Home |
Help |
Advanced search
2024-04-20 10:11:35, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_021942 4564 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens trafficking protein particle complex 11 (TRAPPC11),
transcript variant 1, mRNA.
ACCESSION NM_021942
VERSION NM_021942.5 GI:359718967
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4564)
AUTHORS Yu,S. and Liang,Y.
TITLE A trapper keeper for TRAPP, its structures and functions
JOURNAL Cell. Mol. Life Sci. (2012) In press
PUBMED 22669257
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 4564)
AUTHORS Scrivens,P.J., Noueihed,B., Shahrzad,N., Hul,S., Brunet,S. and
Sacher,M.
TITLE C4orf41 and TTC-15 are mammalian TRAPP components with a role at an
early stage in ER-to-Golgi trafficking
JOURNAL Mol. Biol. Cell 22 (12), 2083-2093 (2011)
PUBMED 21525244
REFERENCE 3 (bases 1 to 4564)
AUTHORS Wendler,F., Gillingham,A.K., Sinka,R., Rosa-Ferreira,C.,
Gordon,D.E., Franch-Marro,X., Peden,A.A., Vincent,J.P. and Munro,S.
TITLE A genome-wide RNA interference screen identifies two novel
components of the metazoan secretory pathway
JOURNAL EMBO J. 29 (2), 304-314 (2010)
PUBMED 19942856
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB096222.1, BX648499.1,
BX647127.1 and AI034264.1.
This sequence is a reference standard in the RefSeqGene project.
On Dec 8, 2011 this sequence version replaced gi:39995075.
Summary: The protein encoded by this gene is a subunit of the TRAPP
(transport protein particle) tethering complex, which functions in
intracellular vesicle trafficking. This subunit is involved in
early stage endoplasmic reticulum-to-Golgi vesicle transport.
Alternative splicing of this gene results in multiple transcript
variants. [provided by RefSeq, Jan 2013].
Transcript Variant: This variant (1) represents the longer
transcript and encodes the longer isoform (a).
##Evidence-Data-START##
Transcript exon combination :: BX647127.1, AK096345.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025083, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-26 DB096222.1 1-26
27-2346 BX648499.1 2-2321
2347-4547 BX647127.1 2318-4518
4548-4564 AI034264.1 1-17 c
FEATURES Location/Qualifiers
source 1..4564
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="4"
/map="4q35.1"
gene 1..4564
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/note="trafficking protein particle complex 11"
/db_xref="GeneID:60684"
/db_xref="HGNC:25751"
/db_xref="HPRD:10968"
/db_xref="MIM:614138"
exon 1..181
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 31
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:186294928"
variation 77
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:190853983"
variation 110
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:111592692"
exon 182..406
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 196
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:370618098"
variation 197
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:113604435"
CDS 203..3604
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/note="isoform a is encoded by transcript variant 1;
gryzun homolog; foie gras homolog; trafficking protein
particle complex subunit 11"
/codon_start=1
/product="trafficking protein particle complex subunit 11
isoform a"
/protein_id="NP_068761.4"
/db_xref="GI:39995076"
/db_xref="CCDS:CCDS34112.1"
/db_xref="GeneID:60684"
/db_xref="HGNC:25751"
/db_xref="HPRD:10968"
/db_xref="MIM:614138"
/translation="
MSPTQWDFPVELCCRPMAFVTLTGLDVVYNAVHRAVWDAFCANRRADRVPISFKVLPGDHEYPKCRPKRTSYEWYIPKGILKTGWMNKHLNLVPALVVVFYELDWDEPQWKEKQSECATRVEIVRQSLQGRNTKVAVVLIQKKTPLPPGEDVIASERAAALCNACELSGKSLFVLPHTDHLVGYIIRLENAFYEHAQTYYYTEIRRVKSHKEFLNKTTHQLLFVRHQFKIAFFSELKQDTQNALKNYRTAYNLVHELRAHETNILEIKTMAGFINYKICRLCFQHNTPLDAIAQFRKHIDLCKKKIGSAELSFEHDAWMSKQFQAFGDLFDEAIKLGLTAIQTQNPGFYYQQAAYYAQERKQLAKTLCNHEASVMYPNPDPLETQTGVLDFYGQRSWRQGILSFDLSDPEKEKVGILAIQLKERNVVHSEIIITLLSNAVAQFKKYKCPRMKSHLMVQMGEEYYYAKDYTKALKLLDYVMCDYRSEGWWTLLTSVLTTALKCSYLMAQLKDYITYSLELLGRASTLKDDQKSRIEKNLINVLMNESPDPEPDCDILAVKTAQKLWADRISLAGSNIFTIGVQDFVPFVQCKAKFHAPSFHVDVPVQFDIYLKADCPHPIRFSKLCVSFNNQEYNQFCVIEEASKANEVLENLTQGKMCLVPGKTRKLLFKFVAKTEDVGKKIEITSVDLALGNETGRCVVLNWQGGGGDAASSQEALQAARSFKRRPKLPDNEVHWDSIIIQASTMIISRVPNISVHLLHEPPALTNEMYCLVVTVQSHEKTQIRDVKLTAGLKPGQDANLTQKTHVTLHGTELCDESYPALLTDIPVGDLHPGEQLEKMLYVRCGTVGSRMFLVYVSYLINTTVEEKEIVCKCHKDETVTIETVFPFDVAVKFVSTKFEHLERVYADIPFLLMTDLLSASPWALTIVSSELQLAPSMTTVDQLESQVDNVILQTGESASECFCLQCPSLGNIEGGVATGHYIISWKRTSAMENIPIITTVITLPHVIVENIPLHVNADLPSFGRVRESLPVKYHLQNKTDLVQDVEISVEPSDAFMFSGLKQIRLRILPGTEQEMLYNFYPLMAGYQQLPSLNINLLRFPNFTNQLLRRFIPTSIFVKPQGRLMDDTSIAAA
"
misc_feature 935..937
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (Q7Z392.2); acetylation site"
misc_feature 989..1768
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/note="Foie gras liver health family 1; Region:
Foie-gras_1; pfam11817"
/db_xref="CDD:192842"
misc_feature 1931..>2305
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/note="Gryzun, putative trafficking through Golgi; Region:
Gryzun; pfam07919"
/db_xref="CDD:191893"
misc_feature <2936..3493
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/note="Gryzun, putative trafficking through Golgi; Region:
Gryzun; pfam07919"
/db_xref="CDD:191893"
misc_feature 3305..3487
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/note="Gryzun, putative Golgi trafficking; Region:
Gryzun-like; pfam12742"
/db_xref="CDD:193218"
variation 246
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:368097747"
variation 251
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:149829052"
variation 259
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:370789553"
variation 316
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:140219590"
variation 319
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:145842147"
variation 320
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:199564084"
variation 344
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:150331292"
variation 347
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:141909783"
variation 353
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:141053214"
variation 372
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:375826055"
variation 385
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:144878889"
exon 407..576
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 421
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:138760818"
variation 431
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:149339392"
variation 472
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:60142264"
variation 484
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:148105529"
variation 553
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:372764730"
variation 560
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:376462004"
variation 561
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:367769488"
exon 577..647
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 586
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:369613803"
variation 606
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:141880154"
variation 607
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="g"
/replace="t"
/db_xref="dbSNP:375901783"
exon 648..762
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 652
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:147280840"
variation 694
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:368033997"
variation 728
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:199967169"
variation 732
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:140909414"
variation 742
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:114853790"
exon 763..862
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 766
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:377678506"
variation 799
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="g"
/replace="t"
/db_xref="dbSNP:373475855"
variation 821
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:201181808"
variation 829
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:200367113"
exon 863..936
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 877
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:73872657"
variation 930
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:373207427"
variation 931
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:369901430"
exon 937..1033
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 950
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:368397954"
variation 1010
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:147526528"
variation 1031
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:368689327"
exon 1034..1167
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1040
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:200646990"
variation 1057
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:139419771"
variation 1087
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:371401679"
variation 1088
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:374498633"
variation 1090
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace=""
/replace="a"
/db_xref="dbSNP:34767735"
variation 1099
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:62357990"
variation 1100
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:138722849"
variation 1119
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:367938699"
variation 1129
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:4241779"
variation 1133
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:148833310"
variation 1162
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:371688110"
exon 1168..1315
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1189
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:142558431"
variation 1260
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:200078740"
variation 1281
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:146470172"
variation 1309
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:140959482"
variation 1312
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:144785855"
exon 1316..1409
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1316
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="g"
/replace="t"
/db_xref="dbSNP:372479687"
variation 1337
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:201932605"
variation 1350
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:138740048"
variation 1359
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:376987315"
variation 1363
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:369104172"
variation 1394
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:140403642"
exon 1410..1489
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1422
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:375379302"
variation 1446
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:150383310"
variation 1477
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:376944145"
variation 1479
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:201263451"
exon 1490..1568
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1498
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:138134740"
variation 1507
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="g"
/replace="t"
/db_xref="dbSNP:373944670"
variation 1531
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:368173953"
variation 1537
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:60648156"
variation 1539
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:149572534"
variation 1540
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:202186437"
variation 1543
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:202220969"
variation 1546
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:147260246"
variation 1549
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:141205658"
variation 1551
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:201387237"
exon 1569..1623
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1597
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:373372697"
variation 1603
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:202145488"
variation 1611
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:200956431"
exon 1624..1769
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1729
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:368801039"
variation 1732
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="g"
/replace="t"
/db_xref="dbSNP:139154209"
exon 1770..1831
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1800
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:201440313"
variation 1813
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:199634473"
variation 1827
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:376489209"
variation 1830
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:370129357"
exon 1832..1964
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1856
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:374195797"
variation 1904
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:200561007"
variation 1905
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:147516606"
variation 1937
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:368529822"
exon 1965..2095
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 1968
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:146053783"
variation 1988..1989
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace=""
/replace="c"
/db_xref="dbSNP:34788117"
variation 2026
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:369696357"
exon 2096..2251
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 2103
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:148567547"
variation 2116
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:202077324"
variation 2121
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:372385350"
variation 2180
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:67383011"
variation 2201
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:185988689"
exon 2252..2439
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 2279
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:374682349"
variation 2297
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:376585316"
variation 2347
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:139034513"
variation 2349
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:143990563"
variation 2371
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:146441514"
variation 2377
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="g"
/replace="t"
/db_xref="dbSNP:140919627"
variation 2382
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:371182334"
variation 2384
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:143344834"
variation 2398
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:375844076"
exon 2440..2588
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 2444
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:368432060"
variation 2479
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:199804527"
variation 2488
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:372771070"
variation 2489
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:201179987"
variation 2522
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:146718854"
variation 2561
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:148885349"
variation 2569
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:374752326"
variation 2572
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:4862234"
exon 2589..2710
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 2590
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:151021715"
variation 2601
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:140915279"
variation 2612
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:111423902"
variation 2620
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:146402163"
variation 2621
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:139113789"
variation 2624
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:184925550"
variation 2627
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:369402916"
variation 2636
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:62358032"
variation 2663
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:114471872"
variation 2685
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:75176151"
variation 2691
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:200068440"
variation 2710
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:201868142"
exon 2711..2830
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 2732
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:149626892"
variation 2753
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:369752120"
variation 2801
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:144365310"
exon 2831..2896
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 2839
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="g"
/replace="t"
/db_xref="dbSNP:148799732"
variation 2849
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:142313888"
variation 2853
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:373484248"
variation 2858
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:376514277"
variation 2876
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:369077324"
variation 2886
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:200931036"
exon 2897..3053
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 2946
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:200936990"
variation 2947
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:200191432"
variation 2987
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:200421641"
variation 2991
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:139826587"
variation 2996
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:376022413"
variation 3001
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:62617790"
variation 3013
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:368829322"
variation 3027
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:202094535"
variation 3034
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:371763250"
variation 3035
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:200260429"
variation 3046
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:151179289"
variation 3051
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:202170132"
variation 3052
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:376728526"
exon 3054..3165
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 3077
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:375415831"
variation 3100
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:139144320"
variation 3120
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:370024286"
variation 3137
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:201344261"
variation 3139
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:200546920"
exon 3166..3257
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 3204
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:200989029"
variation 3220
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:149934183"
variation 3221
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:79804817"
variation 3240
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:77044048"
variation 3241
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:75104564"
variation 3242
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:79057512"
variation 3243
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:74598240"
exon 3258..3391
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 3264
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:371103166"
variation 3265
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:142298713"
variation 3276
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:374203755"
variation 3288
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:201494083"
variation 3294
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:200466260"
variation 3326
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:146219211"
variation 3385
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:373951254"
exon 3392..3559
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 3401
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:374734783"
variation 3409
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:147872774"
variation 3413
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:141588557"
variation 3417
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:147061560"
variation 3418
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:148114592"
variation 3423
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="c"
/db_xref="dbSNP:368699954"
variation 3435
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:372371594"
variation 3475
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:113269326"
variation 3506
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:201906372"
variation 3512
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:78663235"
variation 3531
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:369105119"
variation 3544
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:368766677"
exon 3560..4554
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/inference="alignment:Splign:1.39.8"
variation 3561
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:138928797"
variation 3602
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:142222368"
variation 3614
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:373447557"
variation 3615
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:376809612"
variation 3658
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:373719187"
variation 3766
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:141091250"
variation 3790
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="g"
/db_xref="dbSNP:150159419"
variation 3879
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:372956047"
variation 3982
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:145640453"
variation 4079
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:374746128"
variation 4083
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:376123960"
variation 4095
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:148811548"
variation 4140
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="g"
/replace="t"
/db_xref="dbSNP:78106466"
variation 4162
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="c"
/replace="t"
/db_xref="dbSNP:192368056"
variation 4235..4236
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace=""
/replace="c"
/db_xref="dbSNP:35034292"
variation 4273
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="t"
/db_xref="dbSNP:143470714"
STS 4334..4517
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/standard_name="RH103089"
/db_xref="UniSTS:97423"
STS 4334..4477
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/standard_name="SHGC-44350"
/db_xref="UniSTS:71825"
STS 4342..4517
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/standard_name="D20S722"
/db_xref="UniSTS:78628"
polyA_signal 4529..4534
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
variation 4548
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
/replace="a"
/replace="g"
/db_xref="dbSNP:12642166"
polyA_site 4549
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
polyA_site 4554
/gene="TRAPPC11"
/gene_synonym="C4orf41; FOIGR; GRY"
ORIGIN
aaagtgcttcctgtgccgggggaggtgggtacagggaagtctcgcctgttggaactggctgtggggctgcggcggtggggacgggccacggcgttctgtgacatccccccgcctcccctcgtcttctcccggctggcggcgaccggcctcagctgcagcgggcccggggcgtggggcctgggttttttgtgacatcgtaaacatgagccccacacagtgggacttccctgtggaattatgttgccggcctatggcctttgttactctaacgggcctggatgtagtttataatgcagtccatcgagctgtctgggacgccttctgtgcaaatcggagagctgatcgagtaccaatttctttcaaggtgctcccaggtgaccatgagtatcccaaatgtagacccaagagaacttcatatgagtggtacattcctaaagggatcttaaagactggctggatgaataagcatctgaatctggtgccagccctggtggttgtgttctatgaactggactgggatgagcctcagtggaaagaaaagcagtctgagtgcgccaccagagtggaaatagtcaggcaaagtttacaaggaagaaacacaaaagttgcagtggttctgattcagaagaaaacccctttgcccccaggagaagatgtcattgcttcagaaagggctgcagctttatgcaatgcatgtgaactctcaggaaagtctttgtttgtactgccgcacactgaccaccttgtgggttatattataagattggaaaatgccttttatgaacatgcacagacttattactacactgagatcagaagagtgaaatctcataaagaatttttgaataaaacaacacaccagcttttatttgttaggcatcagttcaaaatagctttcttcagtgagttgaaacaagatacacaaaatgcgctgaagaattataggaccgcctataatcttgtacacgaattgagagcccatgaaactaatattctggaaattaagactatggcaggatttataaactacaagatctgtaggctgtgttttcaacacaacaccccattggatgcaattgctcagttccgaaaacacatcgacttgtgtaagaaaaagattggaagtgcagagctgtcttttgagcatgatgcatggatgtctaaacaattccaggcctttggagatttatttgatgaagctattaagttagggttaacagctattcaaactcagaatcctggtttctattaccagcaggcagcatactatgcccaggagcggaaacagcttgcaaaaaccctctgtaaccacgaagcttctgtaatgtatcccaatcctgatcccttagaaacacaaacaggcgttcttgacttttatggacaaagatcatggcgacaaggaatactaagttttgatctttctgatcctgaaaaagaaaaggtgggaattcttgccattcagctgaaggagagaaatgttgttcactctgagataatcataactcttctgagcaatgctgttgcacagttcaagaagtataagtgcccgcgaatgaaaagtcacctaatggttcagatgggagaggaatattattacgcaaaggattataccaaagctttgaagttgctggattatgtgatgtgtgattatcggagtgaaggatggtggactctgctcacttctgtattaactacagctctgaagtgctcctacctcatggcccaattaaaggattacattacttactccctagaactccttggtagagcttcaactctgaaagatgaccagaagtctcggatagaaaagaacctcataaatgttttaatgaatgaaagtcctgatccagaacccgactgtgatatcttagctgtgaaaactgctcagaagctgtgggcagaccgaatttctctggctggcagcaatattttcacaataggagtacaggactttgtgccatttgtgcagtgcaaagccaagtttcatgccccaagttttcatgttgatgttcctgttcagtttgatatttatctgaaggctgattgtccacatcccattaggttttccaagctctgtgtcagctttaataatcaggaatacaaccagttctgtgtaatagaagaagcatccaaagcaaatgaagttttagaaaatctgactcaaggaaagatgtgcctagttcctggcaaaacaagaaaactgttatttaagtttgttgcaaaaactgaagatgtgggaaagaaaattgagattacttcagtggatcttgctctgggcaatgagacgggaagatgtgtggttttaaattggcagggaggaggaggagatgctgcttcctcccaagaagccttacaggcagctcggtctttcaaaaggcgacctaagctacctgacaatgaagttcactgggacagcattataattcaggcaagcacaatgatcatatccagagtcccaaacatttctgtacatctgctacatgaaccccctgcactgactaatgaaatgtattgtttggttgtgactgttcagtcccatgaaaagacccaaatcagagatgtgaagctcaccgctggcttaaaaccaggacaggatgccaatttaactcagaagactcacgtgactcttcatggaacagaactgtgtgatgaatcctacccggctttactcactgacattcctgttggagacttacatccaggggaacagctggaaaaaatgttgtatgttcgctgtggaacagtgggttccagaatgtttcttgtatatgtttcttacctgataaatacaaccgttgaagaaaaagaaattgtttgcaagtgtcacaaggatgaaactgtaacaattgaaacagtctttccatttgatgttgcggttaaatttgtttctaccaagtttgagcacctggaaagggtttatgctgacatcccctttctgttgatgacggacctcttaagtgcctcaccctgggccctcactattgtttccagtgagctccagcttgctccatccatgaccacagtggaccagctcgagtctcaagtggacaatgttatcttacagactggagagagtgctagtgaatgcttttgtcttcaatgcccatctcttggaaatattgaaggtggagtagcaaccgggcattatattatctcttggaaaaggacctcagcaatggagaatatccccatcatcacaactgtcatcactctgccgcacgtgattgtggagaatatccctctccatgtgaatgcagatctgccgtcatttgggcgtgtcagagagtcgttacctgtcaagtatcacctacagaataagaccgacttagttcaagatgtagaaatttctgtggagcccagtgatgccttcatgttctcaggtctcaaacagattcgattacgtatcctccctggcacggagcaggaaatgctatataatttctatcctctgatggctggataccagcagctgccatctctcaacatcaacttgcttagatttcctaacttcacaaatcagctgctcaggcgttttatacctaccagtatttttgtcaagccacagggtcgactcatggatgatacctctattgctgctgcatgatgttcaagaccggcccttggctgttgttacagagatgttgggcagagctatgcaggtgtttcattgtgaactctagctttgatcatggtaaaaagttaaccttttctattttttaatggatgttataccaactattcagaggaactcatacttcaaaaatattaggaaaatctgtcttatagtttctctaataaatatctgaaatctcagtacgacatgaaagaatgtcagaccattgttattgttgaaagtcatttgatgaatggtaaattctatgaaaagtaagtgatttgcatgtataatatcaggaaaattaagcatcccaagtgtgactggacaaagagagcagatgcaccagtgcctgtgccataaagttccgaatcccccatgtgtctctttcagagctggccagaccggaaataaatcattctcataaattcagtgtgtactcagaacacatacacaacaacatagggagttgtatgactgatacggaaaacttccagaaagttttaatcaaagcagtttaattaaggtatcaaaaatatctttgcttactatcaagaagtgtcaaataggttcagcttgctgccaaaatatggatcatttatgaagcaggttcatattttagaggtgttaataaaatcctcatcggaaaagatccaaagtgcaaggatttgattataaacataatttcctagactgaaagtttttggaaaagatgcagggtctgagtcaggccttctggttatattgtgcagtttcaaaagaactatttaaaactcttgaaaactcatgtaaataaaaatcatagggtgaaaattgtatttgttaaaataccttaataatttaaaatgacctgatttcctggaaaattttattattcaaaaggtggaggcattgtaaaaaggaaatagtgatgtaaataaacatgttctctttcaagtatgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:60684 -> Biological process: GO:0016192 [vesicle-mediated transport] evidence: IEA
GeneID:60684 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.