LOCUS       NM_033178               1380 bp    mRNA    linear   PRI 08-JUL-2013
DEFINITION  Homo sapiens double homeobox 4 (DUX4), mRNA.
ACCESSION   NM_033178 XM_003960844
VERSION     NM_033178.4  GI:489406996
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1380)
  AUTHORS   Dandapat,A., Hartweck,L.M., Bosnakovski,D. and Kyba,M.
  TITLE     Expression of the Human FSHD-Linked DUX4 Gene Induces Neurogenesis
            During Differentiation of Murine Embryonic Stem Cells
  JOURNAL   Stem Cells Dev. (2013) In press
   PUBMED   23560660
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 1380)
  AUTHORS   Krom,Y.D., Thijssen,P.E., Young,J.M., den Hamer,B., Balog,J.,
            Yao,Z., Maves,L., Snider,L., Knopp,P., Zammit,P.S., Rijkers,T., van
            Engelen,B.G., Padberg,G.W., Frants,R.R., Tawil,R., Tapscott,S.J.
            and van der Maarel,S.M.
  TITLE     Intrinsic epigenetic regulation of the D4Z4 macrosatellite repeat
            in a transgenic mouse model for FSHD
  JOURNAL   PLoS Genet. 9 (4), E1003415 (2013)
   PUBMED   23593020
REFERENCE   3  (bases 1 to 1380)
  AUTHORS   Dixit,M., Ansseau,E., Tassin,A., Winokur,S., Shi,R., Qian,H.,
            Sauvage,S., Matteotti,C., van Acker,A.M., Leo,O., Figlewicz,D.,
            Barro,M., Laoudj-Chenivesse,D., Belayew,A., Coppee,F. and Chen,Y.W.
  TITLE     DUX4, a candidate gene of facioscapulohumeral muscular dystrophy,
            encodes a transcriptional activator of PITX1
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 104 (46), 18157-18162 (2007)
   PUBMED   17984056
  REMARK    GeneRIF: up-regulation of both DUX4 and PITX1 in FSHD muscles may
            play critical roles in the molecular mechanisms of the disease
REFERENCE   4  (bases 1 to 1380)
  AUTHORS   Clapp,J., Mitchell,L.M., Bolland,D.J., Fantes,J., Corcoran,A.E.,
            Scotting,P.J., Armour,J.A. and Hewitt,J.E.
  TITLE     Evolutionary conservation of a coding function for D4Z4, the tandem
            DNA repeat mutated in facioscapulohumeral muscular dystrophy
  JOURNAL   Am. J. Hum. Genet. 81 (2), 264-279 (2007)
   PUBMED   17668377
REFERENCE   5  (bases 1 to 1380)
  AUTHORS   Kowaljow,V., Marcowycz,A., Ansseau,E., Conde,C.B., Sauvage,S.,
            Matteotti,C., Arias,C., Corona,E.D., Nunez,N.G., Leo,O.,
            Wattiez,R., Figlewicz,D., Laoudj-Chenivesse,D., Belayew,A.,
            Coppee,F. and Rosa,A.L.
  TITLE     The DUX4 gene at the FSHD1A locus encodes a pro-apoptotic protein
  JOURNAL   Neuromuscul. Disord. 17 (8), 611-623 (2007)
   PUBMED   17588759
  REMARK    GeneRIF: DUX4-mediated cell death contributes to the pathogenic
            pathway in facioscapulohumeral muscular dystrophy
REFERENCE   6  (bases 1 to 1380)
  AUTHORS   Ostlund,C., Garcia-Carrasquillo,R.M., Belayew,A. and Worman,H.J.
  TITLE     Intracellular trafficking and dynamics of double homeodomain
            proteins
  JOURNAL   Biochemistry 44 (7), 2378-2384 (2005)
   PUBMED   15709750
  REMARK    GeneRIF: Report shows that full-length DUX4 is actively transported
            into the nuclei of transfected C2C12 myoblasts, and that DUX4
            homeodomains contain the signals required for this localization.
REFERENCE   7  (bases 1 to 1380)
  AUTHORS   Yip,D.J. and Picketts,D.J.
  TITLE     Increasing D4Z4 repeat copy number compromises C2C12 myoblast
            differentiation
  JOURNAL   FEBS Lett. 537 (1-3), 133-138 (2003)
   PUBMED   12606045
REFERENCE   8  (bases 1 to 1380)
  AUTHORS   Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A.,
            Frants,R.R., Collen,D. and Belayew,A.
  TITLE     Active genes in junk DNA? Characterization of DUX genes embedded
            within 3.3 kb repeated elements
  JOURNAL   Gene 264 (1), 51-57 (2001)
   PUBMED   11245978
REFERENCE   9  (bases 1 to 1380)
  AUTHORS   Gabriels,J., Beckers,M.C., Ding,H., De Vriese,A., Plaisance,S., van
            der Maarel,S.M., Padberg,G.W., Frants,R.R., Hewitt,J.E., Collen,D.
            and Belayew,A.
  TITLE     Nucleotide sequence of the partially deleted D4Z4 locus in a
            patient with FSHD identifies a putative gene within each 3.3 kb
            element
  JOURNAL   Gene 236 (1), 25-32 (1999)
   PUBMED   10433963
REFERENCE   10 (bases 1 to 1380)
  AUTHORS   Lee,J.H., Goto,K., Matsuda,C. and Arahata,K.
  TITLE     Characterization of a tandemly repeated 3.3-kb KpnI unit in the
            facioscapulohumeral muscular dystrophy (FSHD) gene region on
            chromosome 4q35
  JOURNAL   Muscle Nerve Suppl 2, S6-S13 (1995)
   PUBMED   7739628
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC126281.3.
            This sequence is a reference standard in the RefSeqGene project.
            On May 7, 2013 this sequence version replaced gi:485464583.
            
            Summary: This gene is located within a D4Z4 repeat array in the
            subtelomeric region of chromosome 4q. The D4Z4 repeat is
            polymorphic in length; a similar D4Z4 repeat array has been
            identified on chromosome 10. Each D4Z4 repeat unit has an open
            reading frame (named DUX4) that encodes two homeoboxes; the
            repeat-array and ORF is conserved in other mammals. There is no
            evidence for transcription of this gene from standard cDNA
            libraries, however, RT-PCR and in vitro expression experiments
            indicate that the ORF is transcribed. The encoded protein has been
            reported to function as a transcriptional activator of paired-like
            homeodomain transcription factor 1 (PITX1; GeneID 5307).
            Contraction of the microsatellite repeat causes autosomal dominant
            facioscapulohumeral muscular dystrophy (FSHD). [provided by RefSeq,
            May 2013].
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data because no transcript data was available for the full length
            of the gene. The extent of this protein is supported by similar
            human proteins.
            
            CCDS Note: The coding region has been updated to shorten the
            N-terminus to one that is more supported by available transcript
            and publication data. This gene is one of a cluster of highly
            similar DUX4 family members that are located within a D4Z4 repeat
            array in the subtelomeric region of chromosome 4q.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            COMPLETENESS: complete on the 5' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1380              AC126281.3         16074-17453
FEATURES             Location/Qualifiers
     source          1..1380
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4q35"
     gene            1..1380
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /note="double homeobox 4"
                     /db_xref="GeneID:22947"
                     /db_xref="HGNC:3082"
                     /db_xref="MIM:606009"
     exon            1..1380
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /inference="alignment:Splign:1.39.8"
     CDS             98..1372
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /note="double homeobox protein 10; double homeobox protein
                     4/10"
                     /codon_start=1
                     /product="double homeobox protein 4"
                     /protein_id="NP_149418.4"
                     /db_xref="GI:485464584"
                     /db_xref="CCDS:CCDS54828.1"
                     /db_xref="GeneID:22947"
                     /db_xref="HGNC:3082"
                     /db_xref="MIM:606009"
                     /translation="

MALPTPSDSTLPAEARGRGRRRRLVWTPSQSEALRACFERNPYPGIATRERLAQAIGIPEPRVQIWFQNERSRQLRQHRRESRPWPGRRGPPEGRRKRTAVTGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHPGQGGRAPAQAGGLCSAAPGGGHPAPSWVAFAHTGAWGTGLPAPHVPCAPGALPQGAFVSQAARAAPALQPSQAAPAEGVSQPAPARGDFAYAAPAPPDGALSHPQAPRWPPHPGKSREDRDPQRDGLPGPCAVAQPGPAQAGPQGQGVLAPPTSQGSPWWGWGRGPQVAGAAWEPQAGAAPPPQPAPPDASASARQGQMQGIPAPSQALQEPAPWSALPCGLLLDELLASPEFLQQAQPLLETEAPGELEASEEAASLEAPLSEEEYRALLEEL

"
     misc_feature    170..331
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(170..172,290..292,299..304,311..313)
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    order(173..175,224..226,242..244,281..283,287..292,
                     299..304,308..316,320..325)
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    401..544
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(449..451,467..469,506..508,512..517,524..529,
                     533..541)
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(515..517,524..529,536..538)
                     /gene="DUX4"
                     /gene_synonym="DUX10"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      

acctgccgcagtgcacagtccggctgaggtgcacgggagcccgccggcctctctctgcccgcgtccgtccgtgaaattccggccggggctcaccgcgatggccctcccgacaccctcggacagcaccctccccgcggaagcccggggacgaggacggcgacggagactcgtttggaccccgagccaaagcgaggccctgcgagcctgctttgagcggaacccgtacccgggcatcgccaccagagaacggctggcccaggccatcggcattccggagcccagggtccagatttggtttcagaatgagaggtcacgccagctgaggcagcaccggcgggaatctcggccctggcccgggagacgcggcccgccagaaggccggcgaaagcggaccgccgtcaccggatcccagaccgccctgctcctccgagcctttgagaaggatcgctttccaggcatcgccgcccgggaggagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacagggtggcagggcgcccgcgcaggcaggcggcctgtgcagcgcggcccccggcgggggtcaccctgctccctcgtgggtcgccttcgcccacaccggcgcgtggggaacggggcttcccgcaccccacgtgccctgcgcgcctggggctctcccacagggggctttcgtgagccaggcagcgagggccgcccccgcgctgcagcccagccaggccgcgccggcagagggggtctcccaacctgccccggcgcgcggggatttcgcctacgccgccccggctcctccggacggggcgctctcccaccctcaggctcctcggtggcctccgcacccgggcaaaagccgggaggaccgggacccgcagcgcgacggcctgccgggcccctgcgcggtggcacagcctgggcccgctcaagcggggccgcagggccaaggggtgcttgcgccacccacgtcccaggggagtccgtggtggggctggggccggggtccccaggtcgccggggcggcgtgggaaccccaagccggggcagctccacctccccagcccgcgcccccggacgcctccgcctccgcgcggcaggggcagatgcaaggcatcccggcgccctcccaggcgctccaggagccggcgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcgagcccggagtttctgcagcaggcgcaacctctcctagaaacggaggccccgggggagctggaggcctcggaagaggccgcctcgctggaagcacccctcagcgaggaagaataccgggctctgctggaggagctttaggacgcggg

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:22947 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA
            GeneID:22947 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:22947 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:22947 -> Cellular component: GO:0005634 [nucleus] evidence: IEA