GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2024-04-26 09:18:48, GGRNA : RefSeq release 222 (Jan, 2024)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens cytochrome c oxidase subunit 7B (COX7B), mRNA; nuclear gene for mitochondrial product. (2444 bp)
PUBMED 1309697 REFERENCE 10 (bases 1 to 2444) AUTHORS Stroh,A. and Kadenbach,B. TITLE Tissue-specific and species-specific distribution of -SH groups in cytochrome c oxidase subunits JOURNAL Eur J Biochem 156 (1), 199-204 (1986) PUBMED 3007143 gtttttcagctcacttcaagggtacctgaagcgaattggcaccaaagcagcagctgtattgccgcagttctagcttcaccttcacgatgtttcccttggtcaaaagcgcactaaatcgtctccaagttcgaagcattcagcaaacaatggcaaggcagagccaccagaaacgtacacctgattttcatgacaaatacggtaatgctgtattagctagtggagccactttctgtattgttacatggacatatgtagcaacacaagtcggaatagaatggaacctgtcccctgttggcagagttaccccaaaggaatggaggaatcagtaatcatcccagctggtgtaataatgaatt...
position 22
Synonym: APLCC; LSDMCA2
NM_001866.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/seq%3aGTACCTGAAGCGAATTGGCACCAAA
lang : en | div : | spe : hs | query_string : seq:GTACCTGAAGCGAATTGGCACCAAA | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTACCTGAAGCGAATTGGCACCAAA)?source=Homo sapiens (human)?to=0&format=json
0.105 | 0.018 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTACCTGAAGCGAATTGGCACCAAA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.105 | 0.000 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]