GGRNA | Results

2023-11-29 14:51:39, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:	hits:	results:
seq2:caagaagagattgcc	340	NM_000034, NM_000119, NM_000167, NM_000259, NM_000523, NM_000593, NM_000721, NM_000833, NM_000845, NM_000888, NM_001001971, NM_001002006, NM_001002920, NM_001005365, NM_001008224, [...]
[AND]	340	NM_000034, NM_000119, NM_000167, NM_000259, NM_000523, NM_000593, NM_000721, NM_000833, NM_000845, NM_000888, NM_001001971, NM_001002006, NM_001002920, NM_001005365, NM_001008224, [...]

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 1, mRNA. (2408 bp)

..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....

position 1823 (CDS: 1088 - 2182)

Synonym: ALDA; GSD12
NM_000034.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens erythrocyte membrane protein band 4.2 (EPB42), transcript variant 1, mRNA. (2554 bp)

..... ccaaccttagctgctttgctcaggaagacattgccatttgtagaccacaccttgc .....

position 2128 (CDS: 301 - 2466)

Synonym: PA; SPH5
NM_000119.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glycerol kinase (GK), transcript variant 2, mRNA. (4485 bp)

..... tttgttttgtagtaaacagtgaagaaaagattgcctcctaattatttttttcaat .....

position 3199 (CDS: 180 - 1754)

Synonym: GK1; GKD
NM_000167.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin VA (heavy chain 12, myoxin) (MYO5A), transcript variant 1, mRNA. (12238 bp)

..... ctgggcgggtccttagtctgcaggaagaaattgccaagctccggaaagacctgga .....

position 3209 (CDS: 245 - 5812)

Synonym: GS1; MYH12; MYO5; MYR12
NM_000259.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens homeobox D13 (HOXD13), mRNA. (2341 bp)

..... tgcgtctaccgaagagggaggaagaagagagtgccttacaccaaactgcagctta .....

position 918 (CDS: 88 - 1119)

Synonym: BDE; BDSD; HOX4I; SPD
NM_000523.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (TAP1), mRNA. (2974 bp)

..... aggtatttggaagaagtcttcaagaaaatattgcctatggcctgacccagaagcc .....

position 2121 (CDS: 156 - 2582)

Synonym: ABC17; ABCB2; APT1; D6S114E; PSF-1; PSF1; RING4; TAP1*0102N; TAP1N
NM_000593.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 3, mRNA. (14972 bp)

..... gtgccaaggagccaacgatccaagaagagagagcccaggatttaaggaggaccaa .....

position 3115 (CDS: 196 - 7008)

Synonym: BII; CACH6; CACNL1A6; Cav2.3
NM_000721.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 2, mRNA. (14468 bp)

..... taaagagccctaggtatcttccagaagagatggcccactctgacatttcagaaac .....

position 3467 (CDS: 311 - 4705)

Synonym: EPND; GluN2A; NMDAR2A; NR2A
NM_000833.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 1, mRNA. (3572 bp)

..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatttt .....

position 1272 (CDS: 312 - 3038)

Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NM_000845.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens integrin, beta 6 (ITGB6), mRNA. (2397 bp)

..... cccctttcgtgaaaacaacaccagaagaaattgccaacccttgcagtagtattcc .....

position 584 (CDS: 17 - 2383)

NM_000888.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 2, mRNA. (3101 bp)

..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatttg .....

position 1412 (CDS: 135 - 1598)

Synonym: FAM13C1
NM_001001971.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 1, mRNA. (2898 bp)

..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....

position 1430 (CDS: 113 - 1945)

Synonym: AIRP; CN-IB; CN1B
NM_001002006.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens POTE ankyrin domain family, member A (POTEA), transcript variant 1, mRNA. (1838 bp)

..... tgcatgaaaatagcatgatgcaggaagaaattgccatgctaagaatagaactaga .....

position 1658 (CDS: 44 - 1402)

Synonym: A26A1; CT104.3; POTE-8; POTE8
NM_001002920.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens POTE ankyrin domain family, member A (POTEA), transcript variant 2, mRNA. (1976 bp)

..... tgcatgaaaatagcatgatgcaggaagaaattgccatgctaagaatagaactaga .....

position 1796 (CDS: 44 - 1540)

Synonym: A26A1; CT104.3; POTE-8; POTE8
NM_001005365.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 2, mRNA. (7096 bp)

..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaattaa .....

position 3196 (CDS: 367 - 4578)

Synonym: NUCLING
NM_001008224.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger protein 793 (ZNF793), mRNA. (7136 bp)

..... aggccaggcgcagccataagcaagaaaacattgcccaaggagaaaagctgtgaat .....

position 754 (CDS: 443 - 1663)

NM_001013659.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens forkhead box K1 (FOXK1), mRNA. (11191 bp)

..... cttcaatccgggctgacagccaagaagagttttcctcccttcggtgacagggcct .....

position 9724 (CDS: 11 - 2212)

Synonym: FOXK1L
NM_001037165.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 2, mRNA. (3532 bp)

..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgcaag .....

position 1319 (CDS: 170 - 3379)

Synonym: FAM42A; HsT19294; RIA1
NM_001040610.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 5, mRNA. (8257 bp)

..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....

position 4945 (CDS: 104 - 4612)

Synonym: HPTP; HPTPD; HPTPDELTA; PTPD; RPTPDELTA
NM_001040712.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant beta, mRNA. (6910 bp)

..... tccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgc .....

position 4009 (CDS: 409 - 4869)

Synonym: FAM68A; KAB; KIAA0470
NM_001042404.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant gamma, mRNA. (6832 bp)

..... tccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgc .....

position 3901 (CDS: 409 - 4791)

Synonym: FAM68A; KAB; KIAA0470
NM_001042405.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens centrosomal protein 85kDa-like (CEP85L), transcript variant 1, mRNA. (7653 bp)

..... gtaagataatagacagccaacaagatgagattgacagaatgattttagaaattca .....

position 2467 (CDS: 589 - 3006)

Synonym: bA57K17.2; C6orf204; NY-BR-15; RP11-57K17.2
NM_001042475.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens cortexin 3 (CTXN3), transcript variant 1, mRNA. (1683 bp)

..... tatgaatctggtgacaaggccaggaagagatttccttgctctaattatgtctata .....

position 1194 (CDS: 575 - 820)

Synonym: KABE
NM_001048252.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 2, mRNA. (3302 bp)

..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....

position 1067 (CDS: 566 - 2554)

Synonym: MS4A16; NYD-SP21
NM_001079692.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 2, mRNA. (3380 bp)

..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttggc .....

position 1137 (CDS: 183 - 2426)

Synonym: CALCOCO3; T6BP; TXBP151
NM_001079864.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens KIAA1217 (KIAA1217), transcript variant 2, mRNA. (6142 bp)

..... gcagagagaacttgtttatgcaagaggagatggccctggggcccctcgccccgga .....

position 1438 (CDS: 810 - 4604)

Synonym: RP11-324E23.1; SKT
NM_001098500.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens KIAA1217 (KIAA1217), transcript variant 3, mRNA. (5871 bp)

..... gcagagagaacttgtttatgcaagaggagatggccctggggcccctcgccccgga .....

position 1272 (CDS: 404 - 4333)

Synonym: RP11-324E23.1; SKT
NM_001098501.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens sarcalumenin (SRL), mRNA. (4219 bp)

..... cccatcaggaactgttcctccaagaagagatctccctcctagaagacctgaatca .....

position 938 (CDS: 14 - 1435)

NM_001098814.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 1, mRNA. (6797 bp)

..... tccaaccttggcccctctgacaagaagagcttcccaatcatctctggaaagttca .....

position 4128 (CDS: 140 - 4189)

Synonym: OBOE; RAB3IP3; RIM2
NM_001100117.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens actin, beta (ACTB), mRNA. (1852 bp)

..... aacctaacttgcgcagaaaacaagatgagattggcatggctttatttgttttttt .....

position 1273 (CDS: 85 - 1212)

Synonym: BRWS1; PS1TP5BP1
NM_001101.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 1, mRNA. (7376 bp)

..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggc .....

position 4938 (CDS: 399 - 5870)

Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_001105206.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 3, mRNA. (7372 bp)

..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggc .....

position 4934 (CDS: 416 - 5866)

Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_001105207.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens Janus kinase and microtubule interacting protein 3 (JAKMIP3), mRNA. (6488 bp)

..... acaccgatactagaagtcaaaaagaagagagtgcccaagtgtgggtttggaggca .....

position 6013 (CDS: 1 - 2535)

Synonym: bA140A10.5; C10orf14; C10orf39; Jamip3; NECC2
NM_001105521.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens erythrocyte membrane protein band 4.2 (EPB42), transcript variant 2, mRNA. (2464 bp)

..... ccaaccttagctgctttgctcaggaagacattgccatttgtagaccacaccttgc .....

position 2038 (CDS: 301 - 2376)

Synonym: PA; SPH5
NM_001114134.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 2, mRNA. (3873 bp)

..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatttt .....

position 1518 (CDS: 558 - 3284)

Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NM_001127323.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens cortexin 3 (CTXN3), transcript variant 2, mRNA. (1492 bp)

..... tatgaatctggtgacaaggccaggaagagatttccttgctctaattatgtctata .....

position 1003 (CDS: 384 - 629)

Synonym: KABE
NM_001127385.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 4, mRNA. (1630 bp)

..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....

position 1045 (CDS: 310 - 1404)

Synonym: ALDA; GSD12
NM_001127617.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glycerol kinase (GK), transcript variant 3, mRNA. (4572 bp)

..... tttgttttgtagtaaacagtgaagaaaagattgcctcctaattatttttttcaat .....

position 3286 (CDS: 180 - 1841)

Synonym: GK1; GKD
NM_001128127.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 2, mRNA. (3662 bp)

..... aagaagagagaccctcctcggaagatgagattgccctgcatttcgagccccccaa .....

position 1382 (CDS: 458 - 2578)

Synonym: BCL5; BCL6A; LAZ3; ZBTB27; ZNF51
NM_001130845.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 1, mRNA. (14706 bp)

..... taaagagccctaggtatcttccagaagagatggcccactctgacatttcagaaac .....

position 3705 (CDS: 549 - 4943)

Synonym: EPND; GluN2A; NMDAR2A; NR2A
NM_001134407.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 3, mRNA. (4745 bp)

..... taaagagccctaggtatcttccagaagagatggcccactctgacatttcagaaac .....

position 3366 (CDS: 210 - 4055)

Synonym: EPND; GluN2A; NMDAR2A; NR2A
NM_001134408.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens derlin 1 (DERL1), transcript variant 2, mRNA. (3284 bp)

..... cccaacccccacatttgcaactagaagaggttgcccataaaattgctctgccctt .....

position 1415 (CDS: 302 - 997)

Synonym: DER-1; DER1
NM_001134671.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 3, mRNA. (3086 bp)

..... aagaagagagaccctcctcggaagatgagattgccctgcatttcgagccccccaa .....

position 974 (CDS: 50 - 2002)

Synonym: BCL5; BCL6A; LAZ3; ZBTB27; ZNF51
NM_001134738.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens POTE ankyrin domain family, member C (POTEC), mRNA. (2243 bp)

..... tgcgtgaaaacagcatgttgcaggaagaaattgccatgctaatttctggagactg .....

position 2042 (CDS: 455 - 2083)

Synonym: A26B2; CT104.6; POTE-18; POTE18
NM_001137671.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin VA (heavy chain 12, myoxin) (MYO5A), transcript variant 2, mRNA. (12157 bp)

..... ctgggcgggtccttagtctgcaggaagaaattgccaagctccggaaagacctgga .....

position 3209 (CDS: 245 - 5731)

Synonym: GS1; MYH12; MYO5; MYR12
NM_001142495.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 3, mRNA. (3566 bp)

..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatttg .....

position 1877 (CDS: 555 - 2063)

Synonym: FAM13C1
NM_001143773.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens leupaxin (LPXN), transcript variant 1, mRNA. (1892 bp)

..... attttgtctgtactcattgcaaagaagagattggctccagtcccttctttgagcg .....

position 679 (CDS: 121 - 1296)

Synonym: LDPL
NM_001143995.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens stomatin (EPB72)-like 3 (STOML3), transcript variant 2, mRNA. (2020 bp)

..... tgtcccagatcttagctggacgagaagagatcgcccatagcatccagactttact .....

position 712 (CDS: 250 - 1098)

Synonym: Epb7.2l; SRO
NM_001144033.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens inositol(myo)-1(or 4)-monophosphatase 1 (IMPA1), transcript variant 2, mRNA. (3597 bp)

..... aaaaactacaagtttcacaacaagaagatattaccaaatctctcttggtgactga .....

position 779 (CDS: 152 - 1162)

Synonym: IMP; IMPA
NM_001144878.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens HBS1-like (S. cerevisiae) (HBS1L), transcript variant 2, mRNA. (7037 bp)

..... acagtcacccatgttagccacaagaagaggttggctgtttatggtttgcacagtg .....

position 5851 (CDS: 208 - 2136)

Synonym: EF-1a; ERFS; HBS1; HSPC276
NM_001145158.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 3, mRNA. (8957 bp)

..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttct .....

position 891 (CDS: 192 - 2597)

Synonym: HSSOX6; SOXD
NM_001145811.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 4, mRNA. (8919 bp)

..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttct .....

position 772 (CDS: 34 - 2559)

Synonym: HSSOX6; SOXD
NM_001145819.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 2, mRNA. (2851 bp)

..... ttaagatgaccaaattagagtatgaagagattgccttagacttaacacctgtgat .....

position 1597 (CDS: 292 - 1893)

Synonym: KIAA1018; KMIN; MTMR15
NM_001146094.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 3, mRNA. (2748 bp)

..... ttaagatgaccaaattagagtatgaagagattgccttagacttaacacctgtgat .....

position 1494 (CDS: 189 - 1790)

Synonym: KIAA1018; KMIN; MTMR15
NM_001146095.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 4, mRNA. (2864 bp)

..... ttaagatgaccaaattagagtatgaagagattgccttagacttaacacctgtgat .....

position 1610 (CDS: 305 - 1906)

Synonym: KIAA1018; KMIN; MTMR15
NM_001146096.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens RNA binding motif protein, X-linked-like 1 (RBMXL1), transcript variant 1, mRNA. (5128 bp)

..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatacaaga .....

position 1378 (CDS: 717 - 1889)

Synonym: RBM1
NM_001162536.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA. (6269 bp)

..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....

position 4865 (CDS: 245 - 6070)

Synonym: UNQ2430
NM_001164315.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 1, mRNA. (3065 bp)

..... cgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagctt .....

position 139 (CDS: 342 - 2054)

Synonym: 39K2; 39K3
NM_001164380.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 2, mRNA. (2934 bp)

..... cgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagctt .....

position 139 (CDS: 307 - 1923)

Synonym: 39K2; 39K3
NM_001164381.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 3, mRNA. (2888 bp)

..... cgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagctt .....

position 139 (CDS: 363 - 1877)

Synonym: 39K2; 39K3
NM_001164382.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens TLC domain containing 2 (TLCD2), mRNA. (5901 bp)

..... tgcagaggttaaaaaaaaaaaaagcagagattgccagatgctccatttggtagga .....

position 5633 (CDS: 127 - 921)

NM_001164407.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 2, mRNA. (3418 bp)

..... ctaggtcggcgcccgatcggcaagaagagattagcaaattgatgcgaagtgcaag .....

position 1167 (CDS: 42 - 2519)

Synonym: EIF2C2; Q10
NM_001164623.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 2, mRNA. (2071 bp)

..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatactaga .....

position 547 (CDS: 211 - 801)

Synonym: hnRNP-G; HNRNPG; HNRPG; RBMXP1; RBMXRT; RNMX
NM_001164803.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens catenin (cadherin-associated protein), alpha 2 (CTNNA2), transcript variant 2, mRNA. (3870 bp)

..... tgatgccacgcttcgctgaacaagtagaggttgccattgaagccctgagtgccaa .....

position 2041 (CDS: 280 - 2862)

Synonym: CAP-R; CAPR; CT114; CTNR
NM_001164883.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 3, mRNA. (1678 bp)

..... ttgatcccagctggactgctcaagaagaaatggcccttttagaagctgtgatgga .....

position 393 (CDS: 162 - 1493)

Synonym: ADA2; ADA2A; hADA2; KL04P; TADA2L
NM_001166105.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 1, mRNA. (1680 bp)

..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....

position 535 (CDS: 334 - 972)

Synonym: DEN1; NEDP1; PRSC2
NM_001166340.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 4, mRNA. (3477 bp)

..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatttg .....

position 1788 (CDS: 469 - 1974)

Synonym: FAM13C1
NM_001166698.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 1, mRNA. (2924 bp)

..... gaacacttccgcctgtcaggccagaagagatttcctgacaccacagctggaaacc .....

position 37 (CDS: 888 - 2564)

NM_001168479.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 4, mRNA. (2918 bp)

..... gaacacttccgcctgtcaggccagaagagatttcctgacaccacagctggaaacc .....

position 37 (CDS: 882 - 2558)

NM_001168480.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 5, mRNA. (2805 bp)

..... gaacacttccgcctgtcaggccagaagagatttcctgacaccacagctggaaacc .....

position 37 (CDS: 769 - 2445)

NM_001168485.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 6, mRNA. (8266 bp)

..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....

position 4954 (CDS: 104 - 4621)

Synonym: HPTP; HPTPD; HPTPDELTA; PTPD; RPTPDELTA
NM_001171025.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 3, mRNA. (1834 bp)

..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....

position 689 (CDS: 488 - 1126)

Synonym: DEN1; NEDP1; PRSC2
NM_001172109.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 4, mRNA. (1676 bp)

..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....

position 531 (CDS: 330 - 968)

Synonym: DEN1; NEDP1; PRSC2
NM_001172110.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 5, mRNA. (1693 bp)

..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....

position 548 (CDS: 347 - 985)

Synonym: DEN1; NEDP1; PRSC2
NM_001172111.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 3, mRNA. (8685 bp)

..... cctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatgga .....

position 530 (CDS: 272 - 1840)

Synonym: KITENIN; LPP2; STB2; STBM2
NM_001172411.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 2, mRNA. (8635 bp)

..... cctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatgga .....

position 480 (CDS: 216 - 1790)

Synonym: KITENIN; LPP2; STB2; STBM2
NM_001172412.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens centrosomal protein 85kDa-like (CEP85L), transcript variant 3, mRNA. (7141 bp)

..... gtaagataatagacagccaacaagatgagattgacagaatgattttagaaattca .....

position 1955 (CDS: 68 - 2494)

Synonym: bA57K17.2; C6orf204; NY-BR-15; RP11-57K17.2
NM_001178035.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 1, mRNA. (2754 bp)

..... gctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcga .....

position 819 (CDS: 71 - 1069)

Synonym: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
NM_001184714.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 3, mRNA. (2604 bp)

..... gctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcga .....

position 672 (CDS: 71 - 919)

Synonym: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
NM_001184715.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 4, mRNA. (2421 bp)

..... gctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcga .....

position 486 (CDS: 71 - 736)

Synonym: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
NM_001184716.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 2, mRNA. (6570 bp)

..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....

position 541 (CDS: 197 - 3268)

NM_001184773.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 3, mRNA. (6540 bp)

..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....

position 541 (CDS: 197 - 3238)

NM_001184774.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 4, mRNA. (6534 bp)

..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....

position 541 (CDS: 197 - 3232)

NM_001184775.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 5, mRNA. (6348 bp)

..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....

position 541 (CDS: 197 - 3046)

NM_001184776.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 6, mRNA. (6345 bp)

..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....

position 541 (CDS: 197 - 3043)

NM_001184777.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 4, mRNA. (3642 bp)

..... gcccctgatgcttcggggccccagaagagatcgccaggagacactgccaaagatg .....

position 177 (CDS: 28 - 867)

Synonym: D1S2223E; HK33; PBD12A; PMP1; PMPI; PXF; PXMP1
NM_001193644.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myeloid leukemia factor 1 (MLF1), transcript variant 4, mRNA. (2538 bp)

..... ttcttctcagaccatgcaagcaagaagagaatggcatgaaatatataaagtgttg .....

position 197 (CDS: 364 - 1263)

NM_001195432.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 3, mRNA. (3621 bp)

..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....

position 3113 (CDS: 134 - 1705)

Synonym: BT2.2; BTF2
NM_001197237.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 4, mRNA. (1820 bp)

..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....

position 1291 (CDS: 235 - 1245)

Synonym: BT2.2; BTF2
NM_001197238.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 5, mRNA. (2969 bp)

..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....

position 2461 (CDS: 112 - 1053)

Synonym: BT2.2; BTF2
NM_001197239.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 6, mRNA. (3470 bp)

..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....

position 2962 (CDS: 112 - 882)

Synonym: BT2.2; BTF2
NM_001197240.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 1, mRNA. (5496 bp)

..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtacac .....

position 2284 (CDS: 199 - 2253)

Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001197294.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 1, mRNA. (6515 bp)

..... agagtggacactgctgttatcaagcagagagtgccgatcttactcaagtacctag .....

position 5197 (CDS: 623 - 5488)

Synonym: eIF-4G 3; eIF4G 3; eIF4GII
NM_001198801.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 2, mRNA. (6425 bp)

..... agagtggacactgctgttatcaagcagagagtgccgatcttactcaagtacctag .....

position 5107 (CDS: 623 - 5398)

Synonym: eIF-4G 3; eIF4G 3; eIF4GII
NM_001198802.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 3, mRNA. (2847 bp)

..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....

position 1379 (CDS: 113 - 1894)

Synonym: AIRP; CN-IB; CN1B
NM_001199086.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 4, mRNA. (2949 bp)

..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....

position 1481 (CDS: 113 - 1996)

Synonym: AIRP; CN-IB; CN1B
NM_001199087.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 5, mRNA. (2904 bp)

..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....

position 1436 (CDS: 113 - 1951)

Synonym: AIRP; CN-IB; CN1B
NM_001199088.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens NT5C1B-RDH14 readthrough (NT5C1B-RDH14), transcript variant 1, mRNA. (2533 bp)

..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....

position 1256 (CDS: 113 - 2065)

NM_001199103.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens NT5C1B-RDH14 readthrough (NT5C1B-RDH14), transcript variant 2, mRNA. (2982 bp)

..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....

position 1430 (CDS: 113 - 1921)

NM_001199104.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens actin, gamma 1 (ACTG1), transcript variant 1, mRNA. (2123 bp)

..... caaaaggcggggtcgcaatggaagaagagatcgccgcgctggtcattgacaatgg .....

position 262 (CDS: 259 - 1386)

Synonym: ACT; ACTG; BRWS2; DFNA20; DFNA26
NM_001199954.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glycerol kinase (GK), transcript variant 4, mRNA. (4590 bp)

..... tttgttttgtagtaaacagtgaagaaaagattgcctcctaattatttttttcaat .....

position 3304 (CDS: 180 - 1859)

Synonym: GK1; GKD
NM_001205019.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 1, mRNA. (15101 bp)

..... gtgccaaggagccaacgatccaagaagagagagcccaggatttaaggaggaccaa .....

position 3115 (CDS: 196 - 7137)

Synonym: BII; CACH6; CACNL1A6; Cav2.3
NM_001205293.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 2, mRNA. (14915 bp)

..... gtgccaaggagccaacgatccaagaagagagagcccaggatttaaggaggaccaa .....

position 3058 (CDS: 196 - 6951)

Synonym: BII; CACH6; CACNL1A6; Cav2.3
NM_001205294.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 2, mRNA. (6469 bp)

..... ctcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaat .....

position 1030 (CDS: 331 - 1515)

Synonym: Bif-1; CGI-61; dJ612B15.2; PPP1R70
NM_001206651.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 3, mRNA. (6445 bp)

..... ctcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaat .....

position 1006 (CDS: 331 - 1491)

Synonym: Bif-1; CGI-61; dJ612B15.2; PPP1R70
NM_001206652.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 4, mRNA. (6240 bp)

..... ctcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaat .....

position 801 (CDS: 489 - 1286)

Synonym: Bif-1; CGI-61; dJ612B15.2; PPP1R70
NM_001206653.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 3, mRNA. (3383 bp)

..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttggc .....

position 1140 (CDS: 186 - 2429)

Synonym: CALCOCO3; T6BP; TXBP151
NM_001206901.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 4, mRNA. (3192 bp)

..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttggc .....

position 949 (CDS: 466 - 2238)

Synonym: CALCOCO3; T6BP; TXBP151
NM_001206902.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 1, mRNA. (3490 bp)

..... tggtcctaggctcacctaagccagaagagattccccttacttggatacaaccagg .....

position 967 (CDS: 145 - 3084)

Synonym: dJ292B18.2; FTHFSDC1; MTC1THFS; RP1-292B18.2
NM_001242767.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 3, mRNA. (3174 bp)

..... tggtcctaggctcacctaagccagaagagattccccttacttggatacaaccagg .....

position 651 (CDS: 27 - 2768)

Synonym: dJ292B18.2; FTHFSDC1; MTC1THFS; RP1-292B18.2
NM_001242768.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 6, mRNA. (1751 bp)

..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....

position 1166 (CDS: 269 - 1525)

Synonym: ALDA; GSD12
NM_001243177.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 40 (CCDC40), transcript variant 2, mRNA. (3562 bp)

..... ccactcgagcccagcaactggaagaagacattgccctgtttgaggctcagtactt .....

position 1391 (CDS: 32 - 3124)

Synonym: CILD15
NM_001243342.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens small integral membrane protein 22 (SMIM22), transcript variant 1, mRNA. (1032 bp)

..... ttaagttgcagcgtcaaaaacatgaagagattgctttagcaaatatttacccagt .....

position 270 (CDS: 521 - 772)

NM_001253790.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 2, mRNA. (5678 bp)

..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....

position 5313 (CDS: 359 - 3838)

Synonym: TBC; TBC1
NM_001253912.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 3, mRNA. (3344 bp)

..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....

position 2979 (CDS: 707 - 1504)

Synonym: TBC; TBC1
NM_001253913.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 4, mRNA. (2990 bp)

..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....

position 2625 (CDS: 353 - 1150)

Synonym: TBC; TBC1
NM_001253914.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 5, mRNA. (2540 bp)

..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....

position 2175 (CDS: 158 - 700)

Synonym: TBC; TBC1
NM_001253915.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 2, mRNA. (4292 bp)

..... tctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttaca .....

position 1429 (CDS: 300 - 2222)

Synonym: C10orf119; MCM-BP
NM_001256378.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 3, mRNA. (4102 bp)

..... tctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttaca .....

position 1239 (CDS: 629 - 2032)

Synonym: C10orf119; MCM-BP
NM_001256379.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens multiple EGF-like-domains 10 (MEGF10), transcript variant 2, mRNA. (7638 bp)

..... tgtggagatgaaatcgccggcacgaagagattccccatatgcagagatcaataac .....

position 3475 (CDS: 312 - 3734)

Synonym: EMARDD
NM_001256545.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens titin (TTN), transcript variant N2BA, mRNA. (104301 bp)

..... aagtgcctaaagaacttgaaccagaagaggttgcctttgaagaggaagttgtaac .....

position 32719 (CDS: 226 - 103278)

Synonym: CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J; MYLK5; TMD
NM_001256850.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens POTE ankyrin domain family member D-like (LOC100288966), mRNA. (1826 bp)

..... tgcgtgaaaacagcgtgttgcaggaagaaattgccgtgctaagactggaactaga .....

position 1640 (CDS: 53 - 1807)

NM_001257362.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 1, mRNA. (4142 bp)

..... cgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagt .....

position 1609 (CDS: 118 - 3282)

NM_001257967.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 3, mRNA. (3611 bp)

..... cgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagt .....

position 1634 (CDS: 95 - 3283)

NM_001257968.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 132 (CCDC132), transcript variant 3, mRNA. (5741 bp)

..... atgggtatgaatctgatgaacaagaaaagagtgcctatcaagagtatgacagtga .....

position 1801 (CDS: 247 - 3051)

NM_001257998.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 2, mRNA. (7613 bp)

..... aagacgttcgtaatgccacccaagaagcggttgccgctttgctaaagtgttccct .....

position 5476 (CDS: 223 - 6336)

Synonym: HYC2; MUPP1
NM_001261406.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 3, mRNA. (7526 bp)

..... aagacgttcgtaatgccacccaagaagcggttgccgctttgctaaaggtgagtga .....

position 5476 (CDS: 223 - 6249)

Synonym: HYC2; MUPP1
NM_001261407.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 3, mRNA. (3401 bp)

..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....

position 1166 (CDS: 566 - 2653)

Synonym: MS4A16; NYD-SP21
NM_001261827.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 4, mRNA. (3452 bp)

..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....

position 1217 (CDS: 566 - 2704)

Synonym: MS4A16; NYD-SP21
NM_001261828.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens titin (TTN), transcript variant IC, mRNA. (109224 bp)

..... aagtgcctaaagaacttgaaccagaagaggttgcctttgaagaggaagttgtaac .....

position 33670 (CDS: 226 - 108201)

Synonym: CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J; MYLK5; TMD
NM_001267550.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 1, mRNA. (3452 bp)

..... taagaacaggctcgtatctggaggaagagattgccaggtaaaagtatgggatgta .....

position 1764 (CDS: 233 - 3391)

Synonym: Fbw10; HREP; SM25H2; SM2SH2
NM_001267585.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 2, mRNA. (3293 bp)

..... taagaacaggctcgtatctggaggaagagattgccaggtaaaagtatgggatgta .....

position 1764 (CDS: 233 - 3232)

Synonym: Fbw10; HREP; SM25H2; SM2SH2
NM_001267586.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens enkurin, TRPC channel interacting protein (ENKUR), transcript variant 2, mRNA. (3312 bp)

..... agcaacaagtcctacttgctcaagaagagaatgactcaatacgcaggattaggct .....

position 59 (CDS: 320 - 904)

Synonym: C10orf63
NM_001270383.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 2, mRNA. (2525 bp)

..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....

position 2277 (CDS: 69 - 2327)

Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271696.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 3, mRNA. (2405 bp)

..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....

position 2157 (CDS: 69 - 2207)

Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271697.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 4, mRNA. (2447 bp)

..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....

position 2199 (CDS: 69 - 2249)

Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271698.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 5, mRNA. (2408 bp)

..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....

position 2160 (CDS: 69 - 2210)

Synonym: ABC7; ASAT; Atm1p; EST140535
NM_001271699.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 2, mRNA. (6291 bp)

..... gaagacaaagtaccactgataaagaagagattgtcaaatagatgcattcctagtc .....

position 5353 (CDS: 206 - 1120)

Synonym: DUBA8; OTUD2; PRO0907; RP11-164O23.1
NM_001276320.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 2, mRNA. (10440 bp)

..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggctgctg .....

position 475 (CDS: 392 - 5419)

NM_001278469.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 3, mRNA. (10361 bp)

..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggctgctg .....

position 475 (CDS: 392 - 5527)

NM_001278470.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 4, mRNA. (10292 bp)

..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggctgctg .....

position 475 (CDS: 392 - 5458)

NM_001278471.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 5, mRNA. (10457 bp)

..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggtacaga .....

position 475 (CDS: 686 - 5623)

NM_001278472.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens aldo-keto reductase family 1, member C2 (AKR1C2), transcript variant 1, mRNA. (3621 bp)

..... aacttgactgatgtaagtgtcaagaaaagattgacattttgttaaaacttcgtag .....

position 3161 (CDS: 414 - 1385)

Synonym: AKR1C-pseudo; BABP; DD; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8
NM_001354.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 2, mRNA. (5066 bp)

..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtacac .....

position 1854 (CDS: 111 - 1823)

Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001387.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens E1A binding protein p300 (EP300), mRNA. (8761 bp)

..... cggcgcggggaccccgggccgaagaagagatttcctgaggattctggttttcctc .....

position 336 (CDS: 396 - 7640)

Synonym: KAT3B; p300; RSTS2
NM_001429.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 1, mRNA. (1886 bp)

..... ttgatcccagctggactgctcaagaagaaatggcccttttagaagctgtgatgga .....

position 601 (CDS: 370 - 1701)

Synonym: ADA2; ADA2A; hADA2; KL04P; TADA2L
NM_001488.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens actin, gamma 1 (ACTG1), transcript variant 2, mRNA. (2004 bp)

..... tttctctgccggtcgcaatggaagaagagatcgccgcgctggtcattgacaatgg .....

position 143 (CDS: 140 - 1267)

Synonym: ACT; ACTG; BRWS2; DFNA20; DFNA26
NM_001614.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 1, mRNA. (3575 bp)

..... aagaagagagaccctcctcggaagatgagattgccctgcatttcgagccccccaa .....

position 1290 (CDS: 366 - 2486)

Synonym: BCL5; BCL6A; LAZ3; ZBTB27; ZNF51
NM_001706.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens carboxypeptidase A3 (mast cell) (CPA3), mRNA. (1699 bp)

..... aaatcttgattcatgatctacaagaagagattgagaaacagtttgatgttaaaga .....

position 341 (CDS: 53 - 1306)

Synonym: MC-CPA
NM_001870.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 1, mRNA. (2097 bp)

..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatactaga .....

position 872 (CDS: 211 - 1386)

Synonym: hnRNP-G; HNRNPG; HNRPG; RBMXP1; RBMXRT; RNMX
NM_002139.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens inositol 1,4,5-trisphosphate receptor, type 2 (ITPR2), mRNA. (12568 bp)

..... agcaacaaatatcttactgtcaacaagagattacctgctttactggagaagaatg .....

position 819 (CDS: 418 - 8523)

Synonym: IP3R2
NM_002223.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens kinesin family member 3C (KIF3C), mRNA. (5431 bp)

..... acacactgctgcgggaattccaagaggagattgcccgcctgaaggcccagctgga .....

position 1807 (CDS: 658 - 3039)

NM_002254.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 2, mRNA. (7355 bp)

..... tgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggc .....

position 4917 (CDS: 399 - 5849)

Synonym: CMD1JJ; LAMA3; LAMA4*-1
NM_002290.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens microtubule-associated protein 2 (MAP2), transcript variant 1, mRNA. (9445 bp)

..... ctccagaatcatctctaattcaagatgagattgccgtcaaattgtcagtggaaat .....

position 3732 (CDS: 249 - 5732)

Synonym: MAP2A; MAP2B; MAP2C
NM_002374.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens matrilin 2 (MATN2), transcript variant 1, mRNA. (4122 bp)

..... gaaaagccattgaggaggaactacaagagattgcctctgagcccacaaacaagca .....

position 2635 (CDS: 232 - 3102)

NM_002380.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens prefoldin subunit 4 (PFDN4), mRNA. (1383 bp)

..... aagaagcaaagaaaaatttgcaagaagaaattgacgccttagaatccagagtgga .....

position 421 (CDS: 139 - 543)

Synonym: C1; PFD4
NM_002623.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens polymerase (DNA directed), alpha 2, accessory subunit (POLA2), mRNA. (2514 bp)

..... actacccactctacccgccccaagaagacatggccattgactatgagtcgttcta .....

position 1885 (CDS: 343 - 2139)

NM_002689.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 1, mRNA. (10127 bp)

..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....

position 6815 (CDS: 744 - 6482)

Synonym: HPTP; HPTPD; HPTPDELTA; PTPD; RPTPDELTA
NM_002839.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 1, mRNA. (3722 bp)

..... gcccctgatgcttcggggccccagaagagatcgccaggagacactgccaaagatg .....

position 177 (CDS: 28 - 927)

Synonym: D1S2223E; HK33; PBD12A; PMP1; PMPI; PXF; PXMP1
NM_002857.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens UPF1 regulator of nonsense transcripts homolog (yeast) (UPF1), mRNA. (5360 bp)

..... tcttctacgtgacccagggccaagaggagattgccagctcgggcacctcctacct .....

position 2535 (CDS: 276 - 3632)

Synonym: HUPF1; NORF1; pNORF1; RENT1; smg-2
NM_002911.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens spectrin, alpha, erythrocytic 1 (elliptocytosis 2) (SPTA1), mRNA. (8017 bp)

..... ttgctgatgaacactatgccaaagaagagattgctacgcggctccaacgtgtact .....

position 4601 (CDS: 200 - 7459)

Synonym: EL2; HPP; HS3; SPH3; SPTA
NM_003126.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens translocated promoter region, nuclear basket protein (TPR), mRNA. (9727 bp)

..... gtaaaggagccatattgtctgaagaagagcttgccgccatgtctcctactgcagc ..... aagaactattaaaaaatgctcaaaaagaaattgccacattgaaacagcacctcag .....

position 1411 2989 (CDS: 298 - 7389)

NM_003292.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens vimentin (VIM), mRNA. (2151 bp)

..... aacgcaaagtggaatctttgcaagaagagattgcctttttgaagaaactccacga .....

position 1095 (CDS: 414 - 1814)

NM_003380.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens poly (ADP-ribose) glycohydrolase (PARG), mRNA. (4276 bp)

..... atcattccatcacaatgtcgcaggaacagattgccagtcttttagctaatgcttt .....

position 2140 (CDS: 262 - 3192)

Synonym: PARG99
NM_003631.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 3, mRNA. (6041 bp)

..... agagtggacactgctgttatcaagcagagagtgccgatcttactcaagtacctag .....

position 4723 (CDS: 257 - 5014)

Synonym: eIF-4G 3; eIF4G 3; eIF4GII
NM_003760.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin, heavy chain 13, skeletal muscle (MYH13), mRNA. (5992 bp)

..... ggcgagagaacaaaaatctgcaagaagagatttccgacttaactgagcagattgc .....

position 4618 (CDS: 91 - 5907)

Synonym: MyHC-eo
NM_003802.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 (CDS2), mRNA. (9323 bp)

..... ggtaagggccctctggaaatcaagcagagaatgcctttgcagtggtctcccgggc .....

position 7839 (CDS: 333 - 1670)

NM_003818.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 1, mRNA. (7625 bp)

..... aagacgttcgtaatgccacccaagaagcggttgccgctttgctaaaggtgagtga .....

position 5575 (CDS: 223 - 6348)

Synonym: HYC2; MUPP1
NM_003829.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 (ATP6V0E1), mRNA. (894 bp)

..... gtgctcagtctttgaggtcacgagaagagaatgccttctagatgcaaaatcacct .....

position 388 (CDS: 102 - 347)

Synonym: ATP6H; ATP6V0E; M9.2; Vma21; Vma21p
NM_003945.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens heat shock 70kDa protein 9 (mortalin) (HSPA9), mRNA. (3506 bp)

..... ctgatgagtgcaacaagctgaaagaagagatttccaaaatgagggagctcctggc .....

position 2145 (CDS: 312 - 2351)

Synonym: CSA; GRP-75; GRP75; HSPA9B; MOT; MOT2; MTHSP75; PBP74
NM_004134.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 1, mRNA. (2528 bp)

..... aggaggaaagaaagaaactacaagaagaaattgtcaatagtgtgaaaggctgtgg .....

position 2280 (CDS: 69 - 2330)

Synonym: ABC7; ASAT; Atm1p; EST140535
NM_004299.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens cytochrome c oxidase assembly homolog 15 (yeast) (COX15), transcript variant 2, mRNA. (6450 bp)

..... ggctgggcttatgctattgcctagaagagattcccaacttctctcttatttgaat .....

position 3466 (CDS: 618 - 1784)

Synonym: CEMCOX2
NM_004376.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant A, mRNA. (9752 bp)

..... cgttcaggtgcttggaccttcaggaaaagattgcccatcttgtcatttgaccagg .....

position 8339 (CDS: 252 - 1235)

Synonym: CREB
NM_004379.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens catenin (cadherin-associated protein), alpha 2 (CTNNA2), transcript variant 1, mRNA. (4005 bp)

..... tgatgccacgcttcgctgaacaagtagaggttgccattgaagccctgagtgccaa .....

position 2041 (CDS: 280 - 2997)

Synonym: CAP-R; CAPR; CT114; CTNR
NM_004389.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 1, mRNA. (3883 bp)

..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgcag .....

position 1109 (CDS: 216 - 2624)

Synonym: MSK1; MSPK1; RLPK
NM_004755.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens kinesin family member 3B (KIF3B), mRNA. (6135 bp)

..... atgccctccttcgagaattccaggaagagattgctcggctcaaggcccagctgga .....

position 1255 (CDS: 181 - 2424)

Synonym: FLA8; HH0048; KLP-11
NM_004798.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens leupaxin (LPXN), transcript variant 2, mRNA. (1926 bp)

..... attttgtctgtactcattgcaaagaagagattggctccagtcccttctttgagcg .....

position 689 (CDS: 146 - 1306)

Synonym: LDPL
NM_004811.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens aldolase C, fructose-bisphosphate (ALDOC), mRNA. (1665 bp)

..... cctgtcccatcaagtataccccagaggagattgccatggcaactgtcactgccct .....

position 881 (CDS: 146 - 1240)

Synonym: ALDC
NM_005165.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens LIM domain 7 (LMO7), transcript variant 1, mRNA. (7253 bp)

..... caaatcgagtcactgtcaagcaagaagagactgacaggagagtgaaaaatgtttt .....

position 1735 (CDS: 1261 - 5310)

Synonym: FBX20; FBXO20; LOMP
NM_005358.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protein tyrosine phosphatase, non-receptor type 14 (PTPN14), mRNA. (13443 bp)

..... ttctagtggagctcatcaacaaagaagagactgccctctttcacacggatgatat .....

position 1473 (CDS: 654 - 4217)

Synonym: PEZ; PTP36
NM_005401.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens inositol(myo)-1(or 4)-monophosphatase 1 (IMPA1), transcript variant 1, mRNA. (3396 bp)

..... aaaaactacaagtttcacaacaagaagatattaccaaatctctcttggtgactga .....

position 578 (CDS: 128 - 961)

Synonym: IMP; IMPA
NM_005536.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens lipoprotein, Lp(a) (LPA), mRNA. (6489 bp)

..... ggctgttcttggagcccacacaagcagatattgccttgctaaagctaagcaggcc .....

position 5824 (CDS: 121 - 6243)

Synonym: AK38; APOA; LP
NM_005577.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger protein 239 (ZNF239), transcript variant 1, mRNA. (2406 bp)

..... atgacaactcagcaatgacacaagaagagagtgacacagaaagattcagtagctg .....

position 169 (CDS: 654 - 2030)

Synonym: HOK-2; MOK2
NM_005674.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I, mRNA. (3007 bp)

..... tccacccccacagcagacctcaagtagaaattgcccaatttttaccagctggagg .....

position 2682 (CDS: 127 - 1494)

Synonym: EAD
NM_005677.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens phenylalanyl-tRNA synthetase, beta subunit (FARSB), mRNA. (2233 bp)

..... ttacctttgccctgtgctcccaagaagatattgctgataaactaggtgtggatat .....

position 1293 (CDS: 36 - 1805)

Synonym: FARSLB; FRSB; HSPC173; PheHB; PheRS
NM_005687.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 1, mRNA. (3506 bp)

..... aaagcgtgattactcatttcaaagaagagattggcaggctgcagttatgtttggc .....

position 1137 (CDS: 183 - 2552)

Synonym: CALCOCO3; T6BP; TXBP151
NM_006024.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta (PIK3CB), transcript variant 1, mRNA. (5931 bp)

..... agatcaagaaaatgtatgaacaagaaatgattgccatagaggctgccataaatcg .....

position 899 (CDS: 17 - 3229)

Synonym: P110BETA; PI3K; PI3KBETA; PIK3C1
NM_006219.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protein phosphatase 2, regulatory subunit B', beta (PPP2R5B), mRNA. (2766 bp)

..... ggggagggggagggcacaggcaagaagagattcacagtgtcctggggtaaggggg .....

position 2643 (CDS: 623 - 2116)

Synonym: B56B; PR61B
NM_006244.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens intersectin 2 (ITSN2), transcript variant 1, mRNA. (6112 bp)

..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaagaa .....

position 1690 (CDS: 259 - 5352)

Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_006277.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens CMT1A duplicated region transcript 1 (CDRT1), mRNA. (2780 bp)

..... taagaacaggctcgtatctggaggaagagattgccaggtaaaagtatgggatgta .....

position 1724 (CDS: 193 - 2451)

Synonym: C170RF1; C17ORF1; C17ORF1A; FBXW10B; FBXW10P1; HREP; SM25H2
NM_006382.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens fucosyltransferase 9 (alpha (1,3) fucosyltransferase) (FUT9), mRNA. (12815 bp)

..... ctgaagatgccatccttgtccaaggtgagattgccagaggatatgagctcatcta .....

position 9453 (CDS: 342 - 1421)

Synonym: Fuc-TIX
NM_006581.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens HBS1-like (S. cerevisiae) (HBS1L), transcript variant 1, mRNA. (7163 bp)

..... acagtcacccatgttagccacaagaagaggttggctgtttatggtttgcacagtg .....

position 5977 (CDS: 208 - 2262)

Synonym: EF-1a; ERFS; HBS1; HSPC276
NM_006620.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2), mRNA. (9732 bp)

..... cgccctctgagcaggttcttcaagaagattttgcctcggcaaatgctgggtcttt .....

position 4686 (CDS: 744 - 8084)

Synonym: HIV-EP2; MBP-2; MIBP1; SHN2; ZAS2; ZNF40B
NM_006734.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin IXA (MYO9A), mRNA. (8722 bp)

..... aacttcataagactatgtctcaaggagagattaccaagttggcagtgagacagaa .....

position 5691 (CDS: 492 - 8138)

NM_006901.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 1, mRNA. (3602 bp)

..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....

position 3091 (CDS: 112 - 1683)

Synonym: BT2.2; BTF2
NM_006995.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 1, mRNA. (3520 bp)

..... ctaggtcggcgcccgatcggcaagaagagattagcaaattgatgcgaagtgcaag .....

position 1167 (CDS: 42 - 2621)

Synonym: EIF2C2; Q10
NM_012154.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ATPase, H+ transporting, lysosomal V0 subunit a2 (ATP6V0A2), mRNA. (6550 bp)

..... tataaatgaagatattttaccatgaagagattgcacttatccttgagaacagtct ..... tataaatgaagatattttaccatgaagagattgcacttatccttgagaacagtct .....

position 3995 4053 (CDS: 249 - 2819)

Synonym: A2; ARCL; ARCL2A; ATP6A2; ATP6N1D; J6B7; RTF; STV1; TJ6; TJ6M; TJ6S; VPH1; WSS
NM_012463.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens mitochondrial ribosomal protein S18B (MRPS18B), mRNA. (1536 bp)

..... ggctttaccagggtcatctccaagaagagagtggccccccacctgagtcaatgcc .....

position 830 (CDS: 158 - 934)

Synonym: C6orf14; HSPC183; HumanS18a; MRP-S18-2; MRPS18-2; PTD017; S18amt
NM_014046.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens trichorhinophalangeal syndrome I (TRPS1), mRNA. (9990 bp)

..... gtgattttattacccaagtggaagaagagatttcccgacactacaggagagcaca .....

position 2649 (CDS: 579 - 4463)

Synonym: GC79; LGCR
NM_014112.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger and BTB domain containing 44 (ZBTB44), mRNA. (9351 bp)

..... actggtgcctcccgttgcatcaggtagagattgcctgcctctttgtagggcagcc .....

position 7877 (CDS: 395 - 1756)

Synonym: BTBD15; HSPC063; ZNF851
NM_014155.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 5, mRNA. (4161 bp)

..... cgtctgcaaagtgtccccggcaagaagaggctgcctaccacaaggactttagctt .....

position 139 (CDS: 307 - 1746)

Synonym: 39K2; 39K3
NM_014393.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens lipin 2 (LPIN2), mRNA. (6245 bp)

..... atccttagcttgcaagtattccagaagagcttgcctaaggccacagttgagtcct .....

position 1841 (CDS: 240 - 2930)

NM_014646.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 2, mRNA. (6420 bp)

..... tccaaccttggcccctctgacaagaagagcttcccaatcatctctggaaagttca .....

position 3751 (CDS: 321 - 3812)

Synonym: OBOE; RAB3IP3; RIM2
NM_014677.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 144A (CCDC144A), mRNA. (5828 bp)

..... ttcatgaagattgcatgttgcaggaagaaattgccttgctgagactggaaataga .....

position 2549 (CDS: 77 - 4360)

NM_014695.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens STE20-like kinase (SLK), mRNA. (5629 bp)

..... gacctaggaaaaagacactggaagaagagtttgccaggaaactacaggaacagga .....

position 3602 (CDS: 35 - 3742)

Synonym: bA16H23.1; LOSK; se20-9; STK2
NM_014720.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2), mRNA. (2807 bp)

..... accagggggagagaccagaccaagaagagaatggccaagcccaaaaaccgggctg .....

position 590 (CDS: 489 - 2387)

Synonym: ALEX2
NM_014782.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens centrosomal protein 350kDa (CEP350), mRNA. (13473 bp)

..... gttctgaattggaagatgaaaaagaagagatttcctctccagatatgtgtcccag .....

position 8856 (CDS: 384 - 9737)

Synonym: CAP350; GM133
NM_014810.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant alpha, mRNA. (7204 bp)

..... tccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgc .....

position 4303 (CDS: 409 - 5163)

Synonym: FAM68A; KAB; KIAA0470
NM_014812.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 1, mRNA. (4901 bp)

..... ttaagatgaccaaattagagtatgaagagattgccttagacttaacacctgtgat .....

position 1597 (CDS: 292 - 3345)

Synonym: KIAA1018; KMIN; MTMR15
NM_014967.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin, heavy chain 15 (MYH15), mRNA. (7074 bp)

..... ggagggagaacaagaacctccaagaagagatttctaatctgacaaaccaggttag .....

position 4609 (CDS: 58 - 5898)

NM_014981.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 1, mRNA. (10379 bp)

..... cgcgccttgtcactggagtgcaagaagaaattcccacctgtcaaagaggctgctg .....

position 475 (CDS: 392 - 5545)

NM_015026.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens trafficking protein, kinesin binding 2 (TRAK2), mRNA. (6527 bp)

..... gtgatgagctgattcgataccaagaagagctttcctctcttttgtcacagattgt .....

position 1287 (CDS: 447 - 3191)

Synonym: ALS2CR3; CALS-C; GRIF-1; GRIF1; MILT2; OIP98
NM_015049.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens MYC binding protein 2, E3 ubiquitin protein ligase (MYCBP2), mRNA. (15025 bp)

..... cttgatccagataccctccgcaagaagaaaatgcccctcacagaacctttgagag .....

position 8913 (CDS: 268 - 14304)

Synonym: PAM
NM_015057.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin phosphatase Rho interacting protein (MPRIP), transcript variant 1, mRNA. (10960 bp)

..... tcaacattaacttttcctgaaaagaagagtttgcctaacatggtcctaaagaagc .....

position 7401 (CDS: 90 - 3206)

Synonym: M-RIP; MRIP; p116Rip; RHOIP3; RIP3
NM_015134.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 1, mRNA. (5705 bp)

..... catctcttaatcctggggtaaaaggagagattgccatacttagactcactgtgag .....

position 5340 (CDS: 359 - 3865)

Synonym: TBC; TBC1
NM_015173.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ubiquitin protein ligase E3 component n-recognin 2 (UBR2), transcript variant 1, mRNA. (7898 bp)

..... acaaagctgagaggaagagaaaagcagagattgccagactgcgcagagaaaagat .....

position 3398 (CDS: 299 - 5566)

Synonym: bA49A4.1; C6orf133; dJ242G1.1; dJ392M17.3; RP3-392M17.3
NM_015255.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens HAUS augmin-like complex, subunit 5 (HAUS5), mRNA. (4309 bp)

..... tgggggtgaggaatgtattaaaagatgagattgccttctagtttgtatagtttct .....

position 2551 (CDS: 52 - 1953)

Synonym: dgt5; KIAA0841
NM_015302.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens UFM1-specific ligase 1 (UFL1), mRNA. (4219 bp)

..... ataatgaattagacaaagaacaagaagatgttgccagtactactcgtaaagagct .....

position 2329 (CDS: 49 - 2433)

Synonym: KIAA0776; Maxer; NLBP; RCAD; RP3-393D12.1
NM_015323.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ABI family, member 3 (NESH) binding protein (ABI3BP), mRNA. (4488 bp)

..... ctgagcacaaaaagataatgcacgatgagattgcctaccattttataggatattt .....

position 4149 (CDS: 86 - 3313)

Synonym: NESHBP; TARSH
NM_015429.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 2, mRNA. (3487 bp)

..... tggtcctaggctcacctaagccagaagagattccccttacttggatacaaccagg .....

position 964 (CDS: 145 - 3081)

Synonym: dJ292B18.2; FTHFSDC1; MTC1THFS; RP1-292B18.2
NM_015440.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger, DHHC-type containing 5 (ZDHHC5), mRNA. (4582 bp)

..... cttaaagggcttgggaataacaagaagagattgaagacagagaagcttgccctgt .....

position 451 (CDS: 1257 - 3404)

Synonym: DHHC5; ZNF375
NM_015457.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens LIM domain 7 (LMO7), transcript variant 2, mRNA. (6791 bp)

..... caaatcgagtcactgtcaagcaagaagagactgacaggagagtgaaaaatgtttt .....

position 380 (CDS: 761 - 4918)

Synonym: FBX20; FBXO20; LOMP
NM_015842.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1, mRNA. (6382 bp)

..... ctcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaat .....

position 943 (CDS: 331 - 1428)

Synonym: Bif-1; CGI-61; dJ612B15.2; PPP1R70
NM_016009.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SHC (Src homology 2 domain containing) transforming protein 3 (SHC3), mRNA. (9768 bp)

..... cctggtgcgaagggagccttcaagaagagaaagcctccaagcaaaatgctgtcca .....

position 904 (CDS: 308 - 2092)

Synonym: N-Shc; NSHC; RAI; SHCC
NM_016848.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 1, mRNA. (8979 bp)

..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttct .....

position 913 (CDS: 205 - 2619)

Synonym: HSSOX6; SOXD
NM_017508.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 132 (CCDC132), transcript variant 1, mRNA. (5713 bp)

..... atgggtatgaatctgatgaacaagaaaagagtgcctatcaagagtatgacagtga .....

position 1773 (CDS: 129 - 3023)

NM_017667.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens INO80 complex subunit D (INO80D), mRNA. (14136 bp)

..... gtttgtaatttccctttaaacaagaagagatggctcacattttccatatatatct .....

position 13847 (CDS: 406 - 3489)

NM_017759.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 40 (CCDC40), transcript variant 1, mRNA. (4311 bp)

..... ccactcgagcccagcaactggaagaagacattgccctgtttgaggctcagtactt .....

position 1391 (CDS: 32 - 3460)

Synonym: CILD15
NM_017950.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 1, mRNA. (6873 bp)

..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaattaa .....

position 2973 (CDS: 105 - 4355)

Synonym: NUCLING
NM_018003.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 1, mRNA. (6265 bp)

..... gaagacaaagtaccactgataaagaagagattgtcaaatagatgcattcctagtc .....

position 5327 (CDS: 48 - 1094)

Synonym: DUBA8; OTUD2; PRO0907; RP11-164O23.1
NM_018566.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protocadherin beta 14 (PCDHB14), mRNA. (3973 bp)

..... acggctgagcttcagtttttccacaagagattgcctaaaggaaccatggagatca .....

position 1156 (CDS: 1181 - 3577)

Synonym: PCDH-BETA14
NM_018934.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens KIAA1217 (KIAA1217), transcript variant 1, mRNA. (7773 bp)

..... gcagagagaacttgtttatgcaagaggagatggccctggggcccctcgccccgga .....

position 1272 (CDS: 404 - 6235)

Synonym: RP11-324E23.1; SKT
NM_019590.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens intersectin 2 (ITSN2), transcript variant 3, mRNA. (6031 bp)

..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaagaa .....

position 1690 (CDS: 259 - 5271)

Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_019595.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens RNA binding motif protein, X-linked-like 1 (RBMXL1), transcript variant 2, mRNA. (5028 bp)

..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatacaaga .....

position 1278 (CDS: 617 - 1789)

Synonym: RBM1
NM_019610.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens Ral GTPase activating protein, beta subunit (non-catalytic) (RALGAPB), mRNA. (8636 bp)

..... atgatggtgaaggatctcaacaagaagtgatttcctctgaagatattggagctag .....

position 3951 (CDS: 258 - 4742)

Synonym: dJ1100H13.1; KIAA1219; RalGAPbeta; RP5-1100H13.1
NM_020336.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens transmembrane protein 181 (TMEM181), mRNA. (5397 bp)

..... ttatattcagatttttcttacaagcagagatttcctgttcatttgtttacatatt .....

position 1944 (CDS: 12 - 1850)

Synonym: GPR178; KIAA1423
NM_020823.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ZFP14 zinc finger protein (ZFP14), mRNA. (7502 bp)

..... gatggttgtgagggaagggacaagaagatactgccctgatttggagtccagatac .....

position 338 (CDS: 121 - 1722)

Synonym: ZNF531
NM_020917.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 1, mRNA. (6573 bp)

..... cccaagcacgccttgccccccaagaagaaactgccttcgctcaagcaggtgaact .....

position 541 (CDS: 197 - 3271)

NM_021115.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens centromere protein H (CENPH), mRNA. (1405 bp)

..... gaaaaactgcttgatattagaaagaagagattgcaattaaaacaagcttcagaaa .....

position 561 (CDS: 88 - 831)

NM_022909.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens derlin 1 (DERL1), transcript variant 1, mRNA. (3344 bp)

..... cccaacccccacatttgcaactagaagaggttgcccataaaattgctctgccctt .....

position 1475 (CDS: 302 - 1057)

Synonym: DER-1; DER1
NM_024295.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 1, mRNA. (3685 bp)

..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgcaag .....

position 1472 (CDS: 170 - 3532)

Synonym: FAM42A; HsT19294; RIA1
NM_024580.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 1, mRNA. (4298 bp)

..... tctcatctccacagtatatacaagaagagatgtccttccactaggaaaatttaca .....

position 1435 (CDS: 300 - 2228)

Synonym: C10orf119; MCM-BP
NM_024834.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens L-2-hydroxyglutarate dehydrogenase (L2HGDH), mRNA. (6111 bp)

..... agcttatagtagctgttgaacaagaagaaattcccagacttcaggccctatatga .....

position 506 (CDS: 80 - 1471)

Synonym: C14orf160
NM_024884.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens dedicator of cytokinesis 5 (DOCK5), mRNA. (7555 bp)

..... tcacagcctctgattttttccaagaagagattgccttcaccattgttaaatgtca .....

position 5996 (CDS: 138 - 5750)

NM_024940.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens valosin containing protein (p97)/p47 complex interacting protein 1 (VCPIP1), mRNA. (8176 bp)

..... actcagcccacactgtgaaacaagaagatattgctgttactggtaaactgtcatc .....

position 2870 (CDS: 260 - 3928)

Synonym: DUBA3; VCIP135
NM_025054.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ankyrin repeat domain 36B (ANKRD36B), mRNA. (5986 bp)

..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....

position 3137 (CDS: 281 - 4342)

Synonym: KIAA1641
NM_025190.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens matrilin 2 (MATN2), transcript variant 2, mRNA. (4065 bp)

..... gaaaagccattgaggaggaactacaagagattgcctctgagcccacaaacaagca .....

position 2635 (CDS: 232 - 3045)

NM_030583.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens bromodomain adjacent to zinc finger domain, 1B (BAZ1B), mRNA. (6133 bp)

..... cagctgctgagaaagctttccaggaagggattgccaaggccaaactagtcatgcg .....

position 3014 (CDS: 353 - 4804)

Synonym: WBSCR10; WBSCR9; WSTF
NM_032408.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens multiple EGF-like-domains 10 (MEGF10), transcript variant 1, mRNA. (7689 bp)

..... tgtggagatgaaatcgccggcacgaagagattccccatatgcagagatcaataac .....

position 3526 (CDS: 363 - 3785)

Synonym: EMARDD
NM_032446.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 1, mRNA. (3353 bp)

..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....

position 1118 (CDS: 566 - 2605)

Synonym: MS4A16; NYD-SP21
NM_032597.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger and SCAN domain containing 10 (ZSCAN10), mRNA. (2463 bp)

..... caggtccccagccacagccccaagaaggaattgcctgcggaagagccttcagtgc .....

position 412 (CDS: 89 - 2266)

Synonym: ZNF206
NM_032805.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 2, mRNA. (2718 bp)

..... aaaaagtgcaagaggcaatacaagaaggtattgcctctgcgacaatgtttgatgg .....

position 1250 (CDS: 113 - 1765)

Synonym: AIRP; CN-IB; CN1B
NM_033253.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 2, mRNA. (8865 bp)

..... tggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttct .....

position 778 (CDS: 79 - 2505)

Synonym: HSSOX6; SOXD
NM_033326.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 2, mRNA. (2751 bp)

..... gctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcga .....

position 819 (CDS: 71 - 1066)

Synonym: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
NM_052931.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin light chain kinase (MYLK), transcript variant 1, mRNA. (7852 bp)

..... tttcgctcagtgctgggtggcaagaagaaattaccagcagagaatggcagcagca .....

position 3243 (CDS: 283 - 6027)

Synonym: AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
NM_053025.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin light chain kinase (MYLK), transcript variant 2, mRNA. (7645 bp)

..... tttcgctcagtgctgggtggcaagaagaaattaccagcagagaatggcagcagca .....

position 3036 (CDS: 283 - 5820)

Synonym: AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
NM_053026.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin light chain kinase (MYLK), transcript variant 3A, mRNA. (7699 bp)

..... tttcgctcagtgctgggtggcaagaagaaattaccagcagagaatggcagcagca .....

position 3243 (CDS: 283 - 5874)

Synonym: AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
NM_053027.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin light chain kinase (MYLK), transcript variant 3B, mRNA. (7492 bp)

..... tttcgctcagtgctgggtggcaagaagaaattaccagcagagaatggcagcagca .....

position 3036 (CDS: 283 - 5667)

Synonym: AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
NM_053028.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens cytochrome c oxidase assembly homolog 15 (yeast) (COX15), transcript variant 1, mRNA. (7689 bp)

..... ggctgggcttatgctattgcctagaagagattcccaacttctctcttatttgaat .....

position 4705 (CDS: 618 - 1850)

Synonym: CEMCOX2
NM_078470.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant II, mRNA. (3136 bp)

..... tccacccccacagcagacctcaagtagaaattgcccaatttttaccagctggagg .....

position 2811 (CDS: 286 - 1623)

Synonym: EAD
NM_080538.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant III, mRNA. (2905 bp)

..... tccacccccacagcagacctcaagtagaaattgcccaatttttaccagctggagg .....

position 2580 (CDS: 127 - 1392)

Synonym: EAD
NM_080539.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 2, mRNA. (8266 bp)

..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....

position 4954 (CDS: 104 - 4621)

Synonym: HPTP; HPTPD; HPTPDELTA; PTPD; RPTPDELTA
NM_130391.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 3, mRNA. (8269 bp)

..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....

position 4957 (CDS: 104 - 4624)

Synonym: HPTP; HPTPD; HPTPDELTA; PTPD; RPTPDELTA
NM_130392.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 4, mRNA. (8239 bp)

..... tcaggattgcttgaaaggtgcaaggagaaattgccagaatgctgcagttcagcac .....

position 4927 (CDS: 104 - 4594)

Synonym: HPTP; HPTPD; HPTPDELTA; PTPD; RPTPDELTA
NM_130393.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens progestin and adipoQ receptor family member VIII (PAQR8), mRNA. (4758 bp)

..... atgatgagcacaggaacaggcatgaagatattgccatacaattttaatttataca .....

position 3457 (CDS: 175 - 1239)

Synonym: C6orf33; LMPB1; MPRB
NM_133367.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens titin (TTN), transcript variant N2-A, mRNA. (101520 bp)

..... aagtgcctaaagaacttgaaccagaagaggttgcctttgaagaggaagttgtaac .....

position 29938 (CDS: 226 - 100497)

Synonym: CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J; MYLK5; TMD
NM_133378.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 2, mRNA. (1327 bp)

..... ttgatcccagctggactgctcaagaagaaatggcccttttagaagctgtgatgga .....

position 601 (CDS: 370 - 1287)

Synonym: ADA2; ADA2A; hADA2; KL04P; TADA2L
NM_133439.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant B, mRNA. (9794 bp)

..... cgttcaggtgcttggaccttcaggaaaagattgcccatcttgtcatttgaccagg .....

position 8381 (CDS: 252 - 1277)

Synonym: CREB
NM_134442.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glutamate receptor, ionotropic, N-methyl-D-aspartate 3B (GRIN3B), mRNA. (3270 bp)

..... agcagcgccgaggcgtacatcaagaagagcttccccgacatgcacgcacacatgc .....

position 2118 (CDS: 1 - 3132)

Synonym: GluN3B; NR3B
NM_138690.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens polycystic kidney and hepatic disease 1 (autosomal recessive) (PKHD1), transcript variant 1, mRNA. (16235 bp)

..... gcaggaatgtggagagcttccaaaaagagattgctctcagattttcctgaaaatc .....

position 13652 (CDS: 277 - 12501)

Synonym: ARPKD; FCYT; TIGM1
NM_138694.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 1, mRNA. (8691 bp)

..... cctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatgga .....

position 536 (CDS: 272 - 1846)

Synonym: KITENIN; LPP2; STB2; STBM2
NM_138959.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger protein 480 (ZNF480), mRNA. (4742 bp)

..... ataaccccccaagattgaaccaagaagaaattgcatccctgaacagaccaataat .....

position 2072 (CDS: 71 - 1678)

NM_144684.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens EF-hand domain family, member B (EFHB), mRNA. (2857 bp)

..... acttcttcaagaccagatcaaaagaagagattgcagagatattgtgtaacattgg .....

position 2516 (CDS: 197 - 2698)

NM_144715.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger, C3H1-type containing (ZFC3H1), mRNA. (7158 bp)

..... agattgaatatagattgttaaaggaagagattgccaaccgtgagaaacagcgttt .....

position 2703 (CDS: 360 - 6329)

Synonym: CCDC131; PSRC2
NM_144982.4 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens leucine rich repeat containing 45 (LRRC45), mRNA. (2639 bp)

..... tggagactattgataagcagcgagaagagatggccaagagcagcagggcgtcggc .....

position 1048 (CDS: 241 - 2253)

NM_144999.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens fucokinase (FUK), mRNA. (3923 bp)

..... tgaccagagcaagatctgggcaagcagagagtgcctgggacaggactgtgacctg .....

position 3457 (CDS: 59 - 3313)

Synonym: 1110046B12Rik
NM_145059.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 2, mRNA. (1569 bp)

..... tcatcaagtgcactagcaacccagcagagattgccatgttccttgaaccactgga .....

position 424 (CDS: 223 - 861)

Synonym: DEN1; NEDP1; PRSC2
NM_145204.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens stomatin (EPB72)-like 3 (STOML3), transcript variant 1, mRNA. (1936 bp)

..... tgtcccagatcttagctggacgagaagagatcgcccatagcatccagactttact .....

position 628 (CDS: 139 - 1014)

Synonym: Epb7.2l; SRO
NM_145286.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens intersectin 2 (ITSN2), transcript variant 2, mRNA. (4597 bp)

..... tcaatcaaaagaatagagaacaagaagaaattgtcaggttaaactctaaaaagaa .....

position 1690 (CDS: 259 - 4008)

Synonym: PRO2015; SH3D1B; SH3P18; SWA; SWAP
NM_147152.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens leucine rich repeat and fibronectin type III domain containing 5 (LRFN5), mRNA. (3747 bp)

..... tgtccaaacaagctgtgggacacgaagagaatgcccagtgttgtaaagctaccag .....

position 2984 (CDS: 1199 - 3358)

Synonym: C14orf146; FIGLER8; SALM5
NM_152447.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens pseudouridylate synthase-like 1 (PUSL1), mRNA. (1262 bp)

..... caggacacagccatgtacaccaagaagagagtaccaagtagtcttttgttcagct .....

position 1142 (CDS: 31 - 942)

NM_153339.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens lysophosphatidylcholine acyltransferase 4 (LPCAT4), mRNA. (1908 bp)

..... gccggagtcgaatgatcagccaggaagagtttgccaggcagctacagctctctga .....

position 1163 (CDS: 95 - 1669)

Synonym: AGPAT7; AYTL3; LPAAT-eta; LPEAT2
NM_153613.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 1, mRNA. (9757 bp)

..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgctt .....

position 2966 (CDS: 24 - 1892)

Synonym: NCKX4; SHEP6; SLC24A2
NM_153646.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 2, mRNA. (9773 bp)

..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgctt .....

position 2982 (CDS: 97 - 1908)

Synonym: NCKX4; SHEP6; SLC24A2
NM_153647.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 3, mRNA. (9659 bp)

..... tcagaagtgctggttaatgacgagaagagattgcctgaaaaacaacaaactgctt .....

position 2868 (CDS: 118 - 1794)

Synonym: NCKX4; SHEP6; SLC24A2
NM_153648.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens l(3)mbt-like 4 (Drosophila) (L3MBTL4), mRNA. (3604 bp)

..... ggcattcccaggaactccctgaagaagatattgcctcaggccaagaagtcagggg .....

position 2035 (CDS: 202 - 2073)

Synonym: HsT1031
NM_173464.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens POTE ankyrin domain family, member D (POTED), mRNA. (1826 bp)

..... tgcgtgaaaacagcgtgttgcaggaagaaattgccatgctaagactggaactaga .....

position 1640 (CDS: 53 - 1807)

Synonym: A26B3; ANKRD21; CT104.1; POTE; POTE-21; POTE21
NM_174981.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2), mRNA. (2858 bp)

..... accagggggagagaccagaccaagaagagaatggccaagcccaaaaaccgggctg .....

position 641 (CDS: 540 - 2438)

Synonym: ALEX2
NM_177949.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 1, mRNA. (6998 bp)

..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggctttga .....

position 704 (CDS: 155 - 5209)

Synonym: GCC185; RANBP2L4; REN53
NM_181453.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens zinc finger protein 445 (ZNF445), mRNA. (10264 bp)

..... tatttaagtagctaaaaaggcaagaagaaaatgccaaggtgtcttggaggtagca .....

position 9884 (CDS: 349 - 3444)

Synonym: ZKSCAN15; ZNF168; ZSCAN47
NM_181489.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 2, mRNA. (3251 bp)

..... gtgtgtctgtgagtgtgtttccagaagagattggcaagtgagtcagtgggaaatt .....

position 2743 (CDS: 112 - 1335)

Synonym: BT2.2; BTF2
NM_181531.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 2, mRNA. (2343 bp)

..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgcag .....

position 1109 (CDS: 216 - 1865)

Synonym: MSK1; MSPK1; RLPK
NM_182398.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens mitochondrial ribosomal protein S9 (MRPS9), mRNA. (1473 bp)

..... aagatccagaaactttcactcaagaagatattgacagagctattgcttacctttt .....

position 369 (CDS: 69 - 1259)

Synonym: MRP-S9; RPMS9; S9mt
NM_182640.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 2, mRNA. (1597 bp)

..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....

position 1012 (CDS: 277 - 1371)

Synonym: ALDA; GSD12
NM_184041.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 3, mRNA. (1569 bp)

..... cttgcactcagaagttttctcatgaggagattgccatggcgaccgtcacagcgct .....

position 984 (CDS: 249 - 1343)

Synonym: ALDA; GSD12
NM_184043.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens cAMP responsive element binding protein 3-like 2 (CREB3L2), transcript variant 1, mRNA. (7471 bp)

..... cttgtttccaccaatagtgccaaaaagatattgcctaatgtgcacctgtgaggtg .....

position 2258 (CDS: 397 - 1959)

Synonym: BBF2H7
NM_194071.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 2, mRNA. (4030 bp)

..... cgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagt .....

position 1497 (CDS: 36 - 3170)

NM_194300.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 1, mRNA. (3395 bp)

..... ctccgagaaactagggctgacaagaagagactgcggaaagccttaagagaatttg .....

position 1706 (CDS: 135 - 1892)

Synonym: FAM13C1
NM_198215.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens polymerase (DNA directed), theta (POLQ), mRNA. (8787 bp)

..... tgtggcttgccctgatcggccgagaagagtttgccatgaatcttctgcgtcggag .....

position 115 (CDS: 130 - 7902)

Synonym: POLH; PRO0327
NM_199420.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens myosin phosphatase Rho interacting protein (MPRIP), transcript variant 2, mRNA. (11023 bp)

..... tcaacattaacttttcctgaaaagaagagtttgcctaacatggtcctaaagaagc .....

position 7464 (CDS: 90 - 3167)

Synonym: M-RIP; MRIP; p116Rip; RHOIP3; RIP3
NM_201274.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glycerol kinase (GK), transcript variant 1, mRNA. (4503 bp)

..... tttgttttgtagtaaacagtgaagaaaagattgcctcctaattatttttttcaat .....

position 3217 (CDS: 180 - 1772)

Synonym: GK1; GKD
NM_203391.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens aldo-keto reductase family 1, member C2 (AKR1C2), transcript variant 2, mRNA. (3521 bp)

..... aacttgactgatgtaagtgtcaagaaaagattgacattttgttaaaacttcgtag .....

position 3061 (CDS: 314 - 1285)

Synonym: AKR1C-pseudo; BABP; DD; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8
NM_205845.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens CPS1 intronic transcript 1 (non-protein coding) (CPS1-IT1), non-coding RNA. (2306 bp)

..... tagcggtattagataaataacaagaatagatggccactaaagctacctgtctcca .....

position 1039

Synonym: CPS1-IT; CPS1IT; CPS1IT1; PRO0132
NR_002763.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens centrosomal protein 170kDa pseudogene 1 (CEP170P1), non-coding RNA. (1091 bp)

..... tccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgc .....

position 157

Synonym: CEP170L; FAM68B; KIAA0470L
NR_003135.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 144C, pseudogene (CCDC144CP), non-coding RNA. (4204 bp)

..... ttcatgaaaattgcatgttgcaggaagaaattgccttgctgagactggaaataga .....

position 2620

Synonym: CCDC144C
NR_023380.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens long intergenic non-protein coding RNA 51 (LINC00051), non-coding RNA. (1058 bp)

..... ataggaggcctgaagaaccacatgaagagagtgcccacaacccagaggatctcct .....

position 476

Synonym: C8orf43; NCRNA00051
NR_024378.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens actin, gamma 1 pseudogene 4 (ACTG1P4), non-coding RNA. (1988 bp)

..... ctcctccaccagtcgcaatggaagaagagattgccgtactggtgattgacaatgg .....

position 153

Synonym: ACTGP4
NR_024438.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens MRPL23 antisense RNA 1 (MRPL23-AS1), non-coding RNA. (1904 bp)

..... gcggaggctgttttttgctccaagaggacattgcctcagcagagggctgccgagc .....

position 1257

NR_024471.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens chromosome 14 open reading frame 23 (C14orf23), transcript variant 1, non-coding RNA. (3154 bp)

..... gaaatttgaaataaagaacacaaaatgagattgccctttggttgttaaaattgca .....

position 1575

Synonym: c14_5148
NR_026731.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ankyrin repeat domain 36B pseudogene 1 (ANKRD36BP1), non-coding RNA. (1879 bp)

..... tgcataaaaaccatttgatgcaagatgaaattgccaggctcaggctggaaataca .....

position 467

Synonym: ANKRD26L1; ANKRD36BL1
NR_026844.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens POTE ankyrin domain family, member F pseudogene (LOC100130331), non-coding RNA. (3148 bp)

..... ctcctccaccagtcacgatggaagaagagatcgccacgcttgccattgacaatgg .....

position 1640

NR_027247.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 3, non-coding RNA. (3643 bp)

..... aaatagcacctgtctatcagcaagaggagattgcagaaggggctgtgacaatttt .....

position 1272

Synonym: GLUR8; GPRC1H; mGlu8; MGLUR8
NR_028041.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 2, non-coding RNA. (6913 bp)

..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggctttga .....

position 619

Synonym: GCC185; RANBP2L4; REN53
NR_028063.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 3, non-coding RNA. (1925 bp)

..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatactaga .....

position 700

Synonym: hnRNP-G; HNRNPG; HNRPG; RBMXP1; RBMXRT; RNMX
NR_028476.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 4, non-coding RNA. (2132 bp)

..... ttctactaaagacagctattcaagcagagattacccaagttctcgtgatactaga .....

position 907

Synonym: hnRNP-G; HNRNPG; HNRPG; RBMXP1; RBMXRT; RNMX
NR_028477.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens poly (ADP-ribose) glycohydrolase pseudogene (LOC728407), non-coding RNA. (1420 bp)

..... atcattccatcacaatgtcgcaggaacagattgccagtcttttagctaatgcttt .....

position 756

NR_029388.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens ankyrin repeat domain 26 pseudogene (LOC650226), non-coding RNA. (1667 bp)

..... tgcataaaaatagtatgttgcaggaagaaattgccatgctaagactggaactaga .....

position 788

NR_029420.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 3, non-coding RNA. (3608 bp)

..... gcccctgatgcttcggggccccagaagagatcgccaggagacactgccaaagatg .....

position 177

Synonym: D1S2223E; HK33; PBD12A; PMP1; PMPI; PXF; PXMP1
NR_036493.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 144B (pseudogene) (CCDC144B), non-coding RNA. (8713 bp)

..... ttcatgaaaattgcatgttgcaggaagaaattgccttgctgagactggaaataga .....

position 2642

NR_036647.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens elongation factor Tu GTP binding domain containing 1 pseudogene 1 (EFTUD1P1), non-coding RNA. (1167 bp)

..... ataagccaaggcctctcactcaagaagaaattgctcagagacgtgagcgtgcaag .....

position 719

Synonym: FAM42B; HsT19321
NR_036652.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens actin, gamma 1 (ACTG1), transcript variant 3, non-coding RNA. (1855 bp)

..... tttctctgccggtcgcaatggaagaagagatcgccgcgctggtcattgacaatgg .....

position 143

Synonym: ACT; ACTG; BRWS2; DFNA20; DFNA26
NR_037688.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens uncharacterized LOC100506025 (LOC100506025), transcript variant 1, non-coding RNA. (2264 bp)

..... agttctggaagttggaagtacaagatcagattgccagcatcatcaggtactcatg .....

position 137

NR_038946.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens uncharacterized LOC100506025 (LOC100506025), transcript variant 2, non-coding RNA. (2083 bp)

..... cattctggaagttggaagtacaagatcagattgccagcatcatcagatttgatat .....

position 215

NR_038947.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 3, non-coding RNA. (2787 bp)

..... tggtgtgattggacgctgtgcaggatgagattgccaaggaagagcttagaagtag .....

position 299

Synonym: BLOS2; RP11-316M21.4
NR_046314.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 4, non-coding RNA. (4544 bp)

..... cgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagt .....

position 2011

NR_047565.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 5, non-coding RNA. (3522 bp)

..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....

position 1287

Synonym: MS4A16; NYD-SP21
NR_049731.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 6, non-coding RNA. (3474 bp)

..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....

position 1239

Synonym: MS4A16; NYD-SP21
NR_049732.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 7, non-coding RNA. (3423 bp)

..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....

position 1188

Synonym: MS4A16; NYD-SP21
NR_049733.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 8, non-coding RNA. (3573 bp)

..... atcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaa .....

position 1338

Synonym: MS4A16; NYD-SP21
NR_049734.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 3, non-coding RNA. (3494 bp)

..... taagaacaggctcgtatctggaggaagagattgccaggtaaaagtatgggatgta .....

position 2410

Synonym: Fbw10; HREP; SM25H2; SM2SH2
NR_051988.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens SUZ RNA binding domain containing 1 pseudogene (LOC100130075), non-coding RNA. (1058 bp)

..... acagcgcagataaatgcaggcaagaagagatggcgcgactgccgcgtcaacgcgt .....

position 499

NR_073494.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Homo sapiens GATA6 antisense RNA 1 (head to head) (GATA6-AS1), non-coding RNA. (1788 bp)

..... tgcgatcgaatgcgcgactcccagaagagatagccaggcgtccgcccggccgctc .....

position 1005

NR_102763.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

PREDICTED: Homo sapiens ankyrin repeat domain 36C, transcript variant 1 (ANKRD36C), mRNA. (6351 bp)

..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....

position 5146 (CDS: 526 - 6351)

XM_001717763.5 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

PREDICTED: Homo sapiens ankyrin repeat domain 36C, transcript variant 2 (ANKRD36C), mRNA. (4623 bp)

..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....

position 3418 (CDS: 526 - 4623)

XM_003118857.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

PREDICTED: Homo sapiens ankyrin repeat domain 36C (ANKRD36C), mRNA. (6306 bp)

..... tgcatgaaaaccgcttgatgcaagatgaaattgccaggctcaggctggaaaaaga .....

position 5101 (CDS: 1 - 6306)

XM_003119864.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

PREDICTED: Homo sapiens glutamate receptor, ionotropic, N-methyl-D-aspartate 3B (GRIN3B), mRNA. (3547 bp)

..... agcagcgccgaggcgtacatcaagaagagcttccccgacatgcacgcacacatgc .....

position 2403 (CDS: 1 - 3417)

XM_003403700.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

PREDICTED: Homo sapiens ankyrin repeat domain 36C (ANKRD36C), mRNA. (6356 bp)

..... tgcatgaaaaccgcttgatgcaagatgaaattgcctggctcaggctggaaaaaga .....

position 5151 (CDS: 525 - 6356)

XM_003960295.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

PREDICTED: Homo sapiens ankyrin repeat domain 36B (ANKRD36B), mRNA. (4163 bp)

..... tgcatgaaaaccgcttgatgcaagatgaaattgcctggctcaggctggaaaaaga .....

position 3258 (CDS: 561 - 4163)

XM_003960306.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

PREDICTED: Homo sapiens uncharacterized LOC101060595 (LOC101060595), misc_RNA. (595 bp)

..... atgtcccgctctcccctgctcaaggagagagtgcctgacctgagctgggcccatc .....

position 393

XR_171205.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

PREDICTED: Homo sapiens ankyrin repeat domain-containing protein 36A-like (LOC100996862), misc_RNA. (1143 bp)

..... tgcatgaaaaccgcttgatgcaagatgaaattgcctggctcaggctggaaaaaga .....

position 88

XR_172491.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

[GGRNA | 2023-11-29 14:51:39 | RefSeq release 60 (20130726)]
RefSeq ID	Version	Symbol	GeneID	Definition
NM_000034	NM_000034.3	ALDOA	226	Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 1, mRNA.	position 1823 (CDS: 1088 - 2182) 
NM_000119	NM_000119.2	EPB42	2038	Homo sapiens erythrocyte membrane protein band 4.2 (EPB42), transcript variant 1, mRNA.	position 2128 (CDS: 301 - 2466) 
NM_000167	NM_000167.5	GK	2710	Homo sapiens glycerol kinase (GK), transcript variant 2, mRNA.	position 3199 (CDS: 180 - 1754) 
NM_000259	NM_000259.3	MYO5A	4644	Homo sapiens myosin VA (heavy chain 12, myoxin) (MYO5A), transcript variant 1, mRNA.	position 3209 (CDS: 245 - 5812) 
NM_000523	NM_000523.3	HOXD13	3239	Homo sapiens homeobox D13 (HOXD13), mRNA.	position 918 (CDS: 88 - 1119) 
NM_000593	NM_000593.5	TAP1	6890	Homo sapiens transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (TAP1), mRNA.	position 2121 (CDS: 156 - 2582) 
NM_000721	NM_000721.3	CACNA1E	777	Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 3, mRNA.	position 3115 (CDS: 196 - 7008) 
NM_000833	NM_000833.3	GRIN2A	2903	Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 2, mRNA.	position 3467 (CDS: 311 - 4705) 
NM_000845	NM_000845.2	GRM8	2918	Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 1, mRNA.	position 1272 (CDS: 312 - 3038) 
NM_000888	NM_000888.3	ITGB6	3694	Homo sapiens integrin, beta 6 (ITGB6), mRNA.	position 584 (CDS: 17 - 2383) 
NM_001001971	NM_001001971.2	FAM13C	220965	Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 2, mRNA.	position 1412 (CDS: 135 - 1598) 
NM_001002006	NM_001002006.2	NT5C1B	93034	Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 1, mRNA.	position 1430 (CDS: 113 - 1945) 
NM_001002920	NM_001002920.1	POTEA	340441	Homo sapiens POTE ankyrin domain family, member A (POTEA), transcript variant 1, mRNA.	position 1658 (CDS: 44 - 1402) 
NM_001005365	NM_001005365.2	POTEA	340441	Homo sapiens POTE ankyrin domain family, member A (POTEA), transcript variant 2, mRNA.	position 1796 (CDS: 44 - 1540) 
NM_001008224	NM_001008224.1	UACA	55075	Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 2, mRNA.	position 3196 (CDS: 367 - 4578) 
NM_001013659	NM_001013659.2	ZNF793	390927	Homo sapiens zinc finger protein 793 (ZNF793), mRNA.	position 754 (CDS: 443 - 1663) 
NM_001037165	NM_001037165.1	FOXK1	221937	Homo sapiens forkhead box K1 (FOXK1), mRNA.	position 9724 (CDS: 11 - 2212) 
NM_001040610	NM_001040610.2	EFTUD1	79631	Homo sapiens elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 2, mRNA.	position 1319 (CDS: 170 - 3379) 
NM_001040712	NM_001040712.2	PTPRD	5789	Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 5, mRNA.	position 4945 (CDS: 104 - 4612) 
NM_001042404	NM_001042404.1	CEP170	9859	Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant beta, mRNA.	position 4009 (CDS: 409 - 4869) 
NM_001042405	NM_001042405.1	CEP170	9859	Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant gamma, mRNA.	position 3901 (CDS: 409 - 4791) 
NM_001042475	NM_001042475.2	CEP85L	387119	Homo sapiens centrosomal protein 85kDa-like (CEP85L), transcript variant 1, mRNA.	position 2467 (CDS: 589 - 3006) 
NM_001048252	NM_001048252.2	CTXN3	613212	Homo sapiens cortexin 3 (CTXN3), transcript variant 1, mRNA.	position 1194 (CDS: 575 - 820) 
NM_001079692	NM_001079692.2	MS4A14	84689	Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 2, mRNA.	position 1067 (CDS: 566 - 2554) 
NM_001079864	NM_001079864.2	TAX1BP1	8887	Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 2, mRNA.	position 1137 (CDS: 183 - 2426) 
NM_001098500	NM_001098500.1	KIAA1217	56243	Homo sapiens KIAA1217 (KIAA1217), transcript variant 2, mRNA.	position 1438 (CDS: 810 - 4604) 
NM_001098501	NM_001098501.1	KIAA1217	56243	Homo sapiens KIAA1217 (KIAA1217), transcript variant 3, mRNA.	position 1272 (CDS: 404 - 4333) 
NM_001098814	NM_001098814.1	SRL	6345	Homo sapiens sarcalumenin (SRL), mRNA.	position 938 (CDS: 14 - 1435) 
NM_001100117	NM_001100117.2	RIMS2	9699	Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 1, mRNA.	position 4128 (CDS: 140 - 4189) 
NM_001101	NM_001101.3	ACTB	60	Homo sapiens actin, beta (ACTB), mRNA.	position 1273 (CDS: 85 - 1212) 
NM_001105206	NM_001105206.2	LAMA4	3910	Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 1, mRNA.	position 4938 (CDS: 399 - 5870) 
NM_001105207	NM_001105207.2	LAMA4	3910	Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 3, mRNA.	position 4934 (CDS: 416 - 5866) 
NM_001105521	NM_001105521.2	JAKMIP3	282973	Homo sapiens Janus kinase and microtubule interacting protein 3 (JAKMIP3), mRNA.	position 6013 (CDS: 1 - 2535) 
NM_001114134	NM_001114134.1	EPB42	2038	Homo sapiens erythrocyte membrane protein band 4.2 (EPB42), transcript variant 2, mRNA.	position 2038 (CDS: 301 - 2376) 
NM_001127323	NM_001127323.1	GRM8	2918	Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 2, mRNA.	position 1518 (CDS: 558 - 3284) 
NM_001127385	NM_001127385.1	CTXN3	613212	Homo sapiens cortexin 3 (CTXN3), transcript variant 2, mRNA.	position 1003 (CDS: 384 - 629) 
NM_001127617	NM_001127617.2	ALDOA	226	Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 4, mRNA.	position 1045 (CDS: 310 - 1404) 
NM_001128127	NM_001128127.2	GK	2710	Homo sapiens glycerol kinase (GK), transcript variant 3, mRNA.	position 3286 (CDS: 180 - 1841) 
NM_001130845	NM_001130845.1	BCL6	604	Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 2, mRNA.	position 1382 (CDS: 458 - 2578) 
NM_001134407	NM_001134407.1	GRIN2A	2903	Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 1, mRNA.	position 3705 (CDS: 549 - 4943) 
NM_001134408	NM_001134408.1	GRIN2A	2903	Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), transcript variant 3, mRNA.	position 3366 (CDS: 210 - 4055) 
NM_001134671	NM_001134671.2	DERL1	79139	Homo sapiens derlin 1 (DERL1), transcript variant 2, mRNA.	position 1415 (CDS: 302 - 997) 
NM_001134738	NM_001134738.1	BCL6	604	Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 3, mRNA.	position 974 (CDS: 50 - 2002) 
NM_001137671	NM_001137671.1	POTEC	388468	Homo sapiens POTE ankyrin domain family, member C (POTEC), mRNA.	position 2042 (CDS: 455 - 2083) 
NM_001142495	NM_001142495.1	MYO5A	4644	Homo sapiens myosin VA (heavy chain 12, myoxin) (MYO5A), transcript variant 2, mRNA.	position 3209 (CDS: 245 - 5731) 
NM_001143773	NM_001143773.1	FAM13C	220965	Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 3, mRNA.	position 1877 (CDS: 555 - 2063) 
NM_001143995	NM_001143995.1	LPXN	9404	Homo sapiens leupaxin (LPXN), transcript variant 1, mRNA.	position 679 (CDS: 121 - 1296) 
NM_001144033	NM_001144033.1	STOML3	161003	Homo sapiens stomatin (EPB72)-like 3 (STOML3), transcript variant 2, mRNA.	position 712 (CDS: 250 - 1098) 
NM_001144878	NM_001144878.1	IMPA1	3612	Homo sapiens inositol(myo)-1(or 4)-monophosphatase 1 (IMPA1), transcript variant 2, mRNA.	position 779 (CDS: 152 - 1162) 
NM_001145158	NM_001145158.1	HBS1L	10767	Homo sapiens HBS1-like (S. cerevisiae) (HBS1L), transcript variant 2, mRNA.	position 5851 (CDS: 208 - 2136) 
NM_001145811	NM_001145811.1	SOX6	55553	Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 3, mRNA.	position 891 (CDS: 192 - 2597) 
NM_001145819	NM_001145819.1	SOX6	55553	Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 4, mRNA.	position 772 (CDS: 34 - 2559) 
NM_001146094	NM_001146094.1	FAN1	22909	Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 2, mRNA.	position 1597 (CDS: 292 - 1893) 
NM_001146095	NM_001146095.1	FAN1	22909	Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 3, mRNA.	position 1494 (CDS: 189 - 1790) 
NM_001146096	NM_001146096.1	FAN1	22909	Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 4, mRNA.	position 1610 (CDS: 305 - 1906) 
NM_001162536	NM_001162536.2	RBMXL1	494115	Homo sapiens RNA binding motif protein, X-linked-like 1 (RBMXL1), transcript variant 1, mRNA.	position 1378 (CDS: 717 - 1889) 
NM_001164315	NM_001164315.1	ANKRD36	375248	Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.	position 4865 (CDS: 245 - 6070) 
NM_001164380	NM_001164380.1	STAU2	27067	Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 1, mRNA.	position 139 (CDS: 342 - 2054) 
NM_001164381	NM_001164381.1	STAU2	27067	Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 2, mRNA.	position 139 (CDS: 307 - 1923) 
NM_001164382	NM_001164382.1	STAU2	27067	Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 3, mRNA.	position 139 (CDS: 363 - 1877) 
NM_001164407	NM_001164407.1	TLCD2	727910	Homo sapiens TLC domain containing 2 (TLCD2), mRNA.	position 5633 (CDS: 127 - 921) 
NM_001164623	NM_001164623.1	AGO2	27161	Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 2, mRNA.	position 1167 (CDS: 42 - 2519) 
NM_001164803	NM_001164803.1	RBMX	27316	Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 2, mRNA.	position 547 (CDS: 211 - 801) 
NM_001164883	NM_001164883.1	CTNNA2	1496	Homo sapiens catenin (cadherin-associated protein), alpha 2 (CTNNA2), transcript variant 2, mRNA.	position 2041 (CDS: 280 - 2862) 
NM_001166105	NM_001166105.1	TADA2A	6871	Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 3, mRNA.	position 393 (CDS: 162 - 1493) 
NM_001166340	NM_001166340.1	SENP8	123228	Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 1, mRNA.	position 535 (CDS: 334 - 972) 
NM_001166698	NM_001166698.1	FAM13C	220965	Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 4, mRNA.	position 1788 (CDS: 469 - 1974) 
NM_001168479	NM_001168479.1	ARMCX5	64860	Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 1, mRNA.	position 37 (CDS: 888 - 2564) 
NM_001168480	NM_001168480.1	ARMCX5	64860	Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 4, mRNA.	position 37 (CDS: 882 - 2558) 
NM_001168485	NM_001168485.1	ARMCX5	64860	Homo sapiens armadillo repeat containing, X-linked 5 (ARMCX5), transcript variant 5, mRNA.	position 37 (CDS: 769 - 2445) 
NM_001171025	NM_001171025.1	PTPRD	5789	Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 6, mRNA.	position 4954 (CDS: 104 - 4621) 
NM_001172109	NM_001172109.1	SENP8	123228	Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 3, mRNA.	position 689 (CDS: 488 - 1126) 
NM_001172110	NM_001172110.1	SENP8	123228	Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 4, mRNA.	position 531 (CDS: 330 - 968) 
NM_001172111	NM_001172111.1	SENP8	123228	Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 5, mRNA.	position 548 (CDS: 347 - 985) 
NM_001172411	NM_001172411.1	VANGL1	81839	Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 3, mRNA.	position 530 (CDS: 272 - 1840) 
NM_001172412	NM_001172412.1	VANGL1	81839	Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 2, mRNA.	position 480 (CDS: 216 - 1790) 
NM_001178035	NM_001178035.1	CEP85L	387119	Homo sapiens centrosomal protein 85kDa-like (CEP85L), transcript variant 3, mRNA.	position 1955 (CDS: 68 - 2494) 
NM_001184714	NM_001184714.1	SLAMF6	114836	Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 1, mRNA.	position 819 (CDS: 71 - 1069) 
NM_001184715	NM_001184715.1	SLAMF6	114836	Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 3, mRNA.	position 672 (CDS: 71 - 919) 
NM_001184716	NM_001184716.1	SLAMF6	114836	Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 4, mRNA.	position 486 (CDS: 71 - 736) 
NM_001184773	NM_001184773.1	SEZ6L	23544	Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 2, mRNA.	position 541 (CDS: 197 - 3268) 
NM_001184774	NM_001184774.1	SEZ6L	23544	Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 3, mRNA.	position 541 (CDS: 197 - 3238) 
NM_001184775	NM_001184775.1	SEZ6L	23544	Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 4, mRNA.	position 541 (CDS: 197 - 3232) 
NM_001184776	NM_001184776.1	SEZ6L	23544	Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 5, mRNA.	position 541 (CDS: 197 - 3046) 
NM_001184777	NM_001184777.1	SEZ6L	23544	Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 6, mRNA.	position 541 (CDS: 197 - 3043) 
NM_001193644	NM_001193644.1	PEX19	5824	Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 4, mRNA.	position 177 (CDS: 28 - 867) 
NM_001195432	NM_001195432.1	MLF1	4291	Homo sapiens myeloid leukemia factor 1 (MLF1), transcript variant 4, mRNA.	position 197 (CDS: 364 - 1263) 
NM_001197237	NM_001197237.1	BTN2A2	10385	Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 3, mRNA.	position 3113 (CDS: 134 - 1705) 
NM_001197238	NM_001197238.1	BTN2A2	10385	Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 4, mRNA.	position 1291 (CDS: 235 - 1245) 
NM_001197239	NM_001197239.1	BTN2A2	10385	Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 5, mRNA.	position 2461 (CDS: 112 - 1053) 
NM_001197240	NM_001197240.1	BTN2A2	10385	Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 6, mRNA.	position 2962 (CDS: 112 - 882) 
NM_001197294	NM_001197294.1	DPYSL3	1809	Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 1, mRNA.	position 2284 (CDS: 199 - 2253) 
NM_001198801	NM_001198801.1	EIF4G3	8672	Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 1, mRNA.	position 5197 (CDS: 623 - 5488) 
NM_001198802	NM_001198802.1	EIF4G3	8672	Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 2, mRNA.	position 5107 (CDS: 623 - 5398) 
NM_001199086	NM_001199086.1	NT5C1B	93034	Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 3, mRNA.	position 1379 (CDS: 113 - 1894) 
NM_001199087	NM_001199087.1	NT5C1B	93034	Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 4, mRNA.	position 1481 (CDS: 113 - 1996) 
NM_001199088	NM_001199088.1	NT5C1B	93034	Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 5, mRNA.	position 1436 (CDS: 113 - 1951) 
NM_001199103	NM_001199103.1	NT5C1B-RDH14	100526794	Homo sapiens NT5C1B-RDH14 readthrough (NT5C1B-RDH14), transcript variant 1, mRNA.	position 1256 (CDS: 113 - 2065) 
NM_001199104	NM_001199104.1	NT5C1B-RDH14	100526794	Homo sapiens NT5C1B-RDH14 readthrough (NT5C1B-RDH14), transcript variant 2, mRNA.	position 1430 (CDS: 113 - 1921) 
NM_001199954	NM_001199954.1	ACTG1	71	Homo sapiens actin, gamma 1 (ACTG1), transcript variant 1, mRNA.	position 262 (CDS: 259 - 1386) 
NM_001205019	NM_001205019.1	GK	2710	Homo sapiens glycerol kinase (GK), transcript variant 4, mRNA.	position 3304 (CDS: 180 - 1859) 
NM_001205293	NM_001205293.1	CACNA1E	777	Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 1, mRNA.	position 3115 (CDS: 196 - 7137) 
NM_001205294	NM_001205294.1	CACNA1E	777	Homo sapiens calcium channel, voltage-dependent, R type, alpha 1E subunit (CACNA1E), transcript variant 2, mRNA.	position 3058 (CDS: 196 - 6951) 
NM_001206651	NM_001206651.1	SH3GLB1	51100	Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 2, mRNA.	position 1030 (CDS: 331 - 1515) 
NM_001206652	NM_001206652.1	SH3GLB1	51100	Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 3, mRNA.	position 1006 (CDS: 331 - 1491) 
NM_001206653	NM_001206653.1	SH3GLB1	51100	Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 4, mRNA.	position 801 (CDS: 489 - 1286) 
NM_001206901	NM_001206901.1	TAX1BP1	8887	Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 3, mRNA.	position 1140 (CDS: 186 - 2429) 
NM_001206902	NM_001206902.1	TAX1BP1	8887	Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 4, mRNA.	position 949 (CDS: 466 - 2238) 
NM_001242767	NM_001242767.1	MTHFD1L	25902	Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 1, mRNA.	position 967 (CDS: 145 - 3084) 
NM_001242768	NM_001242768.1	MTHFD1L	25902	Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 3, mRNA.	position 651 (CDS: 27 - 2768) 
NM_001243177	NM_001243177.1	ALDOA	226	Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 6, mRNA.	position 1166 (CDS: 269 - 1525) 
NM_001243342	NM_001243342.1	CCDC40	55036	Homo sapiens coiled-coil domain containing 40 (CCDC40), transcript variant 2, mRNA.	position 1391 (CDS: 32 - 3124) 
NM_001253790	NM_001253790.1	SMIM22	440335	Homo sapiens small integral membrane protein 22 (SMIM22), transcript variant 1, mRNA.	position 270 (CDS: 521 - 772) 
NM_001253912	NM_001253912.1	TBC1D1	23216	Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 2, mRNA.	position 5313 (CDS: 359 - 3838) 
NM_001253913	NM_001253913.1	TBC1D1	23216	Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 3, mRNA.	position 2979 (CDS: 707 - 1504) 
NM_001253914	NM_001253914.1	TBC1D1	23216	Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 4, mRNA.	position 2625 (CDS: 353 - 1150) 
NM_001253915	NM_001253915.1	TBC1D1	23216	Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 5, mRNA.	position 2175 (CDS: 158 - 700) 
NM_001256378	NM_001256378.1	MCMBP	79892	Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 2, mRNA.	position 1429 (CDS: 300 - 2222) 
NM_001256379	NM_001256379.1	MCMBP	79892	Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 3, mRNA.	position 1239 (CDS: 629 - 2032) 
NM_001256545	NM_001256545.1	MEGF10	84466	Homo sapiens multiple EGF-like-domains 10 (MEGF10), transcript variant 2, mRNA.	position 3475 (CDS: 312 - 3734) 
NM_001256850	NM_001256850.1	TTN	7273	Homo sapiens titin (TTN), transcript variant N2BA, mRNA.	position 32719 (CDS: 226 - 103278) 
NM_001257362	NM_001257362.1	LOC100288966	100288966	Homo sapiens POTE ankyrin domain family member D-like (LOC100288966), mRNA.	position 1640 (CDS: 53 - 1807) 
NM_001257967	NM_001257967.1	CCDC129	223075	Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 1, mRNA.	position 1609 (CDS: 118 - 3282) 
NM_001257968	NM_001257968.1	CCDC129	223075	Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 3, mRNA.	position 1634 (CDS: 95 - 3283) 
NM_001257998	NM_001257998.1	CCDC132	55610	Homo sapiens coiled-coil domain containing 132 (CCDC132), transcript variant 3, mRNA.	position 1801 (CDS: 247 - 3051) 
NM_001261406	NM_001261406.1	MPDZ	8777	Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 2, mRNA.	position 5476 (CDS: 223 - 6336) 
NM_001261407	NM_001261407.1	MPDZ	8777	Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 3, mRNA.	position 5476 (CDS: 223 - 6249) 
NM_001261827	NM_001261827.1	MS4A14	84689	Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 3, mRNA.	position 1166 (CDS: 566 - 2653) 
NM_001261828	NM_001261828.1	MS4A14	84689	Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 4, mRNA.	position 1217 (CDS: 566 - 2704) 
NM_001267550	NM_001267550.1	TTN	7273	Homo sapiens titin (TTN), transcript variant IC, mRNA.	position 33670 (CDS: 226 - 108201) 
NM_001267585	NM_001267585.1	FBXW10	10517	Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 1, mRNA.	position 1764 (CDS: 233 - 3391) 
NM_001267586	NM_001267586.1	FBXW10	10517	Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 2, mRNA.	position 1764 (CDS: 233 - 3232) 
NM_001270383	NM_001270383.1	ENKUR	219670	Homo sapiens enkurin, TRPC channel interacting protein (ENKUR), transcript variant 2, mRNA.	position 59 (CDS: 320 - 904) 
NM_001271696	NM_001271696.1	ABCB7	22	Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 2, mRNA.	position 2277 (CDS: 69 - 2327) 
NM_001271697	NM_001271697.1	ABCB7	22	Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 3, mRNA.	position 2157 (CDS: 69 - 2207) 
NM_001271698	NM_001271698.1	ABCB7	22	Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 4, mRNA.	position 2199 (CDS: 69 - 2249) 
NM_001271699	NM_001271699.1	ABCB7	22	Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 5, mRNA.	position 2160 (CDS: 69 - 2210) 
NM_001276320	NM_001276320.1	YOD1	55432	Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 2, mRNA.	position 5353 (CDS: 206 - 1120) 
NM_001278469	NM_001278469.1	MON2	23041	Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 2, mRNA.	position 475 (CDS: 392 - 5419) 
NM_001278470	NM_001278470.1	MON2	23041	Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 3, mRNA.	position 475 (CDS: 392 - 5527) 
NM_001278471	NM_001278471.1	MON2	23041	Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 4, mRNA.	position 475 (CDS: 392 - 5458) 
NM_001278472	NM_001278472.1	MON2	23041	Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 5, mRNA.	position 475 (CDS: 686 - 5623) 
NM_001354	NM_001354.5	AKR1C2	1646	Homo sapiens aldo-keto reductase family 1, member C2 (AKR1C2), transcript variant 1, mRNA.	position 3161 (CDS: 414 - 1385) 
NM_001387	NM_001387.2	DPYSL3	1809	Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 2, mRNA.	position 1854 (CDS: 111 - 1823) 
NM_001429	NM_001429.3	EP300	2033	Homo sapiens E1A binding protein p300 (EP300), mRNA.	position 336 (CDS: 396 - 7640) 
NM_001488	NM_001488.3	TADA2A	6871	Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 1, mRNA.	position 601 (CDS: 370 - 1701) 
NM_001614	NM_001614.3	ACTG1	71	Homo sapiens actin, gamma 1 (ACTG1), transcript variant 2, mRNA.	position 143 (CDS: 140 - 1267) 
NM_001706	NM_001706.4	BCL6	604	Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 1, mRNA.	position 1290 (CDS: 366 - 2486) 
NM_001870	NM_001870.2	CPA3	1359	Homo sapiens carboxypeptidase A3 (mast cell) (CPA3), mRNA.	position 341 (CDS: 53 - 1306) 
NM_002139	NM_002139.3	RBMX	27316	Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 1, mRNA.	position 872 (CDS: 211 - 1386) 
NM_002223	NM_002223.2	ITPR2	3709	Homo sapiens inositol 1,4,5-trisphosphate receptor, type 2 (ITPR2), mRNA.	position 819 (CDS: 418 - 8523) 
NM_002254	NM_002254.6	KIF3C	3797	Homo sapiens kinesin family member 3C (KIF3C), mRNA.	position 1807 (CDS: 658 - 3039) 
NM_002290	NM_002290.4	LAMA4	3910	Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 2, mRNA.	position 4917 (CDS: 399 - 5849) 
NM_002374	NM_002374.3	MAP2	4133	Homo sapiens microtubule-associated protein 2 (MAP2), transcript variant 1, mRNA.	position 3732 (CDS: 249 - 5732) 
NM_002380	NM_002380.3	MATN2	4147	Homo sapiens matrilin 2 (MATN2), transcript variant 1, mRNA.	position 2635 (CDS: 232 - 3102) 
NM_002623	NM_002623.3	PFDN4	5203	Homo sapiens prefoldin subunit 4 (PFDN4), mRNA.	position 421 (CDS: 139 - 543) 
NM_002689	NM_002689.2	POLA2	23649	Homo sapiens polymerase (DNA directed), alpha 2, accessory subunit (POLA2), mRNA.	position 1885 (CDS: 343 - 2139) 
NM_002839	NM_002839.3	PTPRD	5789	Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 1, mRNA.	position 6815 (CDS: 744 - 6482) 
NM_002857	NM_002857.3	PEX19	5824	Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 1, mRNA.	position 177 (CDS: 28 - 927) 
NM_002911	NM_002911.3	UPF1	5976	Homo sapiens UPF1 regulator of nonsense transcripts homolog (yeast) (UPF1), mRNA.	position 2535 (CDS: 276 - 3632) 
NM_003126	NM_003126.2	SPTA1	6708	Homo sapiens spectrin, alpha, erythrocytic 1 (elliptocytosis 2) (SPTA1), mRNA.	position 4601 (CDS: 200 - 7459) 
NM_003292	NM_003292.2	TPR	7175	Homo sapiens translocated promoter region, nuclear basket protein (TPR), mRNA.	position 1411 2989 (CDS: 298 - 7389) 
NM_003380	NM_003380.3	VIM	7431	Homo sapiens vimentin (VIM), mRNA.	position 1095 (CDS: 414 - 1814) 
NM_003631	NM_003631.2	PARG	8505	Homo sapiens poly (ADP-ribose) glycohydrolase (PARG), mRNA.	position 2140 (CDS: 262 - 3192) 
NM_003760	NM_003760.4	EIF4G3	8672	Homo sapiens eukaryotic translation initiation factor 4 gamma, 3 (EIF4G3), transcript variant 3, mRNA.	position 4723 (CDS: 257 - 5014) 
NM_003802	NM_003802.2	MYH13	8735	Homo sapiens myosin, heavy chain 13, skeletal muscle (MYH13), mRNA.	position 4618 (CDS: 91 - 5907) 
NM_003818	NM_003818.3	CDS2	8760	Homo sapiens CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 (CDS2), mRNA.	position 7839 (CDS: 333 - 1670) 
NM_003829	NM_003829.4	MPDZ	8777	Homo sapiens multiple PDZ domain protein (MPDZ), transcript variant 1, mRNA.	position 5575 (CDS: 223 - 6348) 
NM_003945	NM_003945.3	ATP6V0E1	8992	Homo sapiens ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 (ATP6V0E1), mRNA.	position 388 (CDS: 102 - 347) 
NM_004134	NM_004134.6	HSPA9	3313	Homo sapiens heat shock 70kDa protein 9 (mortalin) (HSPA9), mRNA.	position 2145 (CDS: 312 - 2351) 
NM_004299	NM_004299.4	ABCB7	22	Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), transcript variant 1, mRNA.	position 2280 (CDS: 69 - 2330) 
NM_004376	NM_004376.5	COX15	1355	Homo sapiens cytochrome c oxidase assembly homolog 15 (yeast) (COX15), transcript variant 2, mRNA.	position 3466 (CDS: 618 - 1784) 
NM_004379	NM_004379.3	CREB1	1385	Homo sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant A, mRNA.	position 8339 (CDS: 252 - 1235) 
NM_004389	NM_004389.3	CTNNA2	1496	Homo sapiens catenin (cadherin-associated protein), alpha 2 (CTNNA2), transcript variant 1, mRNA.	position 2041 (CDS: 280 - 2997) 
NM_004755	NM_004755.2	RPS6KA5	9252	Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 1, mRNA.	position 1109 (CDS: 216 - 2624) 
NM_004798	NM_004798.3	KIF3B	9371	Homo sapiens kinesin family member 3B (KIF3B), mRNA.	position 1255 (CDS: 181 - 2424) 
NM_004811	NM_004811.2	LPXN	9404	Homo sapiens leupaxin (LPXN), transcript variant 2, mRNA.	position 689 (CDS: 146 - 1306) 
NM_005165	NM_005165.2	ALDOC	230	Homo sapiens aldolase C, fructose-bisphosphate (ALDOC), mRNA.	position 881 (CDS: 146 - 1240) 
NM_005358	NM_005358.5	LMO7	4008	Homo sapiens LIM domain 7 (LMO7), transcript variant 1, mRNA.	position 1735 (CDS: 1261 - 5310) 
NM_005401	NM_005401.4	PTPN14	5784	Homo sapiens protein tyrosine phosphatase, non-receptor type 14 (PTPN14), mRNA.	position 1473 (CDS: 654 - 4217) 
NM_005536	NM_005536.3	IMPA1	3612	Homo sapiens inositol(myo)-1(or 4)-monophosphatase 1 (IMPA1), transcript variant 1, mRNA.	position 578 (CDS: 128 - 961) 
NM_005577	NM_005577.2	LPA	4018	Homo sapiens lipoprotein, Lp(a) (LPA), mRNA.	position 5824 (CDS: 121 - 6243) 
NM_005674	NM_005674.2	ZNF239	8187	Homo sapiens zinc finger protein 239 (ZNF239), transcript variant 1, mRNA.	position 169 (CDS: 654 - 2030) 
NM_005677	NM_005677.3	COLQ	8292	Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant I, mRNA.	position 2682 (CDS: 127 - 1494) 
NM_005687	NM_005687.3	FARSB	10056	Homo sapiens phenylalanyl-tRNA synthetase, beta subunit (FARSB), mRNA.	position 1293 (CDS: 36 - 1805) 
NM_006024	NM_006024.6	TAX1BP1	8887	Homo sapiens Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), transcript variant 1, mRNA.	position 1137 (CDS: 183 - 2552) 
NM_006219	NM_006219.2	PIK3CB	5291	Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta (PIK3CB), transcript variant 1, mRNA.	position 899 (CDS: 17 - 3229) 
NM_006244	NM_006244.3	PPP2R5B	5526	Homo sapiens protein phosphatase 2, regulatory subunit B', beta (PPP2R5B), mRNA.	position 2643 (CDS: 623 - 2116) 
NM_006277	NM_006277.2	ITSN2	50618	Homo sapiens intersectin 2 (ITSN2), transcript variant 1, mRNA.	position 1690 (CDS: 259 - 5352) 
NM_006382	NM_006382.3	CDRT1	374286	Homo sapiens CMT1A duplicated region transcript 1 (CDRT1), mRNA.	position 1724 (CDS: 193 - 2451) 
NM_006581	NM_006581.3	FUT9	10690	Homo sapiens fucosyltransferase 9 (alpha (1,3) fucosyltransferase) (FUT9), mRNA.	position 9453 (CDS: 342 - 1421) 
NM_006620	NM_006620.3	HBS1L	10767	Homo sapiens HBS1-like (S. cerevisiae) (HBS1L), transcript variant 1, mRNA.	position 5977 (CDS: 208 - 2262) 
NM_006734	NM_006734.3	HIVEP2	3097	Homo sapiens human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2), mRNA.	position 4686 (CDS: 744 - 8084) 
NM_006901	NM_006901.3	MYO9A	4649	Homo sapiens myosin IXA (MYO9A), mRNA.	position 5691 (CDS: 492 - 8138) 
NM_006995	NM_006995.4	BTN2A2	10385	Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 1, mRNA.	position 3091 (CDS: 112 - 1683) 
NM_012154	NM_012154.3	AGO2	27161	Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 1, mRNA.	position 1167 (CDS: 42 - 2621) 
NM_012463	NM_012463.3	ATP6V0A2	23545	Homo sapiens ATPase, H+ transporting, lysosomal V0 subunit a2 (ATP6V0A2), mRNA.	position 3995 4053 (CDS: 249 - 2819) 
NM_014046	NM_014046.3	MRPS18B	28973	Homo sapiens mitochondrial ribosomal protein S18B (MRPS18B), mRNA.	position 830 (CDS: 158 - 934) 
NM_014112	NM_014112.2	TRPS1	7227	Homo sapiens trichorhinophalangeal syndrome I (TRPS1), mRNA.	position 2649 (CDS: 579 - 4463) 
NM_014155	NM_014155.4	ZBTB44	29068	Homo sapiens zinc finger and BTB domain containing 44 (ZBTB44), mRNA.	position 7877 (CDS: 395 - 1756) 
NM_014393	NM_014393.2	STAU2	27067	Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 5, mRNA.	position 139 (CDS: 307 - 1746) 
NM_014646	NM_014646.2	LPIN2	9663	Homo sapiens lipin 2 (LPIN2), mRNA.	position 1841 (CDS: 240 - 2930) 
NM_014677	NM_014677.4	RIMS2	9699	Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant 2, mRNA.	position 3751 (CDS: 321 - 3812) 
NM_014695	NM_014695.1	CCDC144A	9720	Homo sapiens coiled-coil domain containing 144A (CCDC144A), mRNA.	position 2549 (CDS: 77 - 4360) 
NM_014720	NM_014720.2	SLK	9748	Homo sapiens STE20-like kinase (SLK), mRNA.	position 3602 (CDS: 35 - 3742) 
NM_014782	NM_014782.5	ARMCX2	9823	Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2), mRNA.	position 590 (CDS: 489 - 2387) 
NM_014810	NM_014810.4	CEP350	9857	Homo sapiens centrosomal protein 350kDa (CEP350), mRNA.	position 8856 (CDS: 384 - 9737) 
NM_014812	NM_014812.2	CEP170	9859	Homo sapiens centrosomal protein 170kDa (CEP170), transcript variant alpha, mRNA.	position 4303 (CDS: 409 - 5163) 
NM_014967	NM_014967.4	FAN1	22909	Homo sapiens FANCD2/FANCI-associated nuclease 1 (FAN1), transcript variant 1, mRNA.	position 1597 (CDS: 292 - 3345) 
NM_014981	NM_014981.1	MYH15	22989	Homo sapiens myosin, heavy chain 15 (MYH15), mRNA.	position 4609 (CDS: 58 - 5898) 
NM_015026	NM_015026.2	MON2	23041	Homo sapiens MON2 homolog (S. cerevisiae) (MON2), transcript variant 1, mRNA.	position 475 (CDS: 392 - 5545) 
NM_015049	NM_015049.2	TRAK2	66008	Homo sapiens trafficking protein, kinesin binding 2 (TRAK2), mRNA.	position 1287 (CDS: 447 - 3191) 
NM_015057	NM_015057.4	MYCBP2	23077	Homo sapiens MYC binding protein 2, E3 ubiquitin protein ligase (MYCBP2), mRNA.	position 8913 (CDS: 268 - 14304) 
NM_015134	NM_015134.3	MPRIP	23164	Homo sapiens myosin phosphatase Rho interacting protein (MPRIP), transcript variant 1, mRNA.	position 7401 (CDS: 90 - 3206) 
NM_015173	NM_015173.3	TBC1D1	23216	Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 1, mRNA.	position 5340 (CDS: 359 - 3865) 
NM_015255	NM_015255.2	UBR2	23304	Homo sapiens ubiquitin protein ligase E3 component n-recognin 2 (UBR2), transcript variant 1, mRNA.	position 3398 (CDS: 299 - 5566) 
NM_015302	NM_015302.1	HAUS5	23354	Homo sapiens HAUS augmin-like complex, subunit 5 (HAUS5), mRNA.	position 2551 (CDS: 52 - 1953) 
NM_015323	NM_015323.4	UFL1	23376	Homo sapiens UFM1-specific ligase 1 (UFL1), mRNA.	position 2329 (CDS: 49 - 2433) 
NM_015429	NM_015429.3	ABI3BP	25890	Homo sapiens ABI family, member 3 (NESH) binding protein (ABI3BP), mRNA.	position 4149 (CDS: 86 - 3313) 
NM_015440	NM_015440.4	MTHFD1L	25902	Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 2, mRNA.	position 964 (CDS: 145 - 3081) 
NM_015457	NM_015457.2	ZDHHC5	25921	Homo sapiens zinc finger, DHHC-type containing 5 (ZDHHC5), mRNA.	position 451 (CDS: 1257 - 3404) 
NM_015842	NM_015842.2	LMO7	4008	Homo sapiens LIM domain 7 (LMO7), transcript variant 2, mRNA.	position 380 (CDS: 761 - 4918) 
NM_016009	NM_016009.4	SH3GLB1	51100	Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 1, mRNA.	position 943 (CDS: 331 - 1428) 
NM_016848	NM_016848.5	SHC3	53358	Homo sapiens SHC (Src homology 2 domain containing) transforming protein 3 (SHC3), mRNA.	position 904 (CDS: 308 - 2092) 
NM_017508	NM_017508.2	SOX6	55553	Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 1, mRNA.	position 913 (CDS: 205 - 2619) 
NM_017667	NM_017667.3	CCDC132	55610	Homo sapiens coiled-coil domain containing 132 (CCDC132), transcript variant 1, mRNA.	position 1773 (CDS: 129 - 3023) 
NM_017759	NM_017759.4	INO80D	54891	Homo sapiens INO80 complex subunit D (INO80D), mRNA.	position 13847 (CDS: 406 - 3489) 
NM_017950	NM_017950.3	CCDC40	55036	Homo sapiens coiled-coil domain containing 40 (CCDC40), transcript variant 1, mRNA.	position 1391 (CDS: 32 - 3460) 
NM_018003	NM_018003.2	UACA	55075	Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 1, mRNA.	position 2973 (CDS: 105 - 4355) 
NM_018566	NM_018566.3	YOD1	55432	Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 1, mRNA.	position 5327 (CDS: 48 - 1094) 
NM_018934	NM_018934.3	PCDHB14	56122	Homo sapiens protocadherin beta 14 (PCDHB14), mRNA.	position 1156 (CDS: 1181 - 3577) 
NM_019590	NM_019590.3	KIAA1217	56243	Homo sapiens KIAA1217 (KIAA1217), transcript variant 1, mRNA.	position 1272 (CDS: 404 - 6235) 
NM_019595	NM_019595.3	ITSN2	50618	Homo sapiens intersectin 2 (ITSN2), transcript variant 3, mRNA.	position 1690 (CDS: 259 - 5271) 
NM_019610	NM_019610.5	RBMXL1	494115	Homo sapiens RNA binding motif protein, X-linked-like 1 (RBMXL1), transcript variant 2, mRNA.	position 1278 (CDS: 617 - 1789) 
NM_020336	NM_020336.2	RALGAPB	57148	Homo sapiens Ral GTPase activating protein, beta subunit (non-catalytic) (RALGAPB), mRNA.	position 3951 (CDS: 258 - 4742) 
NM_020823	NM_020823.1	TMEM181	57583	Homo sapiens transmembrane protein 181 (TMEM181), mRNA.	position 1944 (CDS: 12 - 1850) 
NM_020917	NM_020917.2	ZFP14	57677	Homo sapiens ZFP14 zinc finger protein (ZFP14), mRNA.	position 338 (CDS: 121 - 1722) 
NM_021115	NM_021115.4	SEZ6L	23544	Homo sapiens seizure related 6 homolog (mouse)-like (SEZ6L), transcript variant 1, mRNA.	position 541 (CDS: 197 - 3271) 
NM_022909	NM_022909.3	CENPH	64946	Homo sapiens centromere protein H (CENPH), mRNA.	position 561 (CDS: 88 - 831) 
NM_024295	NM_024295.5	DERL1	79139	Homo sapiens derlin 1 (DERL1), transcript variant 1, mRNA.	position 1475 (CDS: 302 - 1057) 
NM_024580	NM_024580.5	EFTUD1	79631	Homo sapiens elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 1, mRNA.	position 1472 (CDS: 170 - 3532) 
NM_024834	NM_024834.3	MCMBP	79892	Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 1, mRNA.	position 1435 (CDS: 300 - 2228) 
NM_024884	NM_024884.2	L2HGDH	79944	Homo sapiens L-2-hydroxyglutarate dehydrogenase (L2HGDH), mRNA.	position 506 (CDS: 80 - 1471) 
NM_024940	NM_024940.6	DOCK5	80005	Homo sapiens dedicator of cytokinesis 5 (DOCK5), mRNA.	position 5996 (CDS: 138 - 5750) 
NM_025054	NM_025054.4	VCPIP1	80124	Homo sapiens valosin containing protein (p97)/p47 complex interacting protein 1 (VCPIP1), mRNA.	position 2870 (CDS: 260 - 3928) 
NM_025190	NM_025190.3	ANKRD36B	57730	Homo sapiens ankyrin repeat domain 36B (ANKRD36B), mRNA.	position 3137 (CDS: 281 - 4342) 
NM_030583	NM_030583.2	MATN2	4147	Homo sapiens matrilin 2 (MATN2), transcript variant 2, mRNA.	position 2635 (CDS: 232 - 3045) 
NM_032408	NM_032408.3	BAZ1B	9031	Homo sapiens bromodomain adjacent to zinc finger domain, 1B (BAZ1B), mRNA.	position 3014 (CDS: 353 - 4804) 
NM_032446	NM_032446.2	MEGF10	84466	Homo sapiens multiple EGF-like-domains 10 (MEGF10), transcript variant 1, mRNA.	position 3526 (CDS: 363 - 3785) 
NM_032597	NM_032597.4	MS4A14	84689	Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 1, mRNA.	position 1118 (CDS: 566 - 2605) 
NM_032805	NM_032805.1	ZSCAN10	84891	Homo sapiens zinc finger and SCAN domain containing 10 (ZSCAN10), mRNA.	position 412 (CDS: 89 - 2266) 
NM_033253	NM_033253.3	NT5C1B	93034	Homo sapiens 5'-nucleotidase, cytosolic IB (NT5C1B), transcript variant 2, mRNA.	position 1250 (CDS: 113 - 1765) 
NM_033326	NM_033326.3	SOX6	55553	Homo sapiens SRY (sex determining region Y)-box 6 (SOX6), transcript variant 2, mRNA.	position 778 (CDS: 79 - 2505) 
NM_052931	NM_052931.4	SLAMF6	114836	Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 2, mRNA.	position 819 (CDS: 71 - 1066) 
NM_053025	NM_053025.3	MYLK	4638	Homo sapiens myosin light chain kinase (MYLK), transcript variant 1, mRNA.	position 3243 (CDS: 283 - 6027) 
NM_053026	NM_053026.3	MYLK	4638	Homo sapiens myosin light chain kinase (MYLK), transcript variant 2, mRNA.	position 3036 (CDS: 283 - 5820) 
NM_053027	NM_053027.3	MYLK	4638	Homo sapiens myosin light chain kinase (MYLK), transcript variant 3A, mRNA.	position 3243 (CDS: 283 - 5874) 
NM_053028	NM_053028.3	MYLK	4638	Homo sapiens myosin light chain kinase (MYLK), transcript variant 3B, mRNA.	position 3036 (CDS: 283 - 5667) 
NM_078470	NM_078470.4	COX15	1355	Homo sapiens cytochrome c oxidase assembly homolog 15 (yeast) (COX15), transcript variant 1, mRNA.	position 4705 (CDS: 618 - 1850) 
NM_080538	NM_080538.2	COLQ	8292	Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant II, mRNA.	position 2811 (CDS: 286 - 1623) 
NM_080539	NM_080539.3	COLQ	8292	Homo sapiens collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ), transcript variant III, mRNA.	position 2580 (CDS: 127 - 1392) 
NM_130391	NM_130391.3	PTPRD	5789	Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 2, mRNA.	position 4954 (CDS: 104 - 4621) 
NM_130392	NM_130392.3	PTPRD	5789	Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 3, mRNA.	position 4957 (CDS: 104 - 4624) 
NM_130393	NM_130393.3	PTPRD	5789	Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 4, mRNA.	position 4927 (CDS: 104 - 4594) 
NM_133367	NM_133367.4	PAQR8	85315	Homo sapiens progestin and adipoQ receptor family member VIII (PAQR8), mRNA.	position 3457 (CDS: 175 - 1239) 
NM_133378	NM_133378.4	TTN	7273	Homo sapiens titin (TTN), transcript variant N2-A, mRNA.	position 29938 (CDS: 226 - 100497) 
NM_133439	NM_133439.2	TADA2A	6871	Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 2, mRNA.	position 601 (CDS: 370 - 1287) 
NM_134442	NM_134442.3	CREB1	1385	Homo sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant B, mRNA.	position 8381 (CDS: 252 - 1277) 
NM_138690	NM_138690.1	GRIN3B	116444	Homo sapiens glutamate receptor, ionotropic, N-methyl-D-aspartate 3B (GRIN3B), mRNA.	position 2118 (CDS: 1 - 3132) 
NM_138694	NM_138694.3	PKHD1	5314	Homo sapiens polycystic kidney and hepatic disease 1 (autosomal recessive) (PKHD1), transcript variant 1, mRNA.	position 13652 (CDS: 277 - 12501) 
NM_138959	NM_138959.2	VANGL1	81839	Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 1, mRNA.	position 536 (CDS: 272 - 1846) 
NM_144684	NM_144684.2	ZNF480	147657	Homo sapiens zinc finger protein 480 (ZNF480), mRNA.	position 2072 (CDS: 71 - 1678) 
NM_144715	NM_144715.3	EFHB	151651	Homo sapiens EF-hand domain family, member B (EFHB), mRNA.	position 2516 (CDS: 197 - 2698) 
NM_144982	NM_144982.4	ZFC3H1	196441	Homo sapiens zinc finger, C3H1-type containing (ZFC3H1), mRNA.	position 2703 (CDS: 360 - 6329) 
NM_144999	NM_144999.2	LRRC45	201255	Homo sapiens leucine rich repeat containing 45 (LRRC45), mRNA.	position 1048 (CDS: 241 - 2253) 
NM_145059	NM_145059.2	FUK	197258	Homo sapiens fucokinase (FUK), mRNA.	position 3457 (CDS: 59 - 3313) 
NM_145204	NM_145204.3	SENP8	123228	Homo sapiens SUMO/sentrin specific peptidase family member 8 (SENP8), transcript variant 2, mRNA.	position 424 (CDS: 223 - 861) 
NM_145286	NM_145286.2	STOML3	161003	Homo sapiens stomatin (EPB72)-like 3 (STOML3), transcript variant 1, mRNA.	position 628 (CDS: 139 - 1014) 
NM_147152	NM_147152.2	ITSN2	50618	Homo sapiens intersectin 2 (ITSN2), transcript variant 2, mRNA.	position 1690 (CDS: 259 - 4008) 
NM_152447	NM_152447.3	LRFN5	145581	Homo sapiens leucine rich repeat and fibronectin type III domain containing 5 (LRFN5), mRNA.	position 2984 (CDS: 1199 - 3358) 
NM_153339	NM_153339.1	PUSL1	126789	Homo sapiens pseudouridylate synthase-like 1 (PUSL1), mRNA.	position 1142 (CDS: 31 - 942) 
NM_153613	NM_153613.2	LPCAT4	254531	Homo sapiens lysophosphatidylcholine acyltransferase 4 (LPCAT4), mRNA.	position 1163 (CDS: 95 - 1669) 
NM_153646	NM_153646.3	SLC24A4	123041	Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 1, mRNA.	position 2966 (CDS: 24 - 1892) 
NM_153647	NM_153647.3	SLC24A4	123041	Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 2, mRNA.	position 2982 (CDS: 97 - 1908) 
NM_153648	NM_153648.3	SLC24A4	123041	Homo sapiens solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 (SLC24A4), transcript variant 3, mRNA.	position 2868 (CDS: 118 - 1794) 
NM_173464	NM_173464.3	L3MBTL4	91133	Homo sapiens l(3)mbt-like 4 (Drosophila) (L3MBTL4), mRNA.	position 2035 (CDS: 202 - 2073) 
NM_174981	NM_174981.3	POTED	317754	Homo sapiens POTE ankyrin domain family, member D (POTED), mRNA.	position 1640 (CDS: 53 - 1807) 
NM_177949	NM_177949.2	ARMCX2	9823	Homo sapiens armadillo repeat containing, X-linked 2 (ARMCX2), mRNA.	position 641 (CDS: 540 - 2438) 
NM_181453	NM_181453.3	GCC2	9648	Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 1, mRNA.	position 704 (CDS: 155 - 5209) 
NM_181489	NM_181489.5	ZNF445	353274	Homo sapiens zinc finger protein 445 (ZNF445), mRNA.	position 9884 (CDS: 349 - 3444) 
NM_181531	NM_181531.2	BTN2A2	10385	Homo sapiens butyrophilin, subfamily 2, member A2 (BTN2A2), transcript variant 2, mRNA.	position 2743 (CDS: 112 - 1335) 
NM_182398	NM_182398.1	RPS6KA5	9252	Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 2, mRNA.	position 1109 (CDS: 216 - 1865) 
NM_182640	NM_182640.2	MRPS9	64965	Homo sapiens mitochondrial ribosomal protein S9 (MRPS9), mRNA.	position 369 (CDS: 69 - 1259) 
NM_184041	NM_184041.2	ALDOA	226	Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 2, mRNA.	position 1012 (CDS: 277 - 1371) 
NM_184043	NM_184043.2	ALDOA	226	Homo sapiens aldolase A, fructose-bisphosphate (ALDOA), transcript variant 3, mRNA.	position 984 (CDS: 249 - 1343) 
NM_194071	NM_194071.3	CREB3L2	64764	Homo sapiens cAMP responsive element binding protein 3-like 2 (CREB3L2), transcript variant 1, mRNA.	position 2258 (CDS: 397 - 1959) 
NM_194300	NM_194300.3	CCDC129	223075	Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 2, mRNA.	position 1497 (CDS: 36 - 3170) 
NM_198215	NM_198215.3	FAM13C	220965	Homo sapiens family with sequence similarity 13, member C (FAM13C), transcript variant 1, mRNA.	position 1706 (CDS: 135 - 1892) 
NM_199420	NM_199420.3	POLQ	10721	Homo sapiens polymerase (DNA directed), theta (POLQ), mRNA.	position 115 (CDS: 130 - 7902) 
NM_201274	NM_201274.3	MPRIP	23164	Homo sapiens myosin phosphatase Rho interacting protein (MPRIP), transcript variant 2, mRNA.	position 7464 (CDS: 90 - 3167) 
NM_203391	NM_203391.3	GK	2710	Homo sapiens glycerol kinase (GK), transcript variant 1, mRNA.	position 3217 (CDS: 180 - 1772) 
NM_205845	NM_205845.2	AKR1C2	1646	Homo sapiens aldo-keto reductase family 1, member C2 (AKR1C2), transcript variant 2, mRNA.	position 3061 (CDS: 314 - 1285) 
NR_002763	NR_002763.2	CPS1-IT1	29034	Homo sapiens CPS1 intronic transcript 1 (non-protein coding) (CPS1-IT1), non-coding RNA.	position 1039 
NR_003135	NR_003135.2	CEP170P1	645455	Homo sapiens centrosomal protein 170kDa pseudogene 1 (CEP170P1), non-coding RNA.	position 157 
NR_023380	NR_023380.1	CCDC144CP	348254	Homo sapiens coiled-coil domain containing 144C, pseudogene (CCDC144CP), non-coding RNA.	position 2620 
NR_024378	NR_024378.1	LINC00051	619434	Homo sapiens long intergenic non-protein coding RNA 51 (LINC00051), non-coding RNA.	position 476 
NR_024438	NR_024438.2	ACTG1P4	648740	Homo sapiens actin, gamma 1 pseudogene 4 (ACTG1P4), non-coding RNA.	position 153 
NR_024471	NR_024471.1	MRPL23-AS1	100133545	Homo sapiens MRPL23 antisense RNA 1 (MRPL23-AS1), non-coding RNA.	position 1257 
NR_026731	NR_026731.1	C14orf23	387978	Homo sapiens chromosome 14 open reading frame 23 (C14orf23), transcript variant 1, non-coding RNA.	position 1575 
NR_026844	NR_026844.1	ANKRD36BP1	84832	Homo sapiens ankyrin repeat domain 36B pseudogene 1 (ANKRD36BP1), non-coding RNA.	position 467 
NR_027247	NR_027247.2	LOC100130331	100130331	Homo sapiens POTE ankyrin domain family, member F pseudogene (LOC100130331), non-coding RNA.	position 1640 
NR_028041	NR_028041.1	GRM8	2918	Homo sapiens glutamate receptor, metabotropic 8 (GRM8), transcript variant 3, non-coding RNA.	position 1272 
NR_028063	NR_028063.1	GCC2	9648	Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 2, non-coding RNA.	position 619 
NR_028476	NR_028476.1	RBMX	27316	Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 3, non-coding RNA.	position 700 
NR_028477	NR_028477.1	RBMX	27316	Homo sapiens RNA binding motif protein, X-linked (RBMX), transcript variant 4, non-coding RNA.	position 907 
NR_029388	NR_029388.1	LOC728407	728407	Homo sapiens poly (ADP-ribose) glycohydrolase pseudogene (LOC728407), non-coding RNA.	position 756 
NR_029420	NR_029420.1	LOC650226	650226	Homo sapiens ankyrin repeat domain 26 pseudogene (LOC650226), non-coding RNA.	position 788 
NR_036493	NR_036493.1	PEX19	5824	Homo sapiens peroxisomal biogenesis factor 19 (PEX19), transcript variant 3, non-coding RNA.	position 177 
NR_036647	NR_036647.1	CCDC144B	284047	Homo sapiens coiled-coil domain containing 144B (pseudogene) (CCDC144B), non-coding RNA.	position 2642 
NR_036652	NR_036652.1	EFTUD1P1	648809	Homo sapiens elongation factor Tu GTP binding domain containing 1 pseudogene 1 (EFTUD1P1), non-coding RNA.	position 719 
NR_037688	NR_037688.1	ACTG1	71	Homo sapiens actin, gamma 1 (ACTG1), transcript variant 3, non-coding RNA.	position 143 
NR_038946	NR_038946.1	LOC100506025	100506025	Homo sapiens uncharacterized LOC100506025 (LOC100506025), transcript variant 1, non-coding RNA.	position 137 
NR_038947	NR_038947.1	LOC100506025	100506025	Homo sapiens uncharacterized LOC100506025 (LOC100506025), transcript variant 2, non-coding RNA.	position 215 
NR_046314	NR_046314.1	BLOC1S2	282991	Homo sapiens biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 3, non-coding RNA.	position 299 
NR_047565	NR_047565.1	CCDC129	223075	Homo sapiens coiled-coil domain containing 129 (CCDC129), transcript variant 4, non-coding RNA.	position 2011 
NR_049731	NR_049731.1	MS4A14	84689	Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 5, non-coding RNA.	position 1287 
NR_049732	NR_049732.1	MS4A14	84689	Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 6, non-coding RNA.	position 1239 
NR_049733	NR_049733.1	MS4A14	84689	Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 7, non-coding RNA.	position 1188 
NR_049734	NR_049734.1	MS4A14	84689	Homo sapiens membrane-spanning 4-domains, subfamily A, member 14 (MS4A14), transcript variant 8, non-coding RNA.	position 1338 
NR_051988	NR_051988.1	FBXW10	10517	Homo sapiens F-box and WD repeat domain containing 10 (FBXW10), transcript variant 3, non-coding RNA.	position 2410 
NR_073494	NR_073494.1	LOC100130075	100130075	Homo sapiens SUZ RNA binding domain containing 1 pseudogene (LOC100130075), non-coding RNA.	position 499 
NR_102763	NR_102763.1	GATA6-AS1	100128893	Homo sapiens GATA6 antisense RNA 1 (head to head) (GATA6-AS1), non-coding RNA.	position 1005 
XM_001717763	XM_001717763.5	ANKRD36C	400986	PREDICTED: Homo sapiens ankyrin repeat domain 36C, transcript variant 1 (ANKRD36C), mRNA.	position 5146 (CDS: 526 - 6351) 
XM_003118857	XM_003118857.3	ANKRD36C	400986	PREDICTED: Homo sapiens ankyrin repeat domain 36C, transcript variant 2 (ANKRD36C), mRNA.	position 3418 (CDS: 526 - 4623) 
XM_003119864	XM_003119864.3	ANKRD36C	400986	PREDICTED: Homo sapiens ankyrin repeat domain 36C (ANKRD36C), mRNA.	position 5101 (CDS: 1 - 6306) 
XM_003403700	XM_003403700.1	GRIN3B	116444	PREDICTED: Homo sapiens glutamate receptor, ionotropic, N-methyl-D-aspartate 3B (GRIN3B), mRNA.	position 2403 (CDS: 1 - 3417) 
XM_003960295	XM_003960295.1	ANKRD36C	400986	PREDICTED: Homo sapiens ankyrin repeat domain 36C (ANKRD36C), mRNA.	position 5151 (CDS: 525 - 6356) 
XM_003960306	XM_003960306.1	ANKRD36B	57730	PREDICTED: Homo sapiens ankyrin repeat domain 36B (ANKRD36B), mRNA.	position 3258 (CDS: 561 - 4163) 
XR_171205	XR_171205.1	LOC101060595	101060595	PREDICTED: Homo sapiens uncharacterized LOC101060595 (LOC101060595), misc_RNA.	position 393 
XR_172491	XR_172491.1	LOC100996862	100996862	PREDICTED: Homo sapiens ankyrin repeat domain-containing protein 36A-like (LOC100996862), misc_RNA.	position 88

Debug Info:

0.012 | 0.012 | q_start
0.221 | 0.209 | q_end
0.594 | 0.373 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.