Home |
Help |
Advanced search
2024-04-19 20:01:39, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_029842 86 bp RNA linear PRI 17-JUL-2013
DEFINITION Homo sapiens microRNA 301a (MIR301A), microRNA.
ACCESSION NR_029842
VERSION NR_029842.1 GI:262206112
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 86)
AUTHORS Chen,Z., Chen,L.Y., Dai,H.Y., Wang,P., Gao,S. and Wang,K.
TITLE miR-301a promotes pancreatic cancer cell proliferation by directly
inhibiting Bim expression
JOURNAL J. Cell. Biochem. 113 (10), 3229-3235 (2012)
PUBMED 22628193
REMARK GeneRIF: miR-301a promotes pancreatic cancer progression by
repressing Bim.
REFERENCE 2 (bases 1 to 86)
AUTHORS Zhou,P., Jiang,W., Wu,L., Chang,R., Wu,K. and Wang,Z.
TITLE miR-301a is a candidate oncogene that targets the homeobox gene Gax
in human hepatocellular carcinoma
JOURNAL Dig. Dis. Sci. 57 (5), 1171-1180 (2012)
PUBMED 22373864
REMARK GeneRIF: MiR-301a is a candidate oncogene that targets the homeobox
gene Gax in human hepatocellular carcinoma.The upregulated miR-301a
plays an important role in promoting proliferation, migration, and
invasion, and in inhibiting apoptosis of HCC cells.
REFERENCE 3 (bases 1 to 86)
AUTHORS Patel,N., Tahara,S.M., Malik,P. and Kalra,V.K.
TITLE Involvement of miR-30c and miR-301a in immediate induction of
plasminogen activator inhibitor-1 by placental growth factor in
human pulmonary endothelial cells
JOURNAL Biochem. J. 434 (3), 473-482 (2011)
PUBMED 21175428
REMARK GeneRIF: PlGF-induced PAI-1 expression at early time points is
post-transcriptionally regulated by two miRNAs, miR-30c and
miR-301a.
REFERENCE 4 (bases 1 to 86)
AUTHORS Cao,G., Huang,B., Liu,Z., Zhang,J., Xu,H., Xia,W., Li,J., Li,S.,
Chen,L., Ding,H., Zhao,Q., Fan,M., Shen,B. and Shao,N.
TITLE Intronic miR-301 feedback regulates its host gene, ska2, in A549
cells by targeting MEOX2 to affect ERK/CREB pathways
JOURNAL Biochem. Biophys. Res. Commun. 396 (4), 978-982 (2010)
PUBMED 20470754
REMARK GeneRIF: blocking of miR-301 in A549 cells leads to a decrease in
the expression of the host gene, ska2.
REFERENCE 5 (bases 1 to 86)
AUTHORS Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A.,
Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C.,
Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R.,
Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B.,
Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De
Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G.,
Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G.,
Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T.,
Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A.,
Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 6 (bases 1 to 86)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006)
PUBMED 16381832
REFERENCE 7 (bases 1 to 86)
AUTHORS Weber,M.J.
TITLE New human and mouse microRNA genes found by homology search
JOURNAL FEBS J. 272 (1), 59-73 (2005)
PUBMED 15634332
REFERENCE 8 (bases 1 to 86)
AUTHORS Suh,M.R., Lee,Y., Kim,J.Y., Kim,S.K., Moon,S.H., Lee,J.Y.,
Cha,K.Y., Chung,H.M., Yoon,H.S., Moon,S.Y., Kim,V.N. and Kim,K.S.
TITLE Human embryonic stem cells express a unique set of microRNAs
JOURNAL Dev. Biol. 270 (2), 488-498 (2004)
PUBMED 15183728
REFERENCE 9 (bases 1 to 86)
AUTHORS Houbaviy,H.B., Murray,M.F. and Sharp,P.A.
TITLE Embryonic stem cell-specific MicroRNAs
JOURNAL Dev. Cell 5 (2), 351-358 (2003)
PUBMED 12919684
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC099850.7.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-86 AC099850.7 113005-113090
FEATURES Location/Qualifiers
source 1..86
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q22"
gene 1..86
/gene="MIR301A"
/gene_synonym="MIRN301; MIRN301A"
/note="microRNA 301a"
/db_xref="GeneID:407027"
/db_xref="HGNC:31622"
/db_xref="miRBase:MI0000745"
precursor_RNA 1..86
/gene="MIR301A"
/gene_synonym="MIRN301; MIRN301A"
/product="microRNA 301a"
/db_xref="GeneID:407027"
/db_xref="HGNC:31622"
/db_xref="miRBase:MI0000745"
exon 1..86
/gene="MIR301A"
/gene_synonym="MIRN301; MIRN301A"
/inference="alignment:Splign:1.39.8"
variation complement(9)
/gene="MIR301A"
/gene_synonym="MIRN301; MIRN301A"
/replace="c"
/replace="t"
/db_xref="dbSNP:376863738"
variation complement(10)
/gene="MIR301A"
/gene_synonym="MIRN301; MIRN301A"
/replace="a"
/replace="g"
/db_xref="dbSNP:370820064"
ncRNA 14..35
/gene="MIR301A"
/gene_synonym="MIRN301; MIRN301A"
/ncRNA_class="miRNA"
/product="hsa-miR-301a-5p"
/db_xref="miRBase:MIMAT0022696"
/db_xref="GeneID:407027"
/db_xref="HGNC:31622"
/db_xref="miRBase:MI0000745"
variation complement(36)
/gene="MIR301A"
/gene_synonym="MIRN301; MIRN301A"
/replace="a"
/replace="g"
/db_xref="dbSNP:373973284"
ncRNA 51..73
/gene="MIR301A"
/gene_synonym="MIRN301; MIRN301A"
/ncRNA_class="miRNA"
/product="hsa-miR-301a-3p"
/db_xref="miRBase:MIMAT0000688"
/db_xref="GeneID:407027"
/db_xref="HGNC:31622"
/db_xref="miRBase:MI0000745"
ORIGIN
actgctaacgaatgctctgactttattgcactactgtactttacagctagcagtgcaatagtattgtcaaagcatctgaaagcagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.