp)
ttccagccccaggcccctcccggcacccatctctgatatcaagtgactccaacaacctaaaactcaacaacgtgcgcctgccacgggagaacatgtccctcccgtccaaccttcagctcaatgacctcactccagattccagagtgaaaccagcagaccggcagatggctcagaacaacagccggccagagcttctggacccggagcccggcggcctcctcaccagccaaggaagaagaaatcaggacaaagacgcataacagagggaagaccatgggaagacacagaagatggccaagaagagacccctcagaagaaatcaatcttggtggggcgtggtggcttcacgcctgtaataccagcactgtgggaggttgaggtgggcagatcgcctgagcctaggagttcgagaccagcctgggcaacatggtgaaattccatctctacaaaaaaattagccgggtgtggtgttgagtatctgtagtcccagctacttgggaggctggggtgggaggactgcttgagtccagcaggttgaggctgcagtgagctgagattgagctactgcactccagcctgggcatagagtaataccctgta...
position 1131
NM_001144038.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens solute carrier family 25 member 51 (SLC25A51), transcript variant 1, mRNA. (1171 bp)
genes influence AIDS progression JOURNAL PLoS ONE 5 (9), e12862 (2010) PUBMED 20877624 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) Publication Status: Online-Only agtctgcgcctgcgcgggccccggctcgctagccgtcctgcgggacgccggcgctgatgggaaatccagttatcaaaattgactcaagaagagagaacctaacagaacaataacaatggaagaaattgggaacattatcacaaagctatcatcctgccaaactccaggctcagatgtcacaggttaaaaaaagtccttcatgaaaaagaaagatcttaagcagcatgatggattcagaagctcatgaaaagaggccaccaatactaacatcttcaaaacaagatatatcacctcatattacaaatgttggtgagatgaagcattacttgtgtggctgctgtgcagccttcaacaatgtcgcaatcacatttcccattcagaaggtcctctttcgacaac...
position 85
Synonym: CG7943; MCART1
NM_033412.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cancer susceptibility 8 (CASC8), transcript variant 1, long non-coding RNA. (1561 bp)
gggtctcccatgaccattttatttaagatttcaactactttgccagtatttcacttctcctcccttgatcttttcttccaagcactcactgccctcttgcacactgtatcttttacttatttatcttgttcagtttctgcctgcctcacctgcctcaccacagtgtacatttcacgagggcagggattttgtctgttttgttgattgctgtagccctggcatcttgggcagtgccagcacctgttagcattaaatacatatttactgaatgaatgagtggcttcatgcttaaaagcaagaagagagaccttcatagagaagtaggaaaatgaattgttgcacaaataaagggccatgtaatgagagagagagagcaagagaaagagcaaacaattaaggagcagcagtggcttcctgcaggggagaccaatgccttctgtcctcagcggaaacagcttggcattcttccaattgatgaatggcatggaccaggagcactagttatcttcagcttctgagcatccgaataaataaacatacaaatgcataacataaaataaattcaaattacaaatgagaaaaccaatctaggttaccggc...
position 416
Synonym: CARLo-1; CARLO1; LINC00860
NR_117100.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens uncharacterized LOC105374924 (LOC105374924), transcript variant X2, ncRNA. (341 bp)
dbSNP:924108649" variation 327 /gene="LOC105374924" /replace="c" /replace="t" /db_xref="dbSNP:1254737885" variation 330 /gene="LOC105374924" /replace="a" /replace="g" /db_xref="dbSNP:907775032" ORIGIN // cagagctagactgcagaagaaaaagagaaagagaggggagaagaggtcaagtgtggaaacagcaagaaggctgctgtctgcaagccaagaagagagccctcgccagaaaccaaattatccagaccctggatattggatttccagcctccagaatgctccttgaggtgcaactgcattacatttctactgaccagtactgtgccagattgatgaccagccaatacttgagtgtttatgatatggcagcagctgtttaaccacctaaaagtactgtagacctagcatacccacacttcctataagaaagatacggctaagaccgcaggcatggtggcatgcag
position 86
XR_002959112.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens uncharacterized LOC105374924 (LOC105374924), transcript variant X2, ncRNA. (341 bp)
dbSNP:924108649" variation 327 /gene="LOC105374924" /replace="c" /replace="t" /db_xref="dbSNP:1254737885" variation 330 /gene="LOC105374924" /replace="a" /replace="g" /db_xref="dbSNP:907775032" ORIGIN // cagagctagactgcagaagaaaaagagaaagagaggggagaagaggtcaagtgtggaaacagcaagaaggctgctgtctgcaagccaagaagagagccctcgccagaaaccaaattatccagaccctggatattggatttccagcctccagaatgctccttgaggtgcaactgcattacatttctactgaccagtactgtgccagattgatgaccagccaatacttgagtgtttatgatatggcagcagctgtttaaccacctaaaagtactgtagacctagcatacccacacttcctataagaaagatacggctaagaccgcaggcatggtggcatgcag
position 86
XR_926467.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens uncharacterized LOC102724577 (LOC102724577), ncRNA. (354 bp)
tgtggaactggagaagggagatgaaataataccagcatcctgaacctgaatgtccagcttcgccttgttctttgtggattataagaccattgattaaataaatcctttcatcaaaattatcttaaaaaagaaactaccatctaaatccagttattccatctgacttggtagcagtgatgtttggagtttaggacctaaaggtgaaatggggaaaatctgggtgctcggaaagacaccagaagcacacagaagaagatcatatgaagacacaacaagaaggtgactagctgcaagccaagaagagaagcctcagaagaaatcaaacg
position 324
XR_927926.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens uncharacterized LOC107984620 (LOC107984620), transcript variant X2, ncRNA. (355 bp)
gene="LOC107984620" /replace="g" /replace="t" /db_xref="dbSNP:1272512924" variation 335 /gene="LOC107984620" /replace="c" /replace="g" /db_xref="dbSNP:987766074" variation 351 /gene="LOC107984620" /replace="a" /replace="g" /db_xref="dbSNP:960368042" ORIGIN // gcaagaaggcaaccatgagcaagccaagaagagagccctcaagggggaaccaaaaggctggctggtaccttgatcttggggtttccagcctccagaatgaatcctctggaaacactatggagtgatggagaaagcaccatctggggagtcagatgacctgctctctatcccagctcatcagggagtctctgagacaaacacttaccagagccactcttgatgatagaattggtgatgtgacagccaccaaaggaatgtgacacaaagtagaaatgagacctgagatgtggcctggacctttaccatggaaatgcccataaattgcgtccctattccttaa...
position 25
XR_001749918.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens phosphoribosyl pyrophosphate synthetase 2 pseudogene (LOC100130673), non-coding RNA. (1598 bp)
variation 1595..1598 /gene="LOC100130673" /replace="aaa" /replace="aaaa" /db_xref="dbSNP:755465500" ORIGIN // gaggctggtttcttccaatatgtgttgcaaaatgttgaggtcattctggcttttctgggagtgcttttatctgtttgcctaagaaggagtccctcaaatgtgctgctttgtctgatgcctgtttcccaccttaataaactttctctgccttgttgctgtagtctctgtggcaagaagagaccctttctgataggagtcttggtagggaacagaacttgcccgcccccaacccagtcccattgcacaacaccgtgatgcttcctgtgtaacatggtctaccccctctctagcagcactagcacgagggcatgccctgtgaacctgaggctcttagtgcctgggccacacaagcacacaggtcaggcttttcctgccaatcataagggaaggagtgaccaaaataacatgtggggaagttacaatggtttgggaaacctcaaaaaattctaatggcagtgattttacagtctatgctaaatattaatgaatt...
position 176
NR_038454.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens uncharacterized LOC105369453 (LOC105369453), ncRNA. (366 bp)
a" /replace="c" /db_xref="dbSNP:1055127066" variation 360 /gene="LOC105369453" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:192799983" variation 366 /gene="LOC105369453" /replace="a" /replace="g" /db_xref="dbSNP:966128864" ORIGIN // cttggatttgggccaatttggacaaacagagttgggatagtaaacattccaagaagagaacaggataaacagaactgcagtaaggccccaagaagattggttggtgcccacccatatggagggcagatcttccaccctcagttcactaagattcacatgcaaatcacctctggaatcatcctcacagacatactaaaaaataatgttttaccagatttccagcctattcaccatgaagatgatgaagatgaaaatatttatgatggctctacttccacttagtgaatgatttagatcaaattctgcctttgaaaacttcaccatctacatgaaagatggggacagatgtttccaatg...
position 50
XR_947942.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens defensin beta 110 (DEFB110), transcript variant 1, mRNA. (397 bp)
aaaacaactgacttgaaaaaggaggtctgttgcccccaagaaactctctaccatgaagattcaacctttattctgcacttttgggtcacaattttaccagccaaaaagaaatatcctgagtatggtagcttggacttgaggagagagtgcagaataggtaatggtcaatgtaaaaatcagtgtcatgaaaatgaaattaggattgcttactgcataagacctggaactcattgctgcttgcagcagtaacgatgacagaagaaaagagtcacaagctccaagaagagagaccagcgttattaagttttcccagcacatccttcaaggcgtgtgtgtctctataatacacaagaactaaataaaaattaatgttgaaccattca
position 293
Synonym: DEFB-10; DEFB-11; DEFB111
NM_001037497.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens uncharacterized LOC107984620 (LOC107984620), transcript variant X1, ncRNA. (404 bp)
gene="LOC107984620" /replace="g" /replace="t" /db_xref="dbSNP:1272512924" variation 384 /gene="LOC107984620" /replace="c" /replace="g" /db_xref="dbSNP:987766074" variation 400 /gene="LOC107984620" /replace="a" /replace="g" /db_xref="dbSNP:960368042" ORIGIN // gcaagaaggcaaccatgagcaagccaagaagagagccctcaagggggaaccaaaaggctggctggtaccttgatcttggggtttccagcctccagaatggagtcatggcttctgttaattgaccatctggccgcacgctaggaaaaagaatcctctggaaacactatggagtgatggagaaagcaccatctggggagtcagatgacctgctctctatcccagctcatcagggagtctctgagacaaacacttaccagagccactcttgatgatagaattggtgatgtgacagccaccaaaggaatgtgacacaaagtagaaatgagacctgagatgtggc...
position 25
XR_001749917.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/caagaagaga
lang : en | div : | spe : hs | query_string : caagaagaga | format : html | download :

0.000 | 0.000 | search_start;
0.082 | 0.082 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:caagaagaga)?source=Homo sapiens (human)?to=0&format=json
0.194 | 0.113 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:caagaagaga)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.200 | 0.006 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]