GGRNA Home | Help | Advanced search

2024-04-27 06:40:05, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_049733               3423 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
            (MS4A14), transcript variant 7, non-coding RNA.
ACCESSION   NR_049733
VERSION     NR_049733.1  GI:387849361
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3423)
  AUTHORS   Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
            Snippe,H., Hibberd,M.L. and Seielstad,M.
  TITLE     New genetic associations detected in a host response study to
            hepatitis B vaccine
  JOURNAL   Genes Immun. 11 (3), 232-238 (2010)
   PUBMED   20237496
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AP003127.2, AK057418.1 and BC035361.1.
            
            Transcript Variant: This variant (7) includes an alternate exon in
            the coding region, compared to variant 4, which results in the
            introduction of an early stop codon. The transcript is sufficiently
            abundant to represent as a RefSeq record; however, the predicted
            protein product is not represented because the product is
            significantly truncated and the transcript is a candidate for
            nonsense-mediated mRNA decay (NMD).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-605               AP003127.2         99935-100539
            606-1051            AK057418.1         152-597
            1052-1163           BC035361.1         583-694
            1164-3423           AP003127.2         119418-121677
FEATURES             Location/Qualifiers
     source          1..3423
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q12.2"
     gene            1..3423
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="membrane-spanning 4-domains, subfamily A, member
                     14"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
     misc_RNA        1..3423
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /product="membrane-spanning 4-domains, subfamily A, member
                     14, transcript variant 7"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
     exon            1..703
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       31
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186234557"
     variation       39
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7929046"
     variation       40
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190992915"
     variation       51..52
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:377307026"
     variation       102
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76333679"
     variation       110
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143358541"
     variation       149
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3816270"
     variation       223
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76174817"
     variation       281
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180800488"
     variation       296
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185942516"
     variation       379
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141665394"
     variation       421
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112785513"
     variation       427
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375045470"
     variation       432
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190864604"
     variation       472
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6591579"
     variation       517
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368431455"
     variation       545
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367878785"
     variation       560
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200592380"
     misc_feature    566..1027
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001079692.2"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     variation       569
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201462421"
     variation       577
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375301622"
     variation       589
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140226757"
     variation       601
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200092161"
     variation       602
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371634910"
     variation       640
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150323558"
     variation       653
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200017443"
     variation       701
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138895874"
     exon            704..832
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       709
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141700245"
     variation       731
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:72514098"
     variation       732..733
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:3217518"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74733740"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:77630012"
     variation       747
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147119308"
     variation       769
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138517611"
     variation       770
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368053345"
     variation       771
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144076317"
     variation       794
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369576834"
     variation       796
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144248317"
     variation       802
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2197234"
     variation       810
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372708908"
     variation       815
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148297999"
     variation       827
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375255532"
     variation       831
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141490187"
     exon            833..982
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       833
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375760675"
     variation       834
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202236686"
     variation       846
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146613208"
     variation       847
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371907012"
     variation       856
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183715072"
     variation       876
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76136794"
     variation       881
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375247098"
     variation       891
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146035561"
     variation       910
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140270120"
     variation       960
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145354751"
     exon            983..1103
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       1039
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200118179"
     variation       1040
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61898304"
     variation       1051
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10750937"
     variation       1059
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188315131"
     exon            1104..3423
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       1124
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371774895"
     variation       1135
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375761169"
     variation       1149
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143463721"
     variation       1164
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7131283"
     variation       1165
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148391374"
     variation       1212
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369024994"
     variation       1218
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142563385"
     variation       1228
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373780418"
     variation       1236
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116626186"
     variation       1241
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140195795"
     variation       1267
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142269991"
     variation       1273
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147713621"
     variation       1274
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142667482"
     variation       1285
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370208539"
     variation       1323
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373858678"
     variation       1326
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150268605"
     variation       1383
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117801657"
     variation       1386
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149338262"
     variation       1422
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187868937"
     variation       1468
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150868984"
     variation       1484
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193025815"
     variation       1485
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368158780"
     variation       1486
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375278465"
     variation       1491
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114064661"
     variation       1507
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138285006"
     variation       1512
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142839945"
     variation       1532
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369608879"
     variation       1543
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185708225"
     variation       1580
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201469306"
     variation       1586
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114663860"
     variation       1595
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376669252"
     variation       1606
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139364741"
     variation       1612
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149681158"
     variation       1632
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150784858"
     variation       1682
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370940283"
     variation       1711
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145539034"
     variation       1731
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149868650"
     variation       1742
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144883718"
     variation       1779
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140428922"
     variation       1815
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144301602"
     variation       1849
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116345276"
     variation       1871
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112103602"
     variation       1903
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369619070"
     variation       1931
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373220783"
     variation       1943..1944
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35183103"
     variation       1987
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3802959"
     variation       2018
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143398166"
     variation       2029
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139435636"
     variation       2036
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145054362"
     variation       2074
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140456628"
     variation       2088
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376488191"
     variation       2126
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150409796"
     variation       2131
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74837900"
     variation       2147
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142892172"
     variation       2162
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145051590"
     variation       2179
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199805024"
     variation       2203
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199505839"
     variation       2206
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374402343"
     variation       2217
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201227484"
     variation       2240
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142235413"
     variation       2272
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113290465"
     variation       2276
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80173276"
     variation       2277
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144635507"
     variation       2290
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372468983"
     variation       2312
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370935983"
     variation       2362
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200738251"
     variation       2363
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148489703"
     variation       2370
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375897716"
     variation       2385
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3825020"
     variation       2411
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374558627"
     variation       2464
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116224124"
     variation       2471
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73481226"
     variation       2481
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200543306"
     variation       2485
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144309625"
     variation       2486
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201726394"
     variation       2493
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200307761"
     variation       2500
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3016727"
     variation       2513
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147367847"
     variation       2514
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936913"
     variation       2529
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368186934"
     variation       2531
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146179294"
     variation       2543
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370794980"
     variation       2552
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375353153"
     variation       2572
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145801550"
     variation       2596
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368014397"
     variation       2598
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149015522"
     variation       2656
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142968938"
     variation       2661
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151183005"
     variation       2694
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181547264"
     variation       2802
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77025492"
     variation       2912
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184474834"
     variation       3012
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375774697"
     variation       3034
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443243"
     variation       3123
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78731118"
     variation       3202
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375396734"
     variation       3238
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75538311"
     variation       3260
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138237921"
     variation       3268
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188971082"
     variation       3359..3360
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="aacac"
                     /db_xref="dbSNP:140068962"
     variation       3400
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181921480"
ORIGIN      


atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttattggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattgacttcatccttctcactcctccacactccagccacttcctataatcccttaatgtgtcaagtatccacggccccaagatgatcagaggatcagcttcttccggctttgaaccgtcaccaggttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.