2024-04-25 14:53:08, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_022716 3999 bp mRNA linear PRI 29-APR-2013 DEFINITION Homo sapiens paired related homeobox 1 (PRRX1), transcript variant pmx-1b, mRNA. ACCESSION NM_022716 VERSION NM_022716.2 GI:56699460 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3999) AUTHORS Ocana,O.H., Corcoles,R., Fabra,A., Moreno-Bueno,G., Acloque,H., Vega,S., Barrallo-Gimeno,A., Cano,A. and Nieto,M.A. TITLE Metastatic colonization requires the repression of the epithelial-mesenchymal transition inducer Prrx1 JOURNAL Cancer Cell 22 (6), 709-724 (2012) PUBMED 23201163 REMARK GeneRIF: The homeobox factor Prrx1 is an EMT inducer conferring migratory and invasive properties. GeneRIF: We show that the homeobox factor Prrx1 is an EMT inducer conferring migratory and invasive properties. The loss of Prrx1 is required for cancer cells to metastasize in vivo, which revert to the epithelial phenotype concomitant with the acquisition of stem cell properties. REFERENCE 2 (bases 1 to 3999) AUTHORS Turner,S.T., Bailey,K.R., Schwartz,G.L., Chapman,A.B., Chai,H.S. and Boerwinkle,E. TITLE Genomic association analysis identifies multiple loci influencing antihypertensive response to an angiotensin II receptor blocker JOURNAL Hypertension 59 (6), 1204-1211 (2012) PUBMED 22566498 REFERENCE 3 (bases 1 to 3999) AUTHORS Ellinor,P.T., Lunetta,K.L., Albert,C.M., Glazer,N.L., Ritchie,M.D., Smith,A.V., Arking,D.E., Muller-Nurasyid,M., Krijthe,B.P., Lubitz,S.A., Bis,J.C., Chung,M.K., Dorr,M., Ozaki,K., Roberts,J.D., Smith,J.G., Pfeufer,A., Sinner,M.F., Lohman,K., Ding,J., Smith,N.L., Smith,J.D., Rienstra,M., Rice,K.M., Van Wagoner,D.R., Magnani,J.W., Wakili,R., Clauss,S., Rotter,J.I., Steinbeck,G., Launer,L.J., Davies,R.W., Borkovich,M., Harris,T.B., Lin,H., Volker,U., Volzke,H., Milan,D.J., Hofman,A., Boerwinkle,E., Chen,L.Y., Soliman,E.Z., Voight,B.F., Li,G., Chakravarti,A., Kubo,M., Tedrow,U.B., Rose,L.M., Ridker,P.M., Conen,D., Tsunoda,T., Furukawa,T., Sotoodehnia,N., Xu,S., Kamatani,N., Levy,D., Nakamura,Y., Parvez,B., Mahida,S., Furie,K.L., Rosand,J., Muhammad,R., Psaty,B.M., Meitinger,T., Perz,S., Wichmann,H.E., Witteman,J.C., Kao,W.H., Kathiresan,S., Roden,D.M., Uitterlinden,A.G., Rivadeneira,F., McKnight,B., Sjogren,M., Newman,A.B., Liu,Y., Gollob,M.H., Melander,O., Tanaka,T., Stricker,B.H., Felix,S.B., Alonso,A., Darbar,D., Barnard,J., Chasman,D.I., Heckbert,S.R., Benjamin,E.J., Gudnason,V. and Kaab,S. TITLE Meta-analysis identifies six new susceptibility loci for atrial fibrillation JOURNAL Nat. Genet. 44 (6), 670-675 (2012) PUBMED 22544366 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 3999) AUTHORS Herman,S., Delio,M., Morrow,B. and Samanich,J. TITLE Agnathia-otocephaly complex: a case report and examination of the OTX2 and PRRX1 genes JOURNAL Gene 494 (1), 124-129 (2012) PUBMED 22198066 REMARK GeneRIF: Mutation analysis was performed after sequencing the entire coding regions of OTX2 and PRRX1 genes isolated from the proband and his parents. After thorough analysis, no DNA variations were detected. REFERENCE 5 (bases 1 to 3999) AUTHORS Liborio,T.N., Acquafreda,T., Matizonkas-Antonio,L.F., Silva-Valenzuela,M.G., Ferraz,A.R. and Nunes,F.D. TITLE In situ hybridization detection of homeobox genes reveals distinct expression patterns in oral squamous cell carcinomas JOURNAL Histopathology 58 (2), 225-233 (2011) PUBMED 21323949 REMARK GeneRIF: HOXA7, PIXT1 and PRRX1 homeobox genes have different patterns of expression in oral squamous cell carcinomas depending on its histological features. REFERENCE 6 (bases 1 to 3999) AUTHORS Kataoka,K., Yoshitomo-Nakagawa,K., Shioda,S. and Nishizawa,M. TITLE A set of Hox proteins interact with the Maf oncoprotein to inhibit its DNA binding, transactivation, and transforming activities JOURNAL J. Biol. Chem. 276 (1), 819-826 (2001) PUBMED 11036080 REFERENCE 7 (bases 1 to 3999) AUTHORS Nakamura,T., Yamazaki,Y., Hatano,Y. and Miura,I. TITLE NUP98 is fused to PMX1 homeobox gene in human acute myelogenous leukemia with chromosome translocation t(1;11)(q23;p15) JOURNAL Blood 94 (2), 741-747 (1999) PUBMED 10397741 REFERENCE 8 (bases 1 to 3999) AUTHORS Grueneberg,D.A., Henry,R.W., Brauer,A., Novina,C.D., Cheriyath,V., Roy,A.L. and Gilman,M. TITLE A multifunctional DNA-binding protein that promotes the formation of serum response factor/homeodomain complexes: identity to TFII-I JOURNAL Genes Dev. 11 (19), 2482-2493 (1997) PUBMED 9334314 REFERENCE 9 (bases 1 to 3999) AUTHORS Grueneberg,D.A., Simon,K.J., Brennan,K. and Gilman,M. TITLE Sequence-specific targeting of nuclear signal transduction pathways by homeodomain proteins JOURNAL Mol. Cell. Biol. 15 (6), 3318-3326 (1995) PUBMED 7760827 REFERENCE 10 (bases 1 to 3999) AUTHORS Grueneberg,D.A., Natesan,S., Alexandre,C. and Gilman,M.Z. TITLE Human and Drosophila homeodomain proteins that enhance the DNA-binding activity of serum response factor JOURNAL Science 257 (5073), 1089-1095 (1992) PUBMED 1509260 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC074993.2, AV750422.1 and Z97200.1. On Dec 17, 2004 this sequence version replaced gi:12707576. Summary: The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription co-activator, enhancing the DNA-binding activity of serum response factor, a protein required for the induction of genes by growth and differentiation factors. The protein regulates muscle creatine kinase, indicating a role in the establishment of diverse mesodermal muscle types. Alternative splicing yields two isoforms that differ in abundance and expression patterns. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (pmx-1b) encodes the longer isoform (pmx-1b). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC074993.2, CN410183.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025083 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-26 BC074993.2 1-26 27-28 AV750422.1 329-330 29-829 BC074993.2 29-829 830-3999 Z97200.1 40484-43653 c FEATURES Location/Qualifiers source 1..3999 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1q24" gene 1..3999 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /note="paired related homeobox 1" /db_xref="GeneID:5396" /db_xref="HGNC:9142" /db_xref="HPRD:01337" /db_xref="MIM:167420" STS 1..829 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /db_xref="UniSTS:482178" exon 1..288 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /inference="alignment:Splign:1.39.8" variation 10 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:77911930" variation 19 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="g" /replace="t" /db_xref="dbSNP:375142985" variation 26 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:368044377" variation 35 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="g" /db_xref="dbSNP:79715821" CDS 48..785 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /note="isoform pmx-1b is encoded by transcript variant pmx-1b; homeobox protein PHOX1; paired mesoderm homeo box 1; paired mesoderm homeobox protein 1; paired mesoderm homeobox 1 isoform pmx-1b; paired-related homeobox protein 1" /codon_start=1 /product="paired mesoderm homeobox protein 1 isoform pmx-1b" /protein_id="NP_073207.1" /db_xref="GI:12707577" /db_xref="CCDS:CCDS1290.1" /db_xref="GeneID:5396" /db_xref="HGNC:9142" /db_xref="HPRD:01337" /db_xref="MIM:167420" /translation="
MTSSYGHVLERQPALGGRLDSPGNLDTLQAKKNFSVSHLLDLEEAGDMVAAQADENVGEAGRSLLESPGLTSGSDTPQQDNDQLNSEEKKKRKQRRNRTTFNSSQLQALERVFERTHYPDAFVREDLARRVNLTEARVQVWFQNRRAKFRRNERAMLANKNASLLKSYSGDVTAVEQPIVPRPAPRPTDYLSWGTASPYSAMATYSATCANNSPAQGINMANSIANLRLKAKEYSLQRNQVPTVN
" misc_feature 342..506 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(342..344,348..350,399..401,417..419,456..458, 462..467,474..479,483..491,495..500) /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(345..347,465..467,474..479,486..488) /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 702..755 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /note="OAR domain; Region: OAR; pfam03826" /db_xref="CDD:146451" misc_feature 711..752 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P54821.2); Region: OAR" variation 62 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:138970767" variation 83 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:377126967" variation 85 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:200885791" variation 96 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:370044964" variation 122 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:199691593" STS 138..785 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /standard_name="Prrx1" /db_xref="UniSTS:525268" variation 151 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="g" /db_xref="dbSNP:373448980" variation 197 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="g" /db_xref="dbSNP:376351453" variation 215 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:370202431" variation 232 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:74674242" variation 253 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:201153811" variation 257 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:372174969" variation 284 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:200693185" exon 289..464 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /inference="alignment:Splign:1.39.8" variation 290 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:370699898" variation 316 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:79567938" variation 322 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="g" /replace="t" /db_xref="dbSNP:147354859" variation 326 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="g" /replace="t" /db_xref="dbSNP:374406599" variation 353 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:34501887" variation 357 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:75715275" variation 385 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:387906667" variation 401 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:200583557" variation 455 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="g" /db_xref="dbSNP:377339646" exon 465..646 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /inference="alignment:Splign:1.39.8" variation 513 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:147184063" variation 519 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:149731143" variation 550 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:201661471" variation 560 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:374262561" variation 570 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:201365132" variation 612 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:372098442" exon 647..3999 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /inference="alignment:Splign:1.39.8" variation 647 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:151333816" variation 661 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:368848007" variation 681 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:373373102" variation 687 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:140550541" STS 717..993 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /standard_name="G15917" /db_xref="UniSTS:21147" variation 771 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:201359953" variation 796 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:139568481" variation 808 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:371029463" variation 821 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:200135594" variation 878 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="t" /db_xref="dbSNP:6663373" variation 955 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:375871578" variation 1076 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:6666030" variation 1143..1144 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="tata" /db_xref="dbSNP:10644708" variation 1144..1153 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="tatatatata" /db_xref="dbSNP:142852183" variation 1144..1149 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="tatata" /db_xref="dbSNP:112340262" variation 1144..1145 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="tata" /db_xref="dbSNP:66515062" variation 1154..1159 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="tatata" /db_xref="dbSNP:72198615" variation 1155..1160 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="atatat" /db_xref="dbSNP:66518766" variation 1161..1170 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="atatatatat" /db_xref="dbSNP:67734884" variation 1162..1163 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="tata" /db_xref="dbSNP:71790118" variation 1165..1170 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="atatat" /db_xref="dbSNP:61148079" variation 1212 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:180995287" variation 1357..1358 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="t" /db_xref="dbSNP:58473244" variation 1550 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:144145873" variation 1813 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:369414337" variation 1814 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="g" /db_xref="dbSNP:41272503" STS 1816..2571 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /standard_name="PRRX1_2266" /db_xref="UniSTS:280930" variation 1905 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:151019671" variation 2011 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:186075523" variation 2045 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:376968825" variation 2070 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:140894020" variation 2093 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="g" /replace="t" /db_xref="dbSNP:188229975" variation 2097 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:73036701" variation 2125 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:370208404" variation 2139..2140 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="g" /db_xref="dbSNP:35591271" variation 2156 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="g" /db_xref="dbSNP:181413858" variation 2260 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:149709697" variation 2261 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:377218637" variation 2368 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:185691611" variation 2615 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="g" /replace="t" /db_xref="dbSNP:190652230" variation 2645 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:3203926" variation 2668 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:145568344" variation 2701 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="t" /db_xref="dbSNP:74123171" variation 2706 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:2227207" variation 2737 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:76427450" variation 2749 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:182885405" variation 2888..2889 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="g" /db_xref="dbSNP:34160248" variation 2891 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:2213750" variation 2967 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:41272505" variation 2997 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:11552914" variation 2998 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:187465183" variation 3021 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:141178877" variation 3048 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:115848619" variation 3051 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="g" /replace="t" /db_xref="dbSNP:34963551" variation 3133 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:3820416" variation 3135 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:183965225" variation 3293 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:187706632" variation 3479 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:146969525" variation 3565 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:114604454" variation 3661 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:115492463" variation 3723 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:112446424" variation 3734 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:143805931" variation 3804 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:191237385" STS 3855..3968 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /standard_name="G31141" /db_xref="UniSTS:18405" variation 3907 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="c" /replace="t" /db_xref="dbSNP:182690267" variation 3971 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="c" /db_xref="dbSNP:148159513" polyA_signal 3977..3982 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" variation 3987..3989 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="" /replace="aag" /db_xref="dbSNP:373284840" variation 3989 /gene="PRRX1" /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1" /replace="a" /replace="g" /db_xref="dbSNP:3177154" ORIGIN
tgattcgagcgggaagaggggggtgggtgggatcggtgggggagaccatgacctccagctacgggcacgttctggagcggcaaccggcgctgggcggccgcttggacagcccgggcaacctcgacaccctgcaggcgaaaaagaacttctccgtcagtcacctgctagacctggaggaagccggggacatggtggcggcacaggcggatgagaacgtgggcgaggctggccggagcctgctggagtcgccgggactcaccagcggcagcgacaccccgcagcaggacaatgaccagctgaactcagaagaaaaaaagaagagaaagcagcgaaggaataggacaaccttcaatagcagccagctgcaggctttggagcgtgtctttgagcggacacactatcctgatgcttttgtgcgagaagaccttgcccgccgggtgaacctcaccgaggcgagagtgcaggtgtggtttcagaaccgaagagccaagttccgcaggaatgagagagccatgctagccaataaaaacgcttccctcctcaaatcctactcaggagacgtgactgctgtggagcagcccatcgtacctcgtcctgctccgagacccaccgattatctctcctgggggacagcgtctccgtacagcgccatggctacttattctgccacatgtgccaacaatagccctgcacagggcatcaacatggccaacagcattgccaacctgagactgaaggccaaggaatatagtttacagaggaaccaggtgccaacagtcaactgaggaaaaaaaataattaaacaggcctaagaagaaatcaaaaaccataagacacctatcctgctctgttatttcttcatctgctggggggaaaaagtaaattacaaacaaacaaacaaagcagaactaaaatattgggaccatggcagagaaaagcaggagaggagcaaaatgaaaattagttaacaaatgttcctcctccctctgggataccaccaccacttgtttctgtgtgtgtttattttgtttttctttcattcatgctttgcttaatgtactccaggcttcttcagataggttcagcccacccacccccatgattgtatgaagttttaaaaaaaactacagcagccaaagaaactatatatatatatatatatatatatatccagaatgattgcctctactgtcctcattgacttgtttgaaccttagtgccttaccctgtcctcttcccagttctctttatagaagctctaggagctttcgaaaagccaaagtctttctgaagaatctgtgctggacagacataattccctttctcattgtctccatctttgttggtcatggtaaggtttttccatcagcctctgaaaaaatagttgtgcacaacatctgctcactggactgtctgatccaatgtaattggctgcgtctggctaattctaagcactaaagtctacatctaagctatagatttaagcttgaagctacagattatatcactatcaccaccacccctcaccctatgcaatcaatcaatcaatcatcttaagttaaagatatttgttgtctttgaatgatttgctgtcacagactatttggtagaagaaatatttttcacctgagagaggaagagaaatttctctagtaacacaaagagtgagttctaaaaggcatgcccacatctctttcgtgccttaaggatagtgagatgcacacttatatatatactgtatatatttatatatttatatatatatttcatatatatatataatattgcaagcttaagtttgcaatttcccaaacaatacaaaaagcaaattacacaccctcaccactgttcttatctctatagtgatgaaacattaattagggatcttgctgcttttctttttctacacgaagttttcattaaagccacagaataattgatagggcagctgtttgagaacaggtcccattttcacattagggctttaaatgaattagaaactatttgaggctataaaaatgtccttgagtttggagcctgagctctggtgaaatgctgatacatctgatctatcatgggaattgcagttagagagagtaaggaataccatttagtcatctatccgttcttcacttagcaggaatatgaaagaaaggcacatgtttaagaggaatacctaaaggtttttctaaattccaacatttaaaaggcaattgtgggctatttttattttttaatattttgaaataaagtttagtgtctagggctgggagccaggactgatcttccatttctttttctttgttcccagccatgcttttgtaacttgccaggtggacttgaccaactacattaccatgctgtgcctcagtttacccatttgtaaaatgggattaataatacttacctacctcacaggggtgttgtgaggctctattcatttgctcctttattctttcctgtattctctgtatgtccagcactttgtagccatgggaggaaagggactataaaagtgtacaatgttaatggaatgatacggtacctgaaagccttgttttctagtaagaaaatgctaccttgctgtacatacttataaccttgtatttggaaatgagaaataggtttatattttcagatctctcaaaaatcacatcatttgaccaaagaataatttaagacacatagaacagatttttttaatttatattttcatcctgaccagcttagttctaataatttttagttgtgagtgattaaaaaactttggatcaattttggtcaaacatgccaactttgtagtctgagtgacaggcaaggatttttgggtttaagatgcacttttagcacacatttgtatttcccttggcatatcagattgagctaatggtgatgttatttcaatctaacagccaccaatctgaaattgtatttcaaatgttgattctgtagttctttaaataataatgaagctcatcttatacattttgctttcaccaattgattccttcttcttttagcccactattaaaacatttcttactgaatggttcatgtaggcttgctgaacagcacgcattacttgcttcctgaagagttcccccattcatccatttgtcccattagttgctgtggattatcaagttttgaaggaactgtacatcccaacagactgaaacattctaagtgaaatgagtataatccaagtaactggtgaactttggaggtttggagcttgaagagaatggctaagaagatttgaattatagggagggaacagaaatcatacatgaaaaggttttactgagaaggggaaaaccttagatagagggacatgtgaaacaaaatcatttgaaattttgattcagacatccatttccagtggcaaacagcaaagcctgaacccataaacccaaatgataggtgaagttgggtggttttatccaatgtctcaagcaagcaatgtctgggaatatcatagagtaacaagtgctggtcagccaaagaaacattcactgctggtgaaccaataccataagcatgtattatctaagcacttgatcaagaaatatacatgttgtacaagctctcaattttgttcatttattatcaaatttttaaaatacaagtttggtatgtgatttggaaaagatgccttctggatcttaagccagttgtcagtggaggtcctcagggctgcaaatgtcaagacataaccctgttcctcaccatcatgataccagatacaggtgaatacataggaactatctgcctgtgtcctcaatctcccttcaaacaagatgctgatttgtagggtacttggcaggttaaattaaaccagaagaggtgacttaataaaaaagggaatgacatttagggtataaagatctcataagaaatgtaatatgtaaattatatcttgctttatgttgtaaaatatacattgtttgcgctagaatagaaatgatttcttttcaataaaaagaaagaaggactcta
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5396 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:5396 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: TAS GeneID:5396 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:5396 -> Molecular function: GO:0071837 [HMG box domain binding] evidence: IEA GeneID:5396 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:5396 -> Biological process: GO:0002053 [positive regulation of mesenchymal cell proliferation] evidence: IEA GeneID:5396 -> Biological process: GO:0030326 [embryonic limb morphogenesis] evidence: IEA GeneID:5396 -> Biological process: GO:0042472 [inner ear morphogenesis] evidence: IEA GeneID:5396 -> Biological process: GO:0042474 [middle ear morphogenesis] evidence: IEA GeneID:5396 -> Biological process: GO:0045880 [positive regulation of smoothened signaling pathway] evidence: IEA GeneID:5396 -> Biological process: GO:0048701 [embryonic cranial skeleton morphogenesis] evidence: IEA GeneID:5396 -> Biological process: GO:0048844 [artery morphogenesis] evidence: IEA GeneID:5396 -> Biological process: GO:0051216 [cartilage development] evidence: IEA GeneID:5396 -> Biological process: GO:0060021 [palate development] evidence: IEA GeneID:5396 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:5396 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.