2024-04-25 07:52:48, GGRNA : RefSeq release 60 (20130726)
LOCUS XM_003960959 1383 bp mRNA linear PRI 30-OCT-2012 DEFINITION PREDICTED: Homo sapiens double homeobox 4 like 7 (DUX4L7), mRNA. ACCESSION XM_003960959 VERSION XM_003960959.1 GI:410170266 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_001841507) annotated using gene prediction method: GNOMON. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1383 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="Unknown" /sex="male" /dev_stage="adult" gene 1..1383 /gene="DUX4L7" /note="Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins" /db_xref="GeneID:653543" /db_xref="HGNC:37266" CDS 1..1383 /gene="DUX4L7" /codon_start=1 /product="LOW QUALITY PROTEIN: double homeobox 4 like 7" /protein_id="XP_003961008.1" /db_xref="GI:410170267" /db_xref="GeneID:653543" /db_xref="HGNC:37266" /translation="
MQGMVEDRHVHRPAEVHGSPPTSLCPCPSVKFRPGLPAMALLTPSHSTLPAESQGWERQRRLIWTPSKSEALQACFERNPYPGITTRERLAQAIGIQEPRVQIWFQNERSCQLRQHWRVSRPWPGRRGLQEGRRKRTAVTGSQTVLLLRAVAKDRFPGIAAREELAGKTGVLESRIQIWFQNRRARHPGQAGRAPTQAGGRCNAAPIGCHPAPSWVAFAHTGTWGMWLPAPHVPCVPGALPQGAFMSQGARVVPVLQPSQATPAEGISQPAPARGDLAYAAPAPPEGALSHTQVPRWPPHPGKIWEDRDPQHDGLPDPCLVGYPGPAQAGPQGQGVLAPPASQGSPWWGWGRGSQVAGAAWEPQAGAAPPLQPTPPEASTQQGQMQGMPASSQALQEPGRSSALPSGLLLDELLANPEFLQQAQPFIETDALGELEALEEAASLKXPFSEEEYQTLLEEL
" misc_feature 172..348 /gene="DUX4L7" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(172..186,190..192,241..243,259..261,298..300, 304..309,316..321,325..333,337..342) /gene="DUX4L7" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(178..180,187..189,307..309,316..321,328..330) /gene="DUX4L7" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 397..561 /gene="DUX4L7" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(397..411,415..417,466..468,484..486,523..525, 529..534,541..546,550..558) /gene="DUX4L7" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(403..405,412..414,532..534,541..546,553..555) /gene="DUX4L7" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" variation 109 /gene="DUX4L7" /replace="a" /replace="c" /db_xref="dbSNP:371361094" variation 138 /gene="DUX4L7" /replace="c" /replace="g" /db_xref="dbSNP:376803527" ORIGIN
atgcagggaatggtggaagaccggcatgtgcacaggccagctgaggtgcacgggagcccgccgacctctctctgcccatgtccgtctgtgaaattccggccggggctgcccgcgatggccctcctgactccttcgcacagcaccctccctgcggaatcccagggatgggaacggcaaaggagactcatttggaccccgagcaaaagcgaggccctacaagcctgctttgaacggaacccgtacccgggcatcaccaccagagaacggctggcccaggccatcggcattcaggagcccagggtccagatttggtttcagaatgagaggtcatgccagctgaggcagcactggcgggtatctcggccctggcccgggagacgtggcctgcaagaaggcaggcgaaagcggaccgccgtcaccggatcccagaccgtcctgctactccgagccgttgcgaaggatcgctttccaggcattgccgccagggaagagctggccggaaagacgggagtcctggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacaggctggaagggcgcccacgcaggcaggcggccggtgcaacgcagcccccattgggtgtcaccctgctccctcgtgggtcgcctttgcccacaccggcacttggggaatgtggcttcctgcaccccacgtgccctgcgtgcctggggctctcccacagggggctttcatgagccaaggagcgagggtcgtccccgtgctccagcccagccaggccacaccggcagaggggatctcccaacctgccccagcacgcggggatcttgcctacgccgccccggctcccccggaaggggcgctctcccacactcaggttcctcggtggcctccgcacccgggcaaaatctgggaggaccgggacccgcagcacgacggcctgccggatccttgcttggtgggatatcctgggcccgctcaagcggggccacagggccaaggtgtgcttgcaccacccgcgtcacaggggagtccgtggtggggctggggccggggttcccaggtcgctggggcggcatgggaaccccaagccggggcagctccacctctccagcccacgcccccggaggcctccacgcagcaggggcagatgcaaggcatgccggcgtcctcccaggcgctccaggagccggggcgatcgtctgcactcccctccggcctgctgctggatgagctcctggcaaacccggagtttctgcagcaggcacaacctttcatagaaacggatgccctgggggagctggaagccttggaagaggctgcttccctgaagncaccctttagtgaggaagaataccagactctgctggaggagctctag
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:653543 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA GeneID:653543 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:653543 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:653543 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.