GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-12-06 11:24:00, GGRNA : RefSeq release 208 (Sep, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus uncharacterized LOC120102195 (LOC120102195), transcript variant X2, mRNA. (1534 bp)
cggggaaatcggctaactgacatctcagcgcgtgaggccgccatgggcacccaagttctgtccttaaaagaccaagatcaacccacgtctccacagccggaacagaccagttggctctacaccacggaggacacaaagctcctacagaaaatgggggccgtttggtacccacaactaaaacggtgggtctacacagggaaaacagttatgcctacgaagatgacctttgaattaatctcctacctacataaattaacacacctgggactcaagaagatgaagaccctcttaagacaagaagagattgacacctacctcctgggacgagatcaggccttgcgggaggtgactgaaagctgcagggcctgtgctcaggtaaacccaggaaaagctaaaattggacaaggagtccgtccccgaggacattggcctggtacccactgggaaattgacttcactgaaatcaagcctggtatgttcggacacaaatacctcttagtgttcatagataccttctccggatggatagaggctttccccacaaaacatgaaatggccaaggtggtgaccaagaagctcctcgaagaaatcttccccagc...
position 1110
XM_039108542.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus uncharacterized LOC103693553 (LOC103693553), mRNA. (1715 bp)
cggggaaatcggctagctgacatctcagcgcgtgaggccgccatgggcacccaagttctgtccttaaaagaccaagatcaacccacgtctccacagccggaacagaccggttggctctacaccacggaggacacaaagctcctacagaaaatgggggccgtttggtacccacaactaaaacggtgggtctacacagggaaaacagttatgcctacgaagatgacctttgaattaatctcctacctacataaattaacacacctgggactcaagaagatgaagaccctcttaagacaagaagagattgacacctacctcctgggacgagatcaggccttgcgggaggtgactgaaagctgcagggcctgtgctcaggtaaacccaggaaaagctaaaattggacaaggagtccgtccccgaggacattggcctggtacccactgggaaattgacttcactgaaatcaagcctggtatgttcggacacaaatacctcttagtgttcatagataccttctccggatggatagaggctttccccacaaaacatgaaatggccaaggtggtgaccaagaagctcctcgaagaaatcttccccagc...
position 1199
XM_039087006.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus uncharacterized LOC120102195 (LOC120102195), transcript variant X1, mRNA. (1730 bp)
cggggaaatcggctaactgacatctcagcgcgtgaggccgccatgggcacccaagttctgtccttaaaagaccaagatcaacccacgtctccacagccggaacagaccagttggctctacaccacggaggacacaaagctcctacagaaaatgggggccgtttggtacccacaactaaaacggtgggtctacacagggaaaacagttatgcctacgaagatgacctttgaattaatctcctacctacataaattaacacacctgggactcaagaagatgaagaccctcttaagacaagaagagattgacacctacctcctgggacgagatcaggccttgcgggaggtgactgaaagctgcagggcctgtgctcaggtaaacccaggaaaagctaaaattggacaaggagtccgtccccgaggacattggcctggtacccactgggaaattgacttcactgaaatcaagcctgcacatcttcaggccctacaaatcgtgcagagagacatctggaaacctctagccgcggcctaccaagacaggcttgaacaaccgatggtgccgcacccgttccagatcagagacactgtgtgggtgtgc...
position 1110
XM_039108541.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus Nedd4 family interacting protein 2 (Ndfip2), mRNA. (2110 bp)
aatttgtcagatttttaaatatgatattatttaggaaatctgtaaataaccatgcataagttgctctttacattcttttcttaaattgtgtctagatatcttttcattaattttaaattaagtaaactaaatacatagaaataaacttcattaaagatggagtggtttagggtgaactttaagaaagtatgagtataccaaatgctgtttaaagaacaagttagggccacaccagttttaggggttttcagatgagaaccttacattttaagattactcaccttacaattcttacaagaagagattgctttagaccttatatttattacatctaagacaatttaaaaaattaatttaccaaatatattctcatttgcatttgtctttccaaaagccaataaaagtatctttcagtattactgtaatcatttttttctttaaatgtttactctgttaagcttagcaaataaaatcttgttctgttaa
position 1919
NM_001108390.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Nedd4 family interacting protein 2 (Ndfip2), transcript variant X1, mRNA. (2580 bp)
aatttgtcagatttttaaatatgatattatttaggaaatctgtaaataaccatgcataagttgctctttacattcttttcttaaattgtgtctagatatcttttcattaattttaaattaagtaaactaaatacatagaaataaacttcattaaagatggagtggtttagggtgaactttaagaaagtatgagtataccaaatgctgtttaaagaacaagttagggccacaccagttttaggggttttcagatgagaaccttacattttaagattactcaccttacaattcttacaagaagagattgctttagaccttatatttattacatctaagacaatttaaaaaattaatttaccaaatatattctcatttgcatttgtctttccaaaagccaataaaagtatctttcagtattactgtaatcatttttttctttaaatgtttactctgttaagcttagcaaataaaatcttgttctgttaatagtgcctcctttagtgattgcaagattagtttgtaacaacatacaacctgaattgagatacttagaatacctaattttgtgttgttaaaatgtatctatggaatgaatgtggg...
position 1663
XM_039093538.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus GRIP and coiled-coil domain containing 2 (Gcc2), transcript variant X3, misc_RNA. (3099 bp)
gcagtacactcagagcacagcaaagaaaaggctgccttacaaagagacctggagggagcagtccataggcaagcagagctgttagaacagctcaagtctcagagcgactctgaagataatgttaaaaaactacaggaagagattcagaacattacagcagcatttgaggaacaaacgtcatgtctacaaaagcaattagaagctaccagtgatgaaaaacagcaagagattattcatctccagaaagtcattgaggacaacgctcagcactaccaaaaagatattaatactttccaagaagagattgtgcagctgagagctacacacaaagaagaagttaatgagctgatgtctcaaatggaaacattagctaaagaacatgaggcagcagtaaataagctaaaagagaacagagtgacactgtgtgagacaagtgagaccattccagagaattaccaatgtgaatcagaaagcttaaatgaagacacctcagatgcaagccaggagaatcaaaaatgctctgtggccttacaggaagatccttttgcagaacatacagtgtatgataaagtcagacaattggaagattcattaaaagaa...
position 848
XR_005497267.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus GRIP and coiled-coil domain containing 2 (Gcc2), transcript variant X2, mRNA. (4210 bp)
gcagtacactcagagcacagcaaagaaaaggctgccttacaaagagacctggagggagcagtccataggcaagcagagctgttagaacagctcaagtctcagagcgactctgaagataatgttaaaaaactacaggaagagattcagaacattacagcagcatttgaggaacaaacgtcatgtctacaaaagcaattagaagctaccagtgatgaaaaacagcaagagattattcatctccagaaagtcattgaggacaacgctcagcactaccaaaaagatattaatactttccaagaagagattgtgcagctgagagctacacacaaagaagaagttaatgagctgatgtctcaaatggaaacattagctaaagaacatgaggcagcagtaaataagctaaaagagaacagagtgacactgtgtgagacaagtgagaccattccagagaattaccaatgtgaatcagaaagcttaaatgaagacacctcagatgcaagccaggagaatcaaaaatgctctgtggccttacaggaagatccttttgcagaacatacagtgtatgataaagtcagacaattggaagattcattaaaagaa...
position 848
XM_039098762.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus lysine-rich nucleolar protein 1 (Knop1), transcript variant X3, mRNA. (5122 bp)
ttgaagaaagggagtaagaagtcagtcagaagtgaagcgttggatttcatcccgatagacagcctgaaggcccctgggaagaagaaagtgaaatccaaaaaaaaggtggagcagccagttggtgaagggctggctgtgaaaaggaagaaaaagaagaggagaaaagagagcggagtaaaggaagacccctggcaggaggaaaaagaggagtcagacacagacttggaggtggtactggaaaaaaaaggcaatatggatgaggcctgcatagatcaggtgagacggaaggccttacaagaagagattgatcgtgagtctggcaagacagaggtttcagaacccaaaaaatggacgggaacccagtttggccagtgggacactgcgggctttgaaaatgaagaacagaaactaaaattcctgaaacttatgggcggctttaagcatctatccccgtcattcaaccgtcctcccagcatgactgtcaggtccaacatggccctggacaagaagtcttcagatacgctccagcagagtctgcagcaggactacgaccgggccatgagctggaagtacagccgaggggctggcctgggctttaac...
position 1210
Synonym: RGD1565096
XM_039087781.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus lysine-rich nucleolar protein 1 (Knop1), transcript variant X1, mRNA. (5122 bp)
ttgaagaaagggagtaagaagtcagtcagaagtgaagcgttggatttcatcccgatagacagcctgaaggcccctgggaagaagaaagtgaaatccaaaaaaaaggtggagcagccagttggtgaagggctggctgtgaaaaggaagaaaaagaagaggagaaaagagagcggagtaaaggaagacccctggcaggaggaaaaagaggagtcagacacagacttggaggtggtactggaaaaaaaaggcaatatggatgaggcctgcatagatcaggtgagacggaaggccttacaagaagagattgatcgtgagtctggcaagacagaggtttcagaacccaaaaaatggacgggaacccagtttggccagtgggacactgcgggctttgaaaatgaagaacagaaactaaaattcctgaaacttatgggcggctttaagcatctatccccgtcattcaaccgtcctcccagcatgactgtcaggtccaacatggccctggacaagaagtcttcagatacgctccagcagagtctgcagcaggactacgaccgggccatgagctggaagtacagccgaggggctggcctgggctttaac...
position 1210
Synonym: RGD1565096
XM_039087770.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus GRIP and coiled-coil domain containing 2 (Gcc2), transcript variant X1, mRNA. (6603 bp)
gcagtacactcagagcacagcaaagaaaaggctgccttacaaagagacctggagggagcagtccataggcaagcagagctgttagaacagctcaagtctcagagcgactctgaagataatgttaaaaaactacaggaagagattcagaacattacagcagcatttgaggaacaaacgtcatgtctacaaaagcaattagaagctaccagtgatgaaaaacagcaagagattattcatctccagaaagtcattgaggacaacgctcagcactaccaaaaagatattaatactttccaagaagagattgtgcagctgagagctacacacaaagaagaagttaatgagctgatgtctcaaatggaaacattagctaaagaacatgaggcagcagtaaataagctaaaagagaacagagtgacactgtgtgagacaagtgagaccattccagagaattaccaatgtgaatcagaaagcttaaatgaagacacctcagatgcaagccaggagaatcaaaaatgctctgtggccttacaggaagatccttttgcagaacatacagtgtatgataaagtcagacaattggaagattcattaaaagaa...
position 848
XM_006256375.4 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X36, mRNA. (14094 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 9616
XM_039087257.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X35, mRNA. (14358 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 9880
XM_039087256.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X34, mRNA. (14559 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 10081
XM_039087254.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X33, mRNA. (14622 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 10144
XM_039087253.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X30, mRNA. (25229 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 20751
XM_039087250.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X29, mRNA. (25493 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 21015
XM_039087249.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X28, mRNA. (25757 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 21279
XM_039087248.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X27, mRNA. (26021 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 21543
XM_039087247.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X26, mRNA. (26021 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 21543
XM_039087246.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X25, mRNA. (26285 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 21807
XM_039087245.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X24, mRNA. (26549 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22071
XM_039087243.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X23, mRNA. (26813 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22335
XM_039087242.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X22, mRNA. (26819 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22341
XM_039087241.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X21, mRNA. (27077 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22599
XM_039087240.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X20, mRNA. (27083 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22605
XM_039087239.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X19, mRNA. (27323 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22845
XM_039087238.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X18, mRNA. (27323 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22845
XM_039087237.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X17, mRNA. (27335 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22857
XM_039087236.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X16, mRNA. (27341 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22863
XM_039087235.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X15, mRNA. (27341 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22863
XM_039087234.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X14, mRNA. (27347 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22869
XM_039087232.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X13, mRNA. (27347 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 22869
XM_039087231.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X12, mRNA. (27593 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23115
XM_039087230.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X11, mRNA. (27599 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23121
XM_039087229.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X10, mRNA. (27599 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23121
XM_039087228.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X9, mRNA. (27599 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23121
XM_039087227.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X8, mRNA. (27599 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23121
XM_039087226.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X7, mRNA. (27599 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23121
XM_039087225.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X6, mRNA. (27605 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23127
XM_039087224.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X5, mRNA. (27611 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23133
XM_039087223.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X4, mRNA. (27611 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23133
XM_039087222.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X3, mRNA. (27611 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23133
XM_039087221.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X2, mRNA. (27611 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23133
XM_039087220.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X1, mRNA. (27875 bp)
gacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtg...
position 23397
XM_039087219.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/en/rn/seq%3acaagaagagattg
lang : en | div : | spe : rn | query_string : seq:caagaagagattg | format : html | download :

0.000 | 0.000 | search_start;
0.076 | 0.076 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:caagaagagattg)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.415 | 0.339 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:caagaagagattg)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.420 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]