LOCUS       XM_018090821            2876 bp    mRNA    linear   VRT 18-DEC-2019
DEFINITION  PREDICTED: Xenopus tropicalis janus kinase and microtubule
            interacting protein 1 (jakmip1), transcript variant X4, mRNA.
ACCESSION   XM_018090821
VERSION     XM_018090821.2
DBLINK      BioProject: PRJNA205740
KEYWORDS    RefSeq.
SOURCE      Xenopus tropicalis (tropical clawed frog)
  ORGANISM  Xenopus tropicalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Silurana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030677.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 18, 2019 this sequence version replaced XM_018090821.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Xenopus tropicalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2876
                     /organism="Xenopus tropicalis"
                     /mol_type="mRNA"
                     /strain="Nigerian"
                     /db_xref="taxon:8364"
                     /chromosome="1"
                     /sex="female"
                     /tissue_type="liver and blood"
                     /dev_stage="adult"
                     /note="F17 inbred"
     gene            1..2876
                     /gene="jakmip1"
                     /note="janus kinase and microtubule interacting protein 1;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 10 ESTs, 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 2 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:100145282"
                     /db_xref="Xenbase:XB-GENE-991323"
     CDS             155..2674
                     /gene="jakmip1"
                     /codon_start=1
                     /product="janus kinase and microtubule-interacting protein
                     1 isoform X1"
                     /protein_id="XP_017946310.1"
                     /db_xref="GeneID:100145282"
                     /db_xref="Xenbase:XB-GENE-991323"
                     /translation="

MSKKNRSRGEKCDIEMEAFQAANEELRAKLTQIQIEYQQEKNKVGKLREKIQDVRLEREQEQHRHTAYISELKAKLHEEKMKEVQSVRESLIRQHEQDVARVVKIKDSEVQRLQCTLNVLRDGAADKVKTALLNEAREEARKAFDNERTKLQQEILALKTEKKQIEESLNNVMQADKMKATDLRIAYQTHQEEIARIKRESEKDIRRLMEEIKAKERVILALEKEVGVQAGHTQKLLLQKEALDEQLVQAKEAERYHSSPKKELPPGVCDISELLGNGEPHVDDRDLRRFQLKIAELHAVIRKLEDRNTLLSDERNELLKRVRETESQLKPLVEKNKRMSKKNEDTLQTIQRMEEKIKSLSRENAEMKEKTSAQISLKRHASLDDLSTAQEQEIEFLRLQVMEQQQVIDDITVEKERMLRCKRPKRKSLKPPRRHVVETFFGFDEESVDSETSSITSYTTDKTDRTPATPEEDIEDNTPKEESDLRFRQLTREYQALQRAYALLQEQVGGTLDAEREARTREQLQTDLLRYQAKIEDLENSLSERGQDSRWVEEKQQLLKSNQNLLEKLFRFELEEKQLKNEIQDARDQNELLEFRVLELEERERRSPAFNLHIANFPENNGSALQLFCQQEGIKDVDISELMKKLDILGDNGNLRNEEQVAVIQAGTVLSLCEKWLKQIEVTEAALTQKMIDLENEKELFSKQKGYLEEELDYRKQALDQAHMKIQELEATLYNALQQEPGRRVSECLNENQREDLRAAVEKLRRQILRQSREFDSQILHERMELLQQAQQRIRELEDKIDFQKRQLKELEEKHSFCGLDDQFQQRYMGLKRAHGMHT"

     misc_feature    <197..>919
                     /gene="jakmip1"
                     /note="Chromosome segregation ATPase Smc [Cell cycle
                     control, cell division, chromosome partitioning]; Region:
                     Smc; COG1196"
                     /db_xref="CDD:440809"
     misc_feature    <713..>2458
                     /gene="jakmip1"
                     /note="Chromosome segregation ATPase Smc [Cell cycle
                     control, cell division, chromosome partitioning]; Region:
                     Smc; COG1196"
                     /db_xref="CDD:440809"
     misc_feature    1394..1987
                     /gene="jakmip1"
                     /note="JAKMIP CC3 domain; Region: JAKMIP_CC3; pfam16034"
                     /db_xref="CDD:464986"
ORIGIN      

ctccaaggcataatcacacaagtaggtgaaaagaggaaaagaggatggcaaaggcctacaagaagagacattgtgaattgaaattcagttgatttgcttatgccaaagaaaactcatagcagagaaaactggttgtacccagggagaaaacaaaatgtcgaagaaaaaccgatccagaggagagaagtgcgatattgagatggaggccttccaggctgctaatgaggaattgcgggcgaagctgacacaaattcaaatagaatatcagcaagaaaaaaacaaggttggtaaacttcgagaaaaaattcaggatgtccgactggaaagggagcaagagcagcaccggcatacggcgtacatttctgaactaaaagccaagctccatgaggagaagatgaaggaagtccagtctgtccgtgagtccctaataaggcagcatgaacaagatgtagcacgtgttgttaaaattaaggatagtgaagtccagcgtttacagtgcactctgaatgtgctacgggacggtgctgcagataaggtgaagacagctcttctaaatgaggccagagaagaagcgaggaaagcctttgataatgagcgaactaagttacaacaggagatcctggcgttaaagactgagaagaaacaaatagaggagagtctgaacaatgtcatgcaagcggacaagatgaaggccaccgacctgcgtatagcttaccagactcaccaagaagagattgctagaataaagcgggaatctgaaaaggatatccgtaggctgatggaggaaataaaagccaaagagagagtgatcctggctctagagaaggaggtgggggtgcaggcgggccacacacagaagttgctcttgcagaaggaggccctggatgaacagctggtccaggctaaagaggctgagcgctaccacagcagcccaaagaaagagctgcctccgggtgtttgcgacatctctgagctccttggaaatggggagccacatgtcgatgaccgagaccttagaagatttcagctaaaaattgcagagcttcatgctgtaataagaaagctggaggaccgcaatactcttctgtctgatgagaggaatgagctgctaaagcgtgtccgagaaacagagagccagctaaagcctctcgtggagaagaataaaagaatgtccaaaaagaatgaggacacactacaaacaatacagaggatggaagagaagatcaaatctctgtcccgggagaatgcagagatgaaagagaagacatcggcccagatctcgctgaagcgccatgcctcactggatgatctgagcactgcgcaagaacaagaaatcgaattcctccgcttacaagtgatggagcagcagcaagttattgatgacattacagtggagaaagagcgaatgttgcgttgcaaaaggccgaagagaaagagcttgaagcctccaaggaggcatgttgtggagacattttttggatttgacgaggaatctgtggattctgaaacctcctccatcacctcatacacaaccgataaaacggacaggacaccagcaacacccgaagaggatatagaggataacacacctaaagaagagtctgatttaaggttccgccagctgacacgagagtaccaagctttacagagggcgtacgcacttcttcaggagcaagtagggggaacattggatgcggaaagagaagcaaggactcgtgagcagctgcaaacagatttattacggtaccaagcaaaaattgaagacttagaaaattctttgtccgagagaggccaggactcaagatgggtggaagaaaaacagcaacttctaaagtcgaaccagaatttgttagagaagctcttcagatttgaactggaagaaaaacagctgaaaaatgaaatccaggatgcaagggaccagaatgagctcttagaattcagagttctagaactggaagagagagaacgaaggtctccagcttttaacctccatatagccaacttcccagaaaacaatggaagtgctctgcagctcttctgtcagcaggaaggaattaaggacgtggatatctccgaacttatgaagaagcttgatatccttggagataatgggaacctgaggaatgaagaacaggttgcggtcatacaagcagggacagtgctgtctctctgtgagaagtggctaaagcagattgaagtcacagaagccgccctcacgcagaaaatgattgacctggagaatgagaaggaactgttcagcaaacagaaaggctatttggaagaagaactggactaccggaagcaggcacttgatcaggcacatatgaaaatccaggaattagaagccactttatataacgctttgcagcaggagccagggcggagagtcagcgaatgcctaaatgagaaccagagggaagacttgcgggcggcggtggagaagctgcgacggcagatcctgagacaaagccgggagtttgacagccagatcctacatgagcgtatggagcttttacagcaggcgcaacagagaatccgggaacttgaagacaaaatagactttcaaaaaaggcaacttaaagagctagaagaaaagcattcattctgtggccttgacgatcaattccagcagagatacatgggtttgaaaagagcacacgggatgcacacctgacccttctgcaactgccaaaatgggacacaccatttatttttaattacaggactggtccaaagcgccagaggatttaatattatgagttttgtaacgattttgcttttcaatggacacttgttgtacagaaacaatcctgctatgagagacttgaatatatctatgaaaatataaaaaaaaataaaaaaaatcataggtttaa

//