ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-20 15:00:51, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_012968458 865 bp mRNA linear VRT 18-DEC-2019
DEFINITION PREDICTED: Xenopus tropicalis ribosomal protein S5 (rps5),
transcript variant X1, mRNA.
ACCESSION XM_012968458
VERSION XM_012968458.1
DBLINK BioProject: PRJNA205740
KEYWORDS RefSeq.
SOURCE Xenopus tropicalis (tropical clawed frog)
ORGANISM Xenopus tropicalis
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
Xenopus; Silurana.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_030684.2) annotated using gene prediction method: Gnomon,
supported by mRNA and EST evidence.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Xenopus tropicalis Annotation
Release 104
Annotation Version :: 104
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.3
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..865
/organism="Xenopus tropicalis"
/mol_type="mRNA"
/strain="Nigerian"
/db_xref="taxon:8364"
/chromosome="8"
/sex="female"
/tissue_type="liver and blood"
/dev_stage="adult"
/note="F17 inbred"
gene 1..865
/gene="rps5"
/note="ribosomal protein S5; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 6
mRNAs, 852 ESTs, 17 Proteins, and 100% coverage of the
annotated genomic feature by RNAseq alignments, including
129 samples with support for all annotated introns"
/db_xref="GeneID:549746"
/db_xref="Xenbase:XB-GENE-919703"
CDS 198..809
/gene="rps5"
/codon_start=1
/product="40S ribosomal protein S5 isoform X1"
/protein_id="XP_012823912.1"
/db_xref="GeneID:549746"
/db_xref="Xenbase:XB-GENE-919703"
/translation="
MSDWETVPVGAETPEIKLFGKWSTDDVQINDISLQDYIAVKEKYAKFLPHSGGRYAAKRFRKAQCPIVERFTNSLMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECVADELINAAKGSSNSYAIKKKDELERVAKSNR"
misc_feature 246..806
/gene="rps5"
/note="Eukaryota homolog of Ribosomal Protein S7; Region:
uS7_Eukaryote; cd14867"
/db_xref="CDD:271246"
misc_feature order(246..248,333..341,345..356,453..455,465..467)
/gene="rps5"
/note="S9 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(345..347,351..353,363..374,381..383,405..407,
414..416,420..434,444..458,465..467,585..593,597..599,
627..629,648..650,669..671,678..680,696..701)
/gene="rps5"
/note="rRNA binding site [nucleotide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(477..479,486..491,498..500,696..698,702..707)
/gene="rps5"
/note="S25 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(582..584,591..593,597..599,804..806)
/gene="rps5"
/note="S11 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
ORIGIN
ttcacggaagtgacgctcatagcatgccatgatgaatatggcgctttttgcttcagttcgtttgcgggtagttatcagcaagtaagggcagaagcctaagaggaagtgtgggcccctgtataactgggttggagaccccgccccggcctctttccgctccgagctccgaccggttaagacacagccgaggagacacgatgtcagattgggagaccgttccagttggggctgagacccctgaaattaaactgtttggaaaatggagcacagatgatgtacaaataaatgatatttctctacaggattacattgcagtgaaggaaaaatatgccaagttcctgccacacagcggaggacgttatgctgcaaaacgcttccgtaaggctcagtgccccattgtggaacgtttcaccaactcccttatgatgcatgggaggaacaatggcaaaaaactcatgacagtcagaattgtaaagcatgcctttgaaatcatccacctgctaaccggggagaatcccctgcaagttttggtaaatgccatcatcaacagtggtcctagggaagattctacacgtattggtagagctggaactgtgaggagacaagctgttgacgtttcacctcttaggagagtaaaccaggctatatggctgctttgcactggggcccgtgaagctgcttttaggaacattaagacaattgcagagtgcgttgctgatgaacttattaatgcagccaagggttcctctaactcatatgccatcaagaaaaaggatgaactggagagagtagccaaatccaaccgttaaagcatcagcagtttaatgagagtatacgttctcataataaagaaatttgttctgta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]