Home |
Help |
Advanced search
2024-04-19 22:19:29, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_073540 2058 bp RNA linear PRI 17-JUL-2013
DEFINITION Homo sapiens MOK protein kinase (MOK), transcript variant 3,
non-coding RNA.
ACCESSION NR_073540
VERSION NR_073540.1 GI:436408728
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2058)
AUTHORS Cha,H.J., Kim,J., Hong,S.M., Hong,S.J., Park,J.H., Kim,E.S.,
Wang,H.J., Choi,Y.J., Do,I.G., Joh,J.W., Kim,D.S. and Choi,K.Y.
TITLE Overexpression of renal tumor antigen is associated with tumor
invasion and poor prognosis of hepatocellular carcinoma
JOURNAL Ann. Surg. Oncol. 19 (SUPPL 3), S404-S411 (2012)
PUBMED 21717246
REMARK GeneRIF: Our results suggest that RAGE may be important in tumor
invasion and could be a potential predictor for the prognosis of
hepatocellular carcinoma patients.
Erratum:[Ann Surg Oncol. 2011 Dec;18 Suppl 3:S321]
REFERENCE 2 (bases 1 to 2058)
AUTHORS Veloso,C.A., Fernandes,J.S., Volpe,C.M., Fagundes-Netto,F.S.,
Reis,J.S., Chaves,M.M. and Nogueira-Machado,J.A.
TITLE TLR4 and RAGE: similar routes leading to inflammation in type 2
diabetic patients
JOURNAL Diabetes Metab. 37 (4), 336-342 (2011)
PUBMED 21377387
REMARK GeneRIF: PBMNC from type 2 diabetics were more sensitive to innate
immune stimulation with LPS and monoclonal agonist anti-TLR4 than
were cells from ND. The actions of LPS, anti-TLR4 and anti-RAGE
potentiated the production of IL-6 and TNF-alpha in both groups.
REFERENCE 3 (bases 1 to 2058)
AUTHORS Zhang,L., Liu,W., Alizadeh,D., Zhao,D., Farrukh,O., Lin,J.,
Badie,S.A. and Badie,B.
TITLE S100B attenuates microglia activation in gliomas: possible role of
STAT3 pathway
JOURNAL Glia 59 (3), 486-498 (2011)
PUBMED 21264954
REMARK GeneRIF: The RAGE pathway may play an important role in STAT3
induction in glioma-associated macrophages and microglia, a process
that may be mediated through S100B.
REFERENCE 4 (bases 1 to 2058)
AUTHORS Kelley,J.L., Turkheimer,K., Haney,M. and Swanson,W.J.
TITLE Targeted resequencing of two genes, RAGE and POLL, confirms
findings from a genome-wide scan for adaptive evolution and
provides evidence for positive selection in additional populations
JOURNAL Hum. Mol. Genet. 18 (4), 779-784 (2009)
PUBMED 19060005
REMARK GeneRIF: POLL is under genetic selection in Sub-Saharan African
populations.
REFERENCE 5 (bases 1 to 2058)
AUTHORS Uesaka,T. and Kageyama,N.
TITLE Cdx2 homeodomain protein regulates the expression of MOK, a member
of the mitogen-activated protein kinase superfamily, in the
intestinal epithelial cells
JOURNAL FEBS Lett. 573 (1-3), 147-154 (2004)
PUBMED 15327990
REMARK GeneRIF: identification of MOK, a member of the mitogen-activated
protein kinase superfamily, as one of the genes induced by a
caudal-related homeobox transcription factor, Cdx2
REFERENCE 6 (bases 1 to 2058)
AUTHORS Eichmuller,S., Usener,D., Jochim,A. and Schadendorf,D.
TITLE mRNA expression of tumor-associated antigens in melanoma tissues
and cell lines
JOURNAL Exp. Dermatol. 11 (4), 292-301 (2002)
PUBMED 12190937
REFERENCE 7 (bases 1 to 2058)
AUTHORS Gotte,K., Usener,D., Riedel,F., Hormann,K., Schadendorf,D. and
Eichmuller,S.
TITLE Tumor-associated antigens as possible targets for immune therapy in
head and neck cancer: comparative mRNA expression analysis of RAGE
and GAGE genes
JOURNAL Acta Otolaryngol. 122 (5), 546-552 (2002)
PUBMED 12206267
REFERENCE 8 (bases 1 to 2058)
AUTHORS Harrington,J.J., Sherf,B., Rundlett,S., Jackson,P.D., Perry,R.,
Cain,S., Leventhal,C., Thornton,M., Ramachandran,R.,
Whittington,J., Lerner,L., Costanzo,D., McElligott,K., Boozer,S.,
Mays,R., Smith,E., Veloso,N., Klika,A., Hess,J., Cothren,K., Lo,K.,
Offenbacher,J., Danzig,J. and Ducar,M.
TITLE Creation of genome-wide protein expression libraries using random
activation of gene expression
JOURNAL Nat. Biotechnol. 19 (5), 440-445 (2001)
PUBMED 11329013
REFERENCE 9 (bases 1 to 2058)
AUTHORS Miyata,Y., Akashi,M. and Nishida,E.
TITLE Molecular cloning and characterization of a novel member of the MAP
kinase superfamily
JOURNAL Genes Cells 4 (5), 299-309 (1999)
PUBMED 10421840
REFERENCE 10 (bases 1 to 2058)
AUTHORS Gaugler,B., Brouwenstijn,N., Vantomme,V., Szikora,J.P., Van der
Spek,C.W., Patard,J.J., Boon,T., Schrier,P. and Van den Eynde,B.J.
TITLE A new gene coding for an antigen recognized by autologous cytolytic
T lymphocytes on a human renal carcinoma
JOURNAL Immunogenetics 44 (5), 323-330 (1996)
PUBMED 8781117
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from U46193.1, U46194.1, AL359402.3
and HY184670.1.
Summary: This gene belongs to the MAP kinase superfamily. The gene
was found to be regulated by caudal type transcription factor 2
(Cdx2) protein. The encoded protein, which is localized to
epithelial cells in the intestinal crypt, may play a role in growth
arrest and differentiation of cells of upper crypt and lower villus
regions. Multiple alternatively spliced transcript variants
encoding different isoforms have been observed for this gene.
[provided by RefSeq, Dec 2012].
Transcript Variant: This variant (3) uses an alternate 5' and 3'
exon structure compared to variant 1. This variant is represented
as non-coding because it lacks a large portion of the coding
region, including the translational start codon, found in variant
1.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U46194.1 [ECO:0000332]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-14 U46193.1 1-14
15-470 U46194.1 1-456
471-471 AL359402.3 108500-108500 c
472-1568 U46194.1 459-1555
1569-1569 AL359402.3 107402-107402 c
1570-2055 U46194.1 1556-2041
2056-2058 HY184670.1 1-3 c
FEATURES Location/Qualifiers
source 1..2058
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="14"
/map="14q32"
gene 1..2058
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/note="MOK protein kinase"
/db_xref="GeneID:5891"
/db_xref="HGNC:9833"
/db_xref="MIM:605762"
misc_RNA 1..2058
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/product="MOK protein kinase, transcript variant 3"
/db_xref="GeneID:5891"
/db_xref="HGNC:9833"
/db_xref="MIM:605762"
exon 1..170
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/inference="alignment:Splign:1.39.8"
exon 171..272
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/inference="alignment:Splign:1.39.8"
exon 273..446
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/inference="alignment:Splign:1.39.8"
exon 447..1760
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/inference="alignment:Splign:1.39.8"
variation 1681
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1141543"
variation 1682
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1141544"
variation 1688
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1141545"
variation 1691
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1141546"
variation 1708
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1141550"
variation 1712
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1141551"
variation 1716
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1141552"
variation 1725
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1141554"
variation 1731
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1141555"
variation 1734
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1141556"
variation 1740
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1141557"
variation 1743
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1141558"
variation 1755
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1141559"
variation 1756
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1141560"
exon 1761..2058
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/inference="alignment:Splign:1.39.8"
polyA_signal 2038..2043
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
polyA_site 2055
/gene="MOK"
/gene_synonym="RAGE; RAGE-1; RAGE1"
/note="The 3' most polyA site has not been determined.
This is an internal polyA site."
ORIGIN
attcctgagtctgtgactggtgctggagttttgagtccacagataaaatgtgtctccttcgtctctactagagaggaaaaagaactggaattggaagaacagggagactgaagggtagcaagagaggctggagaagagagtgaaaagaccgcttacctgatttgaaattgtctgcagcccctctttcctggagtaaatgaactggaccaaatctcaaaaatccacgatgtcatcggcacacccgctcagaagatcctcaccaagttcaaacagtcgagagctatgaattttgattttccttttaaaaagggatcaggaatacctctactaacaaccaatttgtccccacaatgcctctccctcctgcacgcaatggtggcctatgatcccgatgagagaatcgccgcccaccaggccctgcagcacccctacttccaagaacagagaacccagaacggaagcgaggatgaggcctcagccgtcctcctccccattcaaacacgttcatccctcaaccctctgctgagcacctgcatgctgcccggccgcagtgtcacccttcttgtgtgagcctaccctcatccacccacctcaccctcctgaccttaaagaagacaccgggcagaagcacaggggagcccagtcacaccccacactggcgggggcaggccttgcagggagaagcagtaagcagccatctccatcagccatttccatctggcactcagacgtgcacgtcttcgtgtgacaggcggcagcagtgcgaccgtgacctcccatctgctctgctgtccccacacctgcggtgcagccagcctgccacaaggcagctagagtccagctagacccacccctggcacggccgacctcttcctggcttcttctgggcctaatccccgtgcattctccaacgccagaagtgtaagaaagtgcaaggcaacaagtgagaagagcaaacccaaatcgtaccagggaagctagtctttccagggcacctgagtgagggcatgaccagccttgacgctgcctcgctaccatctgcccagggcctgctgaatgcttgagtccatggtgacagtggtgggaacagttacgaggcagttagattttggaagtcatgttggcccacttggctacagagcagtcttaggaacagcaccataaaaataaagacttattcctgacacacatgcatctagagtaaactggggcgtatctgacagcgttagtacagtgatggccaaatgcaaactgcattccagaaccagcgaagggtgacagactgggctgaggcagagctaggactaaccatctcgagtgatgccatctcggggccaacaaaagttttggacacggctggatcatctgaccaaactgctcaaatctttacacaattattgtcctggtattaaactttcacctgccacttccaacaaacaggagacagaataaggagatgaccaggaagatggctggattaagaattctagacttggccgggtgcggtggctcacacctgtaatcctagcatcttgggaggctgaggcaggaggatcgcttgagcccaggagtttgagaccagcctaggcaacataaggagaccccatctctacaaaatatcaaaaaattacccaggtatggtggcacacacgtgtgattccagctactcgggaggctgagatgggaggatcacttgaacccaggaggttggggctacaatgagctatgatcgcaccacttcattccagcctggatgacagaagactcactccatagttcatggccccgtgatccagagtccctgctggcgccttcgagtggggcaggctgagaactcaagctgtaactaatgtctcctccgaagaaaactaaaccgagggctgagctgatgtgaagttttccgtggctgcattcatacaaatggtgaaaatgtagcatacctcccctcaaaagcctgaaagtaaagacatgcccccaatttaatgtgatgaattagagaaataggtttcagacacttcatggtttaaagtctcacaaaataaagctttcgaaggatcc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5891 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
GeneID:5891 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS
GeneID:5891 -> Molecular function: GO:0004693 [cyclin-dependent protein serine/threonine kinase activity] evidence: IEA
GeneID:5891 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:5891 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
GeneID:5891 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:5891 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.