GGRNA Home | Help | Advanced search

2024-03-28 19:21:08, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_024015               2042 bp    mRNA    linear   PRI 12-MAY-2013
DEFINITION  Homo sapiens homeobox B4 (HOXB4), mRNA.
ACCESSION   NM_024015
VERSION     NM_024015.4  GI:85376187
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2042)
  AUTHORS   Wen-jun,L., qu-lian,G., Hong-ying,C., Yan,Z. and Mei-Xian,H.
  TITLE     Studies on HOXB4 expression during differentiation of human
            cytomegalovirus-infected hematopoietic stem cells into lymphocyte
            and erythrocyte progenitor cells
  JOURNAL   Cell Biochem. Biophys. 63 (2), 133-141 (2012)
   PUBMED   22402911
  REMARK    GeneRIF: cytomegalovirus infection markedly down-regulated HOXB4
            expression which affected proliferation and differentiation of
            erythroid and lymphocyte progenitor cells.
REFERENCE   2  (bases 1 to 2042)
  AUTHORS   Fan,R., Bonde,S., Gao,P., Sotomayor,B., Chen,C., Mouw,T.,
            Zavazava,N. and Tan,K.
  TITLE     Dynamic HoxB4-regulatory network during embryonic stem cell
            differentiation to hematopoietic cells
  JOURNAL   Blood 119 (19), E139-E147 (2012)
   PUBMED   22438249
  REMARK    GeneRIF: Down-regulation of mitochondria and lysosomal genes by
            HoxB4 plays a role in the impaired lymphoid lineage development
            from embryonic stem cells-derived hematopoietic stem cells.
REFERENCE   3  (bases 1 to 2042)
  AUTHORS   Umeda,S., Yamamoto,K., Murayama,T., Hidaka,M., Kurata,M.,
            Ohshima,T., Suzuki,S., Sugawara,E., Kawano,F. and Kitagawa,M.
  TITLE     Prognostic significance of HOXB4 in de novo acute myeloid leukemia
  JOURNAL   Hematology 17 (3), 125-131 (2012)
   PUBMED   22664110
  REMARK    GeneRIF: HOXB4-positivity as an independent predictor of overall
            survival of acute myeloid leukemia patients
REFERENCE   4  (bases 1 to 2042)
  AUTHORS   Fujiwara,T., Yokoyama,H., Okitsu,Y., Kamata,M., Fukuhara,N.,
            Onishi,Y., Fujimaki,S., Takahashi,S., Ishizawa,K., Bresnick,E.H.
            and Harigae,H.
  TITLE     Gene expression profiling identifies HOXB4 as a direct downstream
            target of GATA-2 in human CD34+ hematopoietic cells
  JOURNAL   PLoS ONE 7 (9), E40959 (2012)
   PUBMED   23028422
  REMARK    GeneRIF: GATA-2 directly regulates HOXB4 expression in
            hematopoietic stem cells, which may play an important role in the
            development and/or progression of aplastic anemia.
REFERENCE   5  (bases 1 to 2042)
  AUTHORS   Larbi,A., Gombert,J.M., Auvray,C., l'Homme,B., Magniez,A.,
            Feraud,O., Coulombel,L., Chapel,A., Mitjavila-Garcia,M.T.,
            Turhan,A.G., Haddad,R. and Bennaceur-Griscelli,A.
  TITLE     The HOXB4 homeoprotein promotes the ex vivo enrichment of
            functional human embryonic stem cell-derived NK cells
  JOURNAL   PLoS ONE 7 (6), E39514 (2012)
   PUBMED   22761810
  REMARK    GeneRIF: our results outline the effects of HOXB4 in combination
            with stromal cells in the development of NK cells from embryonic
            stem cells.
REFERENCE   6  (bases 1 to 2042)
  AUTHORS   Petrini,M., Quaranta,M.T., Testa,U., Samoggia,P., Tritarelli,E.,
            Care,A., Cianetti,L., Valtieri,M., Barletta,C. and Peschle,C.
  TITLE     Expression of selected human HOX-2 genes in B/T acute lymphoid
            leukemia and interleukin-2/interleukin-1 beta-stimulated natural
            killer lymphocytes
  JOURNAL   Blood 80 (1), 185-193 (1992)
   PUBMED   1351762
REFERENCE   7  (bases 1 to 2042)
  AUTHORS   Peverali,F.A., D'Esposito,M., Acampora,D., Bunone,G., Negri,M.,
            Faiella,A., Stornaiuolo,A., Pannese,M., Migliaccio,E., Simeone,A.
            et al.
  TITLE     Expression of HOX homeogenes in human neuroblastoma cell culture
            lines
  JOURNAL   Differentiation 45 (1), 61-69 (1990)
   PUBMED   1981366
REFERENCE   8  (bases 1 to 2042)
  AUTHORS   Acampora,D., D'Esposito,M., Faiella,A., Pannese,M., Migliaccio,E.,
            Morelli,F., Stornaiuolo,A., Nigro,V., Simeone,A. and Boncinelli,E.
  TITLE     The human HOX gene family
  JOURNAL   Nucleic Acids Res. 17 (24), 10385-10402 (1989)
   PUBMED   2574852
REFERENCE   9  (bases 1 to 2042)
  AUTHORS   Giampaolo,A., Acampora,D., Zappavigna,V., Pannese,M.,
            D'Esposito,M., Care,A., Faiella,A., Stornaiuolo,A., Russo,G.,
            Simeone,A. et al.
  TITLE     Differential expression of human HOX-2 genes along the
            anterior-posterior axis in embryonic central nervous system
  JOURNAL   Differentiation 40 (3), 191-197 (1989)
   PUBMED   2570724
REFERENCE   10 (bases 1 to 2042)
  AUTHORS   Boncinelli,E., Acampora,D., Pannese,M., D'Esposito,M., Somma,R.,
            Gaudino,G., Stornaiuolo,A., Cafiero,M., Faiella,A. and Simeone,A.
  TITLE     Organization of human class I homeobox genes
  JOURNAL   Genome 31 (2), 745-756 (1989)
   PUBMED   2576652
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC049204.1, AC103702.3 and
            AL137449.1.
            On Jan 19, 2006 this sequence version replaced gi:45580720.
            
            Summary: This gene is a member of the Antp homeobox family and
            encodes a nuclear protein with a homeobox DNA-binding domain. It is
            included in a cluster of homeobox B genes located on chromosome 17.
            The encoded protein functions as a sequence-specific transcription
            factor that is involved in development. Intracellular or ectopic
            expression of this protein expands hematopoietic stem and
            progenitor cells in vivo and in vitro, making it a potential
            candidate for therapeutic stem cell expansion. [provided by RefSeq,
            Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC049204.1, AL560836.3 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025083 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1569              BC049204.1         1-1569
            1570-1571           AC103702.3         113529-113530
            1572-2027           BC049204.1         1572-2027
            2028-2042           AL137449.1         1951-1965
FEATURES             Location/Qualifiers
     source          1..2042
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q21.32"
     gene            1..2042
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /note="homeobox B4"
                     /db_xref="GeneID:3214"
                     /db_xref="HGNC:5115"
                     /db_xref="HPRD:07032"
                     /db_xref="MIM:142965"
     exon            1..519
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    24..26
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /note="upstream in-frame stop codon"
     CDS             63..818
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /note="homeo box B4; homeo box 2F; homeobox protein
                     Hox-2F; homeobox protein Hox-2.6"
                     /codon_start=1
                     /product="homeobox protein Hox-B4"
                     /protein_id="NP_076920.1"
                     /db_xref="GI:13273315"
                     /db_xref="CCDS:CCDS11529.1"
                     /db_xref="GeneID:3214"
                     /db_xref="HGNC:5115"
                     /db_xref="HPRD:07032"
                     /db_xref="MIM:142965"
                     /translation="
MAMSSFLINSNYVDPKFPPCEEYSQSDYLPSDHSPGYYAGGQRRESSFQPEAGFGRRAACTVQRYAACRDPGPPPPPPPPPPPPPPPGLSPRAPAPPPAGALLPEPGQRCEAVSSSPPPPPCAQNPLHPSPSHSACKEPVVYPWMRKVHVSTVNPNYAGGEPKRSRTAYTRQQVLELEKEFHYNRYLTRRRRVEIAHALCLSERQIKIWFQNRRMKWKKDHKLPNTKIRSGGAAGSAGGPPGRPNGGPRAL
"
     misc_feature    483..500
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P17483.2);
                     Region: Antp-type hexapeptide"
     misc_feature    549..725
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(549..563,567..569,618..620,636..638,675..677,
                     681..686,693..698,702..710,714..719)
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(555..557,564..566,684..686,693..698,705..707)
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     STS             88..211
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /standard_name="Hoxb4"
                     /db_xref="UniSTS:536651"
     exon            520..2033
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /inference="alignment:Splign:1.39.8"
     variation       903
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2740755"
     variation       1030..1031
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:3833172"
     polyA_signal    2005..2010
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
     polyA_site      2032
                     /gene="HOXB4"
                     /gene_synonym="HOX-2.6; HOX2; HOX2F"
ORIGIN      
ggaaaacgagtcaggggtcggaataaattttagtatattttgtgggcaattcccagaaattaatggctatgagttcttttttgatcaactcaaactatgtcgaccccaagttccctccatgcgaggaatattcacagagcgattacctacccagcgaccactcgcccgggtactacgccggcggccagaggcgagagagcagcttccagccggaggcgggcttcgggcggcgcgcggcgtgcaccgtgcagcgctacgcggcctgccgggaccctgggcccccgccgcctccgccaccacccccgccgcccccgccaccgcccggtctgtcccctcgggctcctgcgccgccacccgccggggccctcctcccggagcccggccagcgctgcgaggcggtcagcagcagccccccgccgcctccctgcgcccagaaccccctgcaccccagcccgtcccactccgcgtgcaaagagcccgtcgtctacccctggatgcgcaaagttcacgtgagcacggtaaaccccaattacgccggcggggagcccaagcgctctcggaccgcctacacgcgccagcaggtcttggagctggagaaggaatttcactacaaccgctacctgacacggcgccggagggtggagatcgcccacgcgctctgcctctccgagcgccagatcaagatctggttccagaaccggcgcatgaagtggaaaaaagaccacaagttgcccaacaccaagatccgctcgggtggtgcggcaggctcagccggagggccccctggccggcccaatggaggcccccgcgcgctctagtgcccccgcacgcgggagccacgaacctcggggtgggggtgggcagtgagtgcaggggatggggtggggggacaggagggggccctggggcctgggccccggaaaaatctatctgccctcccccacactttatatacgaataaacgcagaagagggggaggggaagctttatttatagaaatgacaatagagggccacggggaggcccccccagaagcaagattcaaatctcttgctttctttcttaaaaaaaagaaaaagaaaaagcaagaagaaggaagaaagaaaaagacagaaagagaaataggaggaggctgcagctcctcgttttcagctttggcgaagatggatccacgtttcatctttaatcacgccaggtccaggcccatctgtcttgtttcctctgccgaggagaagacgggcctcggtggcgaccattacctcgacacccgctaacaaatgaggcccggctcggccgcctccgcctctgctactgccgctgctggaagacagcctggatttcctttctttgtcccccactcccgatacccagcgaaagcaccctctgactgccagatagtgcagtgttttggtcacggtaacacacacacactctccctcatctttcgtgcccattcactgagggccagaatgactgctcacccacttccaccgtggggttgggggtgggcaacagaggaggggagcaagtagggaagggggtggccttgacaactcaggagtgagcaggaaaattgagtccaaggaaaaagagagactcagagacccgggagggccttcctctgaaaggccaagccaagccatgcttggcagggtgaggggccagttgagttctgggagctgggcactactctgccagtccagagttgtacagcagaagcctctctcctagactgaaaatgaatgtgaaactaggaaataaaatgtgcccctcccagtctgggaggaggatgttgcagagccctctcccatagtttattatgttgcatcgtttattattattattgataatattattattactatttttttgtgtcatgtgagtcctctctccttttctctttctgacattccaaaaccaggccccttcctacctctggggctgcttgagtctagaacccttcgtatgtgtgaatatctgtgtgctgtacagagtgacaatagaaataaatgtttggtttcttgtgaccagcaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3214 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: NAS
            GeneID:3214 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:3214 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:3214 -> Biological process: GO:0002011 [morphogenesis of an epithelial sheet] evidence: IEA
            GeneID:3214 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:3214 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS
            GeneID:3214 -> Biological process: GO:0007275 [multicellular organismal development] evidence: NAS
            GeneID:3214 -> Biological process: GO:0008283 [cell proliferation] evidence: IEA
            GeneID:3214 -> Biological process: GO:0009952 [anterior/posterior pattern specification] evidence: IEA
            GeneID:3214 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:3214 -> Biological process: GO:0048103 [somatic stem cell division] evidence: IEA
            GeneID:3214 -> Biological process: GO:0048536 [spleen development] evidence: IEA
            GeneID:3214 -> Biological process: GO:0048539 [bone marrow development] evidence: IEA
            GeneID:3214 -> Biological process: GO:0048704 [embryonic skeletal system morphogenesis] evidence: IEA
            GeneID:3214 -> Biological process: GO:0060216 [definitive hemopoiesis] evidence: IEA
            GeneID:3214 -> Biological process: GO:0060218 [hematopoietic stem cell differentiation] evidence: IDA
            GeneID:3214 -> Biological process: GO:2000738 [positive regulation of stem cell differentiation] evidence: IDA
            GeneID:3214 -> Cellular component: GO:0005634 [nucleus] evidence: NAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.