2025-04-17 06:47:13, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_002940181 4261 bp mRNA linear VRT 18-DEC-2019 DEFINITION PREDICTED: Xenopus tropicalis piwi-like RNA-mediated gene silencing 1 (piwil1), transcript variant X1, mRNA. ACCESSION XM_002940181 VERSION XM_002940181.4 DBLINK BioProject: PRJNA205740 KEYWORDS RefSeq. SOURCE Xenopus tropicalis (tropical clawed frog) ORGANISM Xenopus tropicalis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae; Xenopus; Silurana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_030677.2) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Dec 18, 2019 this sequence version replaced XM_002940181.3. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Xenopus tropicalis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4261 /organism="Xenopus tropicalis" /mol_type="mRNA" /strain="Nigerian" /db_xref="taxon:8364" /chromosome="1" /sex="female" /tissue_type="liver and blood" /dev_stage="adult" /note="F17 inbred" gene 1..4261 /gene="piwil1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 57 ESTs, 16 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 11 samples with support for all annotated introns" /db_xref="GeneID:100488735" /db_xref="Xenbase:XB-GENE-963233" CDS 203..2788 /gene="piwil1" /codon_start=1 /product="piwi-like protein 1 isoform X1" /protein_id="XP_002940227.2" /db_xref="GeneID:100488735" /db_xref="Xenbase:XB-GENE-963233" /translation="
MSGRARARARGRARGQEPPAPGKEPQPGYTQKTSTEEQAEPEIVGRGRQKRASVAHSTPVTQAGDLQISAGFQEISLGDRGGRRRDFHDLGINTRQAIEHVKESKTGSSGSIIQLSTNHIKLISRPQWVLFQYHIDYAPQMESRGLRCALLFQHEELIGKARAFDGTMLFLPKRLDKVNEVFSQTRNGETVKITITLTNELPPTSPTCFQFYNIIFRRLLKMMNMKQIGRNYYNPNDQIEISSHGLTIYPGFSTSILQYENNIMLSIDVSHKVLRSETVLDYMYNVNQKVESHKFHDICSKDLIGQIVLTKYNNKTYRIDDINWDFTPESTFKKSDGSEISFVDYYRTQYNKGITDLNQPALVHNPKKPRGPQNVPAGPILLIPEFCFLTGLTDRMRSDFNVMKDLAIHTRLAPEQREIQVGKFLKNIHKDDSVQKELQDWGLNFDSKLLPFAGRVAPAEKILQAGKTADYNPQFADWSRELRGPTLIRVKHLDNWVLLYTRRNYDAANTLTQNLFKVSGQMGIKMNRAVMVEVDDTTDAYVKVLQQKVTPDVQMVVCLLSSNRKDKYDAIKKYLCIDCPVPSQCVLAKTLNKPQTVVSVATKIALQMNCKMGGELWTVEIPLKELMIVGIDCYHDTLSGKRSIGAFVASLNPSMTRWFSRCVLQAQKQEIVDGLKVCMHAALKAWFNCNKSLPSRIIIYRDGVGDGQLKTMVEYEIPQLQDCIRSAEKDYSPKLTVIVVKKRVSARFFAHVGGRLQNPPPGTIVDVEITRPEWYDFFIISQSVRVGSVSPTHYNVVYDSGALKPDHMQRLTYKLCHLYYNWPGVIRVPAPCQYAHKLAFLVGQSIHREPHLTLSDRLYYL"
misc_feature 248..523 /gene="piwil1" /note="GAGE protein; Region: GAGE; pfam05831" /db_xref="CDD:461753" misc_feature 1028..1381 /gene="piwil1" /note="PAZ domain, Piwi_like subfamily. In multi-cellular organisms, the Piwi protein appears to be essential for the maintenance of germline stem cells. In the Drosophila male germline, Piwi was shown to be involved in the silencing of retrotransposons in the...; Region: PAZ_piwi_like; cd02845" /db_xref="CDD:239211" misc_feature order(1163..1165,1202..1204,1226..1228,1238..1240, 1292..1294,1340..1342,1346..1348) /gene="piwil1" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239211" misc_feature 1403..2734 /gene="piwil1" /note="PIWI domain, Piwi-like subfamily found in eukaryotes. This domain is found in Piwi and closely related proteins, where it is believed to perform a crucial role in germline cells, via RNA silencing. RNA silencing refers to a group of related...; Region: Piwi_piwi-like_Euk; cd04658" /db_xref="CDD:240016" misc_feature order(1904..1906,1916..1918,1952..1963,1970..1972, 2000..2002,2009..2011,2021..2023,2033..2035) /gene="piwil1" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240016" misc_feature order(2096..2098,2102..2104,2306..2308,2708..2710) /gene="piwil1" /note="active site" /db_xref="CDD:240016" ORIGIN
tggggcgtagccttagggaattatagtttgtggcgcagcaagaaattggatctgtactgcgcggatgaatttttcgcgggtctgcgctgaagtgaaggggccttagttcagtgacagagacgagcggcggcgcaacttttcctcacctgttgactcgcgttagaataaagggagcctgtttgtcttggacaaggagataaaaatgtcaggaagagctagagcaagagctcgaggcagagcccgtggtcaggaaccaccagcacctggaaaggagcctcaacctggatatacacaaaagacatcaacagaagagcaagcagaaccagagattgttgggcgtggacgtcagaagagagcctctgttgctcactcaactccagtgacacaggcaggagacctgcagatatcagcaggatttcaagaaatatctcttggggatcgtggtggacgtagacgtgattttcatgaccttggtataaatactcgtcaagcaatagaacacgtcaaagagtcaaaaacaggttcttctggaagcataattcagctaagtacaaaccatataaaacttatctctagacctcagtgggtattattccaatatcatattgactatgccccacagatggaatctaggggattgcgctgtgctttactctttcagcatgaggaacttattggaaaagcacgtgcttttgatggaacaatgttatttttacctaaaagacttgataaggttaatgaggtttttagtcaaacccgcaatggtgagacagtgaagatcactattactttaacaaacgagttaccacctacttcaccaacgtgcttccagttctacaacatcatttttcgaagacttctgaagatgatgaatatgaagcagattggacgtaattactacaatcctaatgatcagatagaaattagttcacatggccttactatatatccagggttttccacttcaattctgcaatatgaaaacaacataatgttaagcatagatgtgagccacaaagttttaagaagcgaaacagttctggattacatgtacaatgtgaaccaaaaagtggagtcacataaattccatgatatctgcagcaaagacctgattggacaaattgttcttacaaagtacaacaataagacttaccggattgatgatatcaactgggattttactccagagtctacatttaagaaatcagatggttcagaaataagctttgttgattactatagaacacaatataataaaggaatcacagacttaaaccagcctgctcttgttcataatccaaaaaaacccaggggtccacagaatgttccagcaggaccaattctcttgataccagaattttgtttcctaacaggtttaactgatcgaatgaggagtgattttaatgtaatgaaggacctagcaattcataccagactggcaccagagcaaagagaaatacaagttggaaaatttctaaagaatattcacaaggatgatagtgtgcagaaagagcttcaggattggggcttaaactttgactcaaaacttttgccttttgctggcagagtagctccagcagagaagattttgcaggctggaaaaacagctgactacaatcctcagtttgctgactggtcaagagaattacgaggaccgacactaatccgtgtgaaacatttggataattgggtattgttatacacacgcagaaactatgatgctgccaatactttgacacaaaatctgttcaaagtgtcaggtcaaatgggaatcaagatgaatagagcagtaatggtggaagtagatgacactacagatgcatatgtaaaagttttgcagcaaaaggtaacacctgatgtacagatggtagtttgtcttctctctagtaatcggaaggataaatatgatgctataaaaaaatacctgtgcattgactgcccagttccaagtcaatgcgtgttagcaaagactttaaataaaccacagaccgttgtttcagttgcaacaaaaattgcattacagatgaactgcaagatggggggagagttatggactgttgaaatacctctgaaggaattgatgattgttggcattgattgttatcacgacacattatcaggaaaaagatctattggggcatttgttgccagtttaaacccaagcatgacacggtggttttctcgttgtgttctccaggcacagaaacaagagattgttgatggtctcaaagtctgcatgcatgctgccctaaaagcctggtttaattgcaacaaaagtctgccttcccgtataataatctaccgagatggagtaggagatggtcagttgaaaacaatggtcgaatacgaaataccacagctccaggattgtataaggtctgctgaaaaagattacagcccaaaactaactgttattgtcgtaaaaaaacgagtcagtgctagattctttgcacatgttggtggtagacttcagaaccctcctccaggcaccattgttgatgtggaaatcacgagaccagaatggtatgacttcttcataatcagccagtctgtaagagtaggttctgtgtcgccaactcactacaacgttgtgtatgacagcggcgcattgaaaccagatcatatgcaaagactgacttacaagctttgccatctgtactacaactggccaggtgtaatcagagtgccagctccttgtcagtatgcccataaattagcatttttggttggtcagagcatccacagagaaccacatcttacactttcggatcgcctatattatctctaagttttttggggaacggccaattgagttttctgccgcttcagtctaaaagtactctacttaatttagttagtttaaatttgtgtaccaggagttaatttactgttaatctgaaaaagcattgttaattggataaaacctacctttattttccatattgtaaccaattaaaaaaaaaaggattttctttggatatttagcttacattccagtaggttactgctctataaagtatatctgttctattacttgacacttttgtattttcaaagcaaaattgagcctaacactatgtaacatttcatccatttcagttatcagacctgctgagaggttatcagcatgatgaactgacaatataccagttatcttactttttctaaacagcattgttcaagcattactagaagagtaaatacaacataagctgaaactaattttatttacaaagttagtcgccttcaattattcataacaacactattcaatatataatggttggattagagttggatataatttaaatattgttcactcaccttagcatggatttgaaatcccatctatggtttcaaaaaaatgaaaccataagcatcttaagttggtgcattcagatgagaaataatatttatttagaaagcaatcattgtaataatggatgtttggtttgggtatcacatggtaaatttggttcaaacccaaatagtttagcccagtgggcccttcctcttttggtagaacttcagtctaggttggtattggttcattgaatgtgacagccagactaaaagaaatactgccacttaaacaagaaaagccaatataatagcaataaaataggcaaacacagtgcttgagggttttaaacatgcagagtgttgtggctaacaaatctccagaaagtaaatatgtattcatgccatgcagcctaaaaaaaatgtccaaattgggacactctagctgtagcaacaggacattcatgaacaaacatggggccatatattacttttaagttaatgttgtttctgtgactatatatgctaaaacattttaatcactgaactaagcttggaaatgtgtggagaaaaataaaactacataagtattgatctctaaataattattggaggctcattgtagacatttaaatatacagtatcattcaaaggcatttggtaaggatttaattaggtaatataagacaaaatgtttggtttaagtattgtatgtctaagcctggaaacatgctttttagacagctgatttatgtttaggagtttgcaaactcatatggttttaagatcccatttacttacaggcgaaaacacatatgtatatctgttttcactagtgattactattgtaaaagttatttttgttaatgtcaaaactactattacaggtgcacacttaattgtgtattaattgcatttatatgaaaatggttacaataaagtttggattctaatatcatta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]