2024-03-28 19:21:08, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_024015 2042 bp mRNA linear PRI 12-MAY-2013 DEFINITION Homo sapiens homeobox B4 (HOXB4), mRNA. ACCESSION NM_024015 VERSION NM_024015.4 GI:85376187 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2042) AUTHORS Wen-jun,L., qu-lian,G., Hong-ying,C., Yan,Z. and Mei-Xian,H. TITLE Studies on HOXB4 expression during differentiation of human cytomegalovirus-infected hematopoietic stem cells into lymphocyte and erythrocyte progenitor cells JOURNAL Cell Biochem. Biophys. 63 (2), 133-141 (2012) PUBMED 22402911 REMARK GeneRIF: cytomegalovirus infection markedly down-regulated HOXB4 expression which affected proliferation and differentiation of erythroid and lymphocyte progenitor cells. REFERENCE 2 (bases 1 to 2042) AUTHORS Fan,R., Bonde,S., Gao,P., Sotomayor,B., Chen,C., Mouw,T., Zavazava,N. and Tan,K. TITLE Dynamic HoxB4-regulatory network during embryonic stem cell differentiation to hematopoietic cells JOURNAL Blood 119 (19), E139-E147 (2012) PUBMED 22438249 REMARK GeneRIF: Down-regulation of mitochondria and lysosomal genes by HoxB4 plays a role in the impaired lymphoid lineage development from embryonic stem cells-derived hematopoietic stem cells. REFERENCE 3 (bases 1 to 2042) AUTHORS Umeda,S., Yamamoto,K., Murayama,T., Hidaka,M., Kurata,M., Ohshima,T., Suzuki,S., Sugawara,E., Kawano,F. and Kitagawa,M. TITLE Prognostic significance of HOXB4 in de novo acute myeloid leukemia JOURNAL Hematology 17 (3), 125-131 (2012) PUBMED 22664110 REMARK GeneRIF: HOXB4-positivity as an independent predictor of overall survival of acute myeloid leukemia patients REFERENCE 4 (bases 1 to 2042) AUTHORS Fujiwara,T., Yokoyama,H., Okitsu,Y., Kamata,M., Fukuhara,N., Onishi,Y., Fujimaki,S., Takahashi,S., Ishizawa,K., Bresnick,E.H. and Harigae,H. TITLE Gene expression profiling identifies HOXB4 as a direct downstream target of GATA-2 in human CD34+ hematopoietic cells JOURNAL PLoS ONE 7 (9), E40959 (2012) PUBMED 23028422 REMARK GeneRIF: GATA-2 directly regulates HOXB4 expression in hematopoietic stem cells, which may play an important role in the development and/or progression of aplastic anemia. REFERENCE 5 (bases 1 to 2042) AUTHORS Larbi,A., Gombert,J.M., Auvray,C., l'Homme,B., Magniez,A., Feraud,O., Coulombel,L., Chapel,A., Mitjavila-Garcia,M.T., Turhan,A.G., Haddad,R. and Bennaceur-Griscelli,A. TITLE The HOXB4 homeoprotein promotes the ex vivo enrichment of functional human embryonic stem cell-derived NK cells JOURNAL PLoS ONE 7 (6), E39514 (2012) PUBMED 22761810 REMARK GeneRIF: our results outline the effects of HOXB4 in combination with stromal cells in the development of NK cells from embryonic stem cells. REFERENCE 6 (bases 1 to 2042) AUTHORS Petrini,M., Quaranta,M.T., Testa,U., Samoggia,P., Tritarelli,E., Care,A., Cianetti,L., Valtieri,M., Barletta,C. and Peschle,C. TITLE Expression of selected human HOX-2 genes in B/T acute lymphoid leukemia and interleukin-2/interleukin-1 beta-stimulated natural killer lymphocytes JOURNAL Blood 80 (1), 185-193 (1992) PUBMED 1351762 REFERENCE 7 (bases 1 to 2042) AUTHORS Peverali,F.A., D'Esposito,M., Acampora,D., Bunone,G., Negri,M., Faiella,A., Stornaiuolo,A., Pannese,M., Migliaccio,E., Simeone,A. et al. TITLE Expression of HOX homeogenes in human neuroblastoma cell culture lines JOURNAL Differentiation 45 (1), 61-69 (1990) PUBMED 1981366 REFERENCE 8 (bases 1 to 2042) AUTHORS Acampora,D., D'Esposito,M., Faiella,A., Pannese,M., Migliaccio,E., Morelli,F., Stornaiuolo,A., Nigro,V., Simeone,A. and Boncinelli,E. TITLE The human HOX gene family JOURNAL Nucleic Acids Res. 17 (24), 10385-10402 (1989) PUBMED 2574852 REFERENCE 9 (bases 1 to 2042) AUTHORS Giampaolo,A., Acampora,D., Zappavigna,V., Pannese,M., D'Esposito,M., Care,A., Faiella,A., Stornaiuolo,A., Russo,G., Simeone,A. et al. TITLE Differential expression of human HOX-2 genes along the anterior-posterior axis in embryonic central nervous system JOURNAL Differentiation 40 (3), 191-197 (1989) PUBMED 2570724 REFERENCE 10 (bases 1 to 2042) AUTHORS Boncinelli,E., Acampora,D., Pannese,M., D'Esposito,M., Somma,R., Gaudino,G., Stornaiuolo,A., Cafiero,M., Faiella,A. and Simeone,A. TITLE Organization of human class I homeobox genes JOURNAL Genome 31 (2), 745-756 (1989) PUBMED 2576652 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC049204.1, AC103702.3 and AL137449.1. On Jan 19, 2006 this sequence version replaced gi:45580720. Summary: This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Intracellular or ectopic expression of this protein expands hematopoietic stem and progenitor cells in vivo and in vitro, making it a potential candidate for therapeutic stem cell expansion. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC049204.1, AL560836.3 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025083 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1569 BC049204.1 1-1569 1570-1571 AC103702.3 113529-113530 1572-2027 BC049204.1 1572-2027 2028-2042 AL137449.1 1951-1965 FEATURES Location/Qualifiers source 1..2042 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="17" /map="17q21.32" gene 1..2042 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /note="homeobox B4" /db_xref="GeneID:3214" /db_xref="HGNC:5115" /db_xref="HPRD:07032" /db_xref="MIM:142965" exon 1..519 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /inference="alignment:Splign:1.39.8" misc_feature 24..26 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /note="upstream in-frame stop codon" CDS 63..818 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /note="homeo box B4; homeo box 2F; homeobox protein Hox-2F; homeobox protein Hox-2.6" /codon_start=1 /product="homeobox protein Hox-B4" /protein_id="NP_076920.1" /db_xref="GI:13273315" /db_xref="CCDS:CCDS11529.1" /db_xref="GeneID:3214" /db_xref="HGNC:5115" /db_xref="HPRD:07032" /db_xref="MIM:142965" /translation="
MAMSSFLINSNYVDPKFPPCEEYSQSDYLPSDHSPGYYAGGQRRESSFQPEAGFGRRAACTVQRYAACRDPGPPPPPPPPPPPPPPPGLSPRAPAPPPAGALLPEPGQRCEAVSSSPPPPPCAQNPLHPSPSHSACKEPVVYPWMRKVHVSTVNPNYAGGEPKRSRTAYTRQQVLELEKEFHYNRYLTRRRRVEIAHALCLSERQIKIWFQNRRMKWKKDHKLPNTKIRSGGAAGSAGGPPGRPNGGPRAL
" misc_feature 483..500 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P17483.2); Region: Antp-type hexapeptide" misc_feature 549..725 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(549..563,567..569,618..620,636..638,675..677, 681..686,693..698,702..710,714..719) /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(555..557,564..566,684..686,693..698,705..707) /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" STS 88..211 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /standard_name="Hoxb4" /db_xref="UniSTS:536651" exon 520..2033 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /inference="alignment:Splign:1.39.8" variation 903 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /replace="c" /replace="t" /db_xref="dbSNP:2740755" variation 1030..1031 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" /replace="" /replace="c" /db_xref="dbSNP:3833172" polyA_signal 2005..2010 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" polyA_site 2032 /gene="HOXB4" /gene_synonym="HOX-2.6; HOX2; HOX2F" ORIGIN
ggaaaacgagtcaggggtcggaataaattttagtatattttgtgggcaattcccagaaattaatggctatgagttcttttttgatcaactcaaactatgtcgaccccaagttccctccatgcgaggaatattcacagagcgattacctacccagcgaccactcgcccgggtactacgccggcggccagaggcgagagagcagcttccagccggaggcgggcttcgggcggcgcgcggcgtgcaccgtgcagcgctacgcggcctgccgggaccctgggcccccgccgcctccgccaccacccccgccgcccccgccaccgcccggtctgtcccctcgggctcctgcgccgccacccgccggggccctcctcccggagcccggccagcgctgcgaggcggtcagcagcagccccccgccgcctccctgcgcccagaaccccctgcaccccagcccgtcccactccgcgtgcaaagagcccgtcgtctacccctggatgcgcaaagttcacgtgagcacggtaaaccccaattacgccggcggggagcccaagcgctctcggaccgcctacacgcgccagcaggtcttggagctggagaaggaatttcactacaaccgctacctgacacggcgccggagggtggagatcgcccacgcgctctgcctctccgagcgccagatcaagatctggttccagaaccggcgcatgaagtggaaaaaagaccacaagttgcccaacaccaagatccgctcgggtggtgcggcaggctcagccggagggccccctggccggcccaatggaggcccccgcgcgctctagtgcccccgcacgcgggagccacgaacctcggggtgggggtgggcagtgagtgcaggggatggggtggggggacaggagggggccctggggcctgggccccggaaaaatctatctgccctcccccacactttatatacgaataaacgcagaagagggggaggggaagctttatttatagaaatgacaatagagggccacggggaggcccccccagaagcaagattcaaatctcttgctttctttcttaaaaaaaagaaaaagaaaaagcaagaagaaggaagaaagaaaaagacagaaagagaaataggaggaggctgcagctcctcgttttcagctttggcgaagatggatccacgtttcatctttaatcacgccaggtccaggcccatctgtcttgtttcctctgccgaggagaagacgggcctcggtggcgaccattacctcgacacccgctaacaaatgaggcccggctcggccgcctccgcctctgctactgccgctgctggaagacagcctggatttcctttctttgtcccccactcccgatacccagcgaaagcaccctctgactgccagatagtgcagtgttttggtcacggtaacacacacacactctccctcatctttcgtgcccattcactgagggccagaatgactgctcacccacttccaccgtggggttgggggtgggcaacagaggaggggagcaagtagggaagggggtggccttgacaactcaggagtgagcaggaaaattgagtccaaggaaaaagagagactcagagacccgggagggccttcctctgaaaggccaagccaagccatgcttggcagggtgaggggccagttgagttctgggagctgggcactactctgccagtccagagttgtacagcagaagcctctctcctagactgaaaatgaatgtgaaactaggaaataaaatgtgcccctcccagtctgggaggaggatgttgcagagccctctcccatagtttattatgttgcatcgtttattattattattgataatattattattactatttttttgtgtcatgtgagtcctctctccttttctctttctgacattccaaaaccaggccccttcctacctctggggctgcttgagtctagaacccttcgtatgtgtgaatatctgtgtgctgtacagagtgacaatagaaataaatgtttggtttcttgtgaccagcaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:3214 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: NAS GeneID:3214 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:3214 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:3214 -> Biological process: GO:0002011 [morphogenesis of an epithelial sheet] evidence: IEA GeneID:3214 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:3214 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS GeneID:3214 -> Biological process: GO:0007275 [multicellular organismal development] evidence: NAS GeneID:3214 -> Biological process: GO:0008283 [cell proliferation] evidence: IEA GeneID:3214 -> Biological process: GO:0009952 [anterior/posterior pattern specification] evidence: IEA GeneID:3214 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA GeneID:3214 -> Biological process: GO:0048103 [somatic stem cell division] evidence: IEA GeneID:3214 -> Biological process: GO:0048536 [spleen development] evidence: IEA GeneID:3214 -> Biological process: GO:0048539 [bone marrow development] evidence: IEA GeneID:3214 -> Biological process: GO:0048704 [embryonic skeletal system morphogenesis] evidence: IEA GeneID:3214 -> Biological process: GO:0060216 [definitive hemopoiesis] evidence: IEA GeneID:3214 -> Biological process: GO:0060218 [hematopoietic stem cell differentiation] evidence: IDA GeneID:3214 -> Biological process: GO:2000738 [positive regulation of stem cell differentiation] evidence: IDA GeneID:3214 -> Cellular component: GO:0005634 [nucleus] evidence: NAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.