GGRNA Home | Help | Advanced search

2023-11-29 14:57:43, GGRNA : RefSeq release 60 (20130726)

Summary:

search term:hits:results:
seq:caagaagagattg12 NM_001008224, NM_001197294, NM_001387, NM_001870, NM_003380, NM_004755, NM_015457, NM_018003, NM_024940, NM_181453, NM_182398, NR_028063
[AND] 12 NM_001008224, NM_001197294, NM_001387, NM_001870, NM_003380, NM_004755, NM_015457, NM_018003, NM_024940, NM_181453, NM_182398, NR_028063

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 2, mRNA. (7096 bp)
..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaatt .....
position 3196 (CDS: 367 - 4578)
Synonym: NUCLING
NM_001008224.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 1, mRNA. (5496 bp)
..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtac .....
position 2284 (CDS: 199 - 2253)
Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001197294.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dihydropyrimidinase-like 3 (DPYSL3), transcript variant 2, mRNA. (5066 bp)
..... ctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtac .....
position 1854 (CDS: 111 - 1823)
Synonym: CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP; ULIP-1
NM_001387.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens carboxypeptidase A3 (mast cell) (CPA3), mRNA. (1699 bp)
..... aaatcttgattcatgatctacaagaagagattgagaaacagtttgatgttaaa .....
position 341 (CDS: 53 - 1306)
Synonym: MC-CPA
NM_001870.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens vimentin (VIM), mRNA. (2151 bp)
..... aacgcaaagtggaatctttgcaagaagagattgcctttttgaagaaactccac .....
position 1095 (CDS: 414 - 1814)
NM_003380.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 1, mRNA. (3883 bp)
..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgc .....
position 1109 (CDS: 216 - 2624)
Synonym: MSK1; MSPK1; RLPK
NM_004755.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens zinc finger, DHHC-type containing 5 (ZDHHC5), mRNA. (4582 bp)
..... cttaaagggcttgggaataacaagaagagattgaagacagagaagcttgccct .....
position 451 (CDS: 1257 - 3404)
Synonym: DHHC5; ZNF375
NM_015457.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 1, mRNA. (6873 bp)
..... tggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaatt .....
position 2973 (CDS: 105 - 4355)
Synonym: NUCLING
NM_018003.2 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens dedicator of cytokinesis 5 (DOCK5), mRNA. (7555 bp)
..... tcacagcctctgattttttccaagaagagattgccttcaccattgttaaatgt .....
position 5996 (CDS: 138 - 5750)
NM_024940.6 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 1, mRNA. (6998 bp)
..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggcttt .....
position 704 (CDS: 155 - 5209)
Synonym: GCC185; RANBP2L4; REN53
NM_181453.3 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5), transcript variant 2, mRNA. (2343 bp)
..... cgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgc .....
position 1109 (CDS: 216 - 1865)
Synonym: MSK1; MSPK1; RLPK
NM_182398.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression
Homo sapiens GRIP and coiled-coil domain containing 2 (GCC2), transcript variant 2, non-coding RNA. (6913 bp)
..... aagataatgttaaaaaactacaagaagagattgagaaaattaggccaggcttt .....
position 619
Synonym: GCC185; RANBP2L4; REN53
NR_028063.1 - Homo sapiens (human) - NCBI - UCSC - Reference Expression

Data Export:

Tab-delimited text. You can copy-paste the result into spreadsheet softwares (e.g., Excel, Numbers, Google Docs) or text editors.

Debug Info:

0.013 | 0.013 | q_start
0.089 | 0.076 | q_end
0.097 | 0.008 | end

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.