GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2024-04-26 12:05:12, GGRNA : RefSeq release 222 (Jan, 2024)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus mitoregulin (Mtln), long non-coding RNA. (445 bp)
Han ZG and Zhang X. TITLE Identification of gene expression profile of dorsal root ganglion in the rat peripheral axotomy model of neuropathic pain JOURNAL Proc Natl Acad Sci U S A 99 (12), 8360-8365 (2002) PUBMED 12060780 atctactgcatgctgagcgtttgcaatggcggacgtgtctgagaggacgctgcaagtgtccgtgctagtggctttcgcctctggagtggtccttggctggcaagcgaatcggttgcggaggcgttacctggactggaggaagcggaggctgcaggacaagctggcgacgactcagaaaaagctggacctggcctgagcacgttgggttctctccaagcctcgtgcagcccgtatccggggagctgcgcgactacacgccctgagtcccggctcgtccttgcacggcttgcaggaacgtggcttgcttccagacctcagaaagaaaatagttttgtcttcgctaacagcctgtgctcagcttgtcgaagatggatata...
position 63
Synonym: Smim37
NR_132743.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/seq%3aTGCTAGTGGCTTTCGCCTCTGGAGT
lang : en | div : | spe : rn | query_string : seq:TGCTAGTGGCTTTCGCCTCTGGAGT | format : html | download : 

0.000 | 0.000 | search_start;
0.093 | 0.093 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGCTAGTGGCTTTCGCCTCTGGAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.103 | 0.011 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGCTAGTGGCTTTCGCCTCTGGAGT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.104 | 0.000 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]