GGRNA Home | Help | Advanced search

2024-03-29 16:09:15, GGRNA : RefSeq release 60 (20130726)

LOCUS       XM_003846725            1446 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens double homeobox protein 4-like (LOC650267),
            mRNA.
ACCESSION   XM_003846725
VERSION     XM_003846725.2  GI:410170215
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_001839407) annotated using gene prediction method: GNOMON.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 30, 2012 this sequence version replaced gi:397138564.
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1446
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="Unknown"
                     /sex="male"
                     /dev_stage="adult"
     gene            1..1446
                     /gene="LOC650267"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 4 Proteins"
                     /db_xref="GeneID:650267"
     CDS             1..1446
                     /gene="LOC650267"
                     /codon_start=1
                     /product="double homeobox protein 4-like"
                     /protein_id="XP_003846773.2"
                     /db_xref="GI:410170216"
                     /db_xref="GeneID:650267"
                     /translation="
MRGSPESGFQFPWDSWRGPESQPPKRAPLTPSPRPLPLRLSGPTTTINTPSPTNPPPGRGPRCPGTLLVSGAGLLAAPAPVHRPAEVHGSPPDSLCPCPSVTFRPGHPAMALPTPSDGTLPAEARGRGQRRRLVWTPSQSEALRACFVQNLHPGIATRGQLSQAIGIPEPRVQIWFQNERSRQLKQHRRESRPWPGRCGPQEGRRKRTAVTGSQNALLLRAFEKDRFPGIATREELARETGLLESRSEILFRNRRARHRGQAGKVPALAGGLCNVAPVGCHPAPSWVAFAHTGACETGLPARQVPCVPGALPQGAFVIHGARAVPVLQSSQAAPAEGIFQPAWACGDFAYAATALSEGVVSHPQAPRWRPHLAKAGRTGTRSATACRSLALWDSLGPLKRGHRAKLSLHQPCPRGLRGGAGARVRRSPGRHGNPKPSSSTLAARNPGGLLAAGADARHPGALPGASGATALICMPLRPAAG
"
     misc_feature    388..561
                     /gene="LOC650267"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(388..399,403..405,454..456,472..474,511..513,
                     517..522,529..534,538..546,550..555)
                     /gene="LOC650267"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(391..393,400..402,520..522,529..534,541..543)
                     /gene="LOC650267"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    610..783
                     /gene="LOC650267"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(610..624,628..630,679..681,697..699,736..738,
                     742..747,754..759,763..771,775..780)
                     /gene="LOC650267"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(616..618,625..627,745..747,754..759,766..768)
                     /gene="LOC650267"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
ORIGIN      
atgcgtgggagcccagagagcggcttccagtttccgtgggattcctggagaggcccggagagccagcccccgaaacgcgccccgctcaccccttcccctcgcccccttcctcttcgtctctctggccccaccaccaccatcaacacgccctcccccaccaacccaccccctggccgagggcctcgatgccctgggacccttctggtgtctggcgcaggcctcctagctgcacctgccccagtgcacaggcccgctgaggtgcacgggagcccgccggactctctctgtccgtgtccgtccgtgacattccggccggggcaccccgcgatggccctccccacaccttcagacggcaccctccctgcggaagcccggggacggggacagcgaaggagactcgtttggaccccgagccaaagcgaggccctgcgagcatgctttgtgcagaacctgcacccaggcatcgccaccagaggacagctgtcccaggccatcggcattccggagcccagggtccagatttggtttcagaatgagaggtcacgccagctgaagcagcaccggcgggaatctcggccctggcctgggagatgcggcccgcaagaaggcaggcgaaagcggactgccgtcacaggatcccagaatgccctgctcctccgagcctttgagaaggatcgctttccaggcatcgccaccagggaagagctggccagagagacgggcctcctggagtccaggagtgagatcttgtttcggaatcgaagggccaggcaccggggacaggctggcaaggtgcctgcgctggctggcggcctgtgcaacgtggcccccgttgggtgtcaccctgccccctcgtgggtcgccttcgcccacaccggcgcctgtgaaactgggcttcccgcacggcaagtgccctgcgtgcctggggctctcccacagggggctttcgtgatccacggagcgagggccgtccccgttctccagtccagccaggccgcgccggcagaggggatcttccaacctgcctgggcatgcggggattttgcctacgccgctacggctctttcggaaggggtggtctcccaccctcaggctcctcggtggcgtccacacctggcaaaagccgggaggaccgggacccgcagtgcgacagcctgccggtcccttgcgctgtgggacagcctgggcccactcaagcggggacacagggccaagttgtccttgcaccaaccttgtcccaggggactccgtggtggggctggggccagagtccgcaggtcgccggggcggcatgggaaccccaagccatccagctccactttggcagcccgcaaccccggaggcctcctcgcggcaggggcagatgcaaggcatcccggcgccctcccaggggcttcaggagccacagcgctcatatgcatgcccctccggcctgctgctggatga
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.