2024-04-26 18:37:32, GGRNA : RefSeq release 222 (Jan, 2024)
Matches are highlighted with green background. Overlapping matches are dark colored.
Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.
Redirect URI : http://ggrna.dbcls.jp/rn/seq%3aTTTTGCTTTCACTGATACAGAGAGC
lang : en |
div : |
spe : rn |
query_string : seq:TTTTGCTTTCACTGATACAGAGAGC |
format : html |
download :
0.000 | 0.000 | search_start; 0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TTTTGCTTTCACTGATACAGAGAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json 0.096 | 0.009 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TTTTGCTTTCACTGATACAGAGAGC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json 0.096 | 0.000 | cgi_end;
GGRNA ver.2 by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]