Home |
Help |
Advanced search
2024-04-20 04:05:19, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_021873 3701 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens cell division cycle 25B (CDC25B), transcript variant
1, mRNA.
ACCESSION NM_021873
VERSION NM_021873.2 GI:47078252
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3701)
AUTHORS Hsieh,W.L., Lin,Y.K., Tsai,C.N., Wang,T.M., Chen,T.Y. and Pang,J.H.
TITLE Indirubin, an acting component of indigo naturalis, inhibits EGFR
activation and EGF-induced CDC25B gene expression in epidermal
keratinocytes
JOURNAL J. Dermatol. Sci. 67 (2), 140-146 (2012)
PUBMED 22721997
REMARK GeneRIF: Indirubin, an acting component of indigo naturalis,
inhibits EGFR activation and EGF-induced CDC25B gene expression in
epidermal ke
REFERENCE 2 (bases 1 to 3701)
AUTHORS Yu,X.Y., Zhang,Z., Zhang,G.J., Guo,K.F. and Kong,C.Z.
TITLE Knockdown of Cdc25B in renal cell carcinoma is associated with
decreased malignant features
JOURNAL Asian Pac. J. Cancer Prev. 13 (3), 931-935 (2012)
PUBMED 22631674
REMARK GeneRIF: downregulation of Cdc25B resulted in slower growth, more
G2/M cells, weaker capacity for migration and invasion and
induction of apoptosis in renal carcinoma cell line 769-P
transfectants; findings suggest an important role of Cdc25B in
renal cell carcinoma development
REFERENCE 3 (bases 1 to 3701)
AUTHORS Liffers,S.T., Munding,J.B., Vogt,M., Kuhlmann,J.D., Verdoodt,B.,
Nambiar,S., Maghnouj,A., Mirmohammadsadegh,A., Hahn,S.A. and
Tannapfel,A.
TITLE MicroRNA-148a is down-regulated in human pancreatic ductal
adenocarcinomas and regulates cell survival by targeting CDC25B
JOURNAL Lab. Invest. 91 (10), 1472-1479 (2011)
PUBMED 21709669
REMARK GeneRIF: We identified CDC25B as novel miR-148a target which may
confer a proliferative advantage in pancreatic ductal
adenocarcinomas.
REFERENCE 4 (bases 1 to 3701)
AUTHORS Lobjois,V., Froment,C., Braud,E., Grimal,F., Burlet-Schiltz,O.,
Ducommun,B. and Bouche,J.P.
TITLE Study of the docking-dependent PLK1 phosphorylation of the CDC25B
phosphatase
JOURNAL Biochem. Biophys. Res. Commun. 410 (1), 87-90 (2011)
PUBMED 21640712
REMARK GeneRIF: there are 13 sites phosphorylated by PLK1 in CDC25B.This
study illustrates the complexity of the phosphorylation pattern and
of the subsequent regulation of CDC25B activity.
REFERENCE 5 (bases 1 to 3701)
AUTHORS Nakamura,S., Nagata,Y., Tan,L., Takemura,T., Shibata,K., Fujie,M.,
Fujisawa,S., Tanaka,Y., Toda,M., Makita,R., Tsunekawa,K.,
Yamada,M., Yamaoka,M., Yamashita,J., Ohnishi,K. and Yamashita,M.
TITLE Transcriptional repression of Cdc25B by IER5 inhibits the
proliferation of leukemic progenitor cells through NF-YB and p300
in acute myeloid leukemia
JOURNAL PLoS ONE 6 (11), E28011 (2011)
PUBMED 22132193
REMARK GeneRIF: Transcriptional repression mediated by IER5 regulates
Cdc25B expression levels via the release of NF-YB and p300 in acute
myeloid leukemia.
REFERENCE 6 (bases 1 to 3701)
AUTHORS Baldin,V., Cans,C., Superti-Furga,G. and Ducommun,B.
TITLE Alternative splicing of the human CDC25B tyrosine phosphatase.
Possible implications for growth control?
JOURNAL Oncogene 14 (20), 2485-2495 (1997)
PUBMED 9188863
REFERENCE 7 (bases 1 to 3701)
AUTHORS Conklin,D.S., Galaktionov,K. and Beach,D.
TITLE 14-3-3 proteins associate with cdc25 phosphatases
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (17), 7892-7896 (1995)
PUBMED 7644510
REFERENCE 8 (bases 1 to 3701)
AUTHORS Galaktionov,K. and Beach,D.
TITLE Specific activation of cdc25 tyrosine phosphatases by B-type
cyclins: evidence for multiple roles of mitotic cyclins
JOURNAL Cell 67 (6), 1181-1194 (1991)
PUBMED 1836978
REFERENCE 9 (bases 1 to 3701)
AUTHORS Nagata,A., Igarashi,M., Jinno,S., Suto,K. and Okayama,H.
TITLE An additional homolog of the fission yeast cdc25+ gene occurs in
humans and is highly expressed in some cancer cells
JOURNAL New Biol. 3 (10), 959-968 (1991)
PUBMED 1662986
REFERENCE 10 (bases 1 to 3701)
AUTHORS Strausfeld,U., Labbe,J.C., Fesquet,D., Cavadore,J.C., Picard,A.,
Sadhu,K., Russell,P. and Doree,M.
TITLE Dephosphorylation and activation of a p34cdc2/cyclin B complex in
vitro by human CDC25 protein
JOURNAL Nature 351 (6323), 242-245 (1991)
PUBMED 1828290
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK092713.1, BC051711.1,
S78187.1 and BX640836.1.
This sequence is a reference standard in the RefSeqGene project.
On May 7, 2004 this sequence version replaced gi:11641412.
Summary: CDC25B is a member of the CDC25 family of phosphatases.
CDC25B activates the cyclin dependent kinase CDC2 by removing two
phosphate groups and it is required for entry into mitosis. CDC25B
shuttles between the nucleus and the cytoplasm due to nuclear
localization and nuclear export signals. The protein is nuclear in
the M and G1 phases of the cell cycle and moves to the cytoplasm
during S and G2. CDC25B has oncogenic properties, although its role
in tumor formation has not been determined. Multiple transcript
variants for this gene exist. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1), also known as CDC25B3,
represents the longest transcript and encodes the longest isoform
(1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC051711.1, BC009953.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025083 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-86 AK092713.1 16-101
87-567 BC051711.1 6-486
568-743 S78187.1 30-205
744-3045 BC051711.1 664-2965
3046-3666 BX640836.1 1984-2604
3667-3701 S78187.1 3084-3118
FEATURES Location/Qualifiers
source 1..3701
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="20"
/map="20p13"
gene 1..3701
/gene="CDC25B"
/note="cell division cycle 25B"
/db_xref="GeneID:994"
/db_xref="HGNC:1726"
/db_xref="HPRD:00307"
/db_xref="MIM:116949"
exon 1..978
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 69
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:183999341"
variation 158
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11569978"
variation 251
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:374054731"
misc_feature 470..472
/gene="CDC25B"
/note="upstream in-frame stop codon"
variation 568
/gene="CDC25B"
/replace="a"
/replace="t"
/db_xref="dbSNP:6116042"
variation 662
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:13038734"
variation 665..666
/gene="CDC25B"
/replace=""
/replace="c"
/db_xref="dbSNP:11462398"
variation 666..667
/gene="CDC25B"
/replace=""
/replace="c"
/db_xref="dbSNP:71678223"
variation 772
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11087603"
variation 775
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:372029025"
CDS 779..2521
/gene="CDC25B"
/EC_number="3.1.3.48"
/note="isoform 1 is encoded by transcript variant 1;
M-phase inducer phosphatase 2; dual specificity
phosphatase Cdc25B"
/codon_start=1
/product="M-phase inducer phosphatase 2 isoform 1"
/protein_id="NP_068659.1"
/db_xref="GI:11641413"
/db_xref="CCDS:CCDS13067.1"
/db_xref="GeneID:994"
/db_xref="HGNC:1726"
/db_xref="HPRD:00307"
/db_xref="MIM:116949"
/translation="
MEVPQPEPAPGSALSPAGVCGGAQRPGHLPGLLLGSHGLLGSPVRAAASSPVTTLTQTMHDLAGLGSETPKSQVGTLLFRSRSRLTHLSLSRRASESSLSSESSESSDAGLCMDSPSPMDPHMAEQTFEQAIQAASRIIRNEQFAIRRFQSMPVRLLGHSPVLRNITNSQAPDGRRKSEAGSGAASSSGEDKENDGFVFKMPWKPTHPSSTHALAEWASRREAFAQRPSSAPDLMCLSPDRKMEVEELSPLALGRFSLTPAEGDTEEDDGFVDILESDLKDDDAVPPGMESLISAPLVKTLEKEEEKDLVMYSKCQRLFRSPSMPCSVIRPILKRLERPQDRDTPVQNKRRRSVTPPEEQQEAEEPKARVLRSKSLCHDEIENLLDSDHRELIGDYSKAFLLQTVDGKHQDLKYISPETMVALLTGKFSNIVDKFVIVDCRYPYEYEGGHIKTAVNLPLERDAESFLLKSPIAPCSLDKRVILIFHCEFSSERGPRMCRFIRERDRAVNDYPSLYYPEMYILKGGYKEFFPQHPNFCEPQDYRPMNHEAFKDELKTFRLKTRSWAGERSRRELCSRLQDQ
"
misc_feature 1115..1930
/gene="CDC25B"
/note="M-phase inducer phosphatase; Region:
M-inducer_phosp; pfam06617"
/db_xref="CDD:115287"
misc_feature 1256..1258
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 1283..1285
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by MELK; propagated from
UniProtKB/Swiss-Prot (P30305.2); phosphorylation site"
misc_feature 1334..1336
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 1337..1339
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00277"
misc_feature 1523..1525
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P30305.2); phosphorylation site"
misc_feature 1739..1741
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:06119"
misc_feature 1745..1747
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by MELK and MAPK14; propagated from
UniProtKB/Swiss-Prot (P30305.2); phosphorylation site"
misc_feature 1835..1837
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by AURKA; propagated from
UniProtKB/Swiss-Prot (P30305.2); phosphorylation site"
misc_feature 1835..1837
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:04066"
misc_feature 1901..1903
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by BRSK1 and MAPK14; propagated from
UniProtKB/Swiss-Prot (P30305.2); phosphorylation site"
misc_feature 2012..2371
/gene="CDC25B"
/note="Cdc25 phosphatases are members of the Rhodanese
Homology Domain superfamily. They activate the cell
division kinases throughout the cell cycle progression.
Cdc25 phosphatases dephosphorylate phosphotyrosine and
phosphothreonine residues, in order to...; Region: Cdc25;
cd01530"
/db_xref="CDD:29093"
misc_feature 2237..2257
/gene="CDC25B"
/note="oxyanion binding site; other site"
/db_xref="CDD:29093"
misc_feature 2237..2239
/gene="CDC25B"
/note="active site residue [active]"
/db_xref="CDD:29093"
variation 820
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11569979"
variation 838
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375122468"
variation 889
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368274446"
variation 953
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372183442"
variation 965
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:145700972"
variation 973
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:373847564"
exon 979..1106
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 984
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:373910055"
variation 1014
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:202156665"
variation 1017
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:76772959"
variation 1023
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:146567070"
variation 1031
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141031701"
variation 1038
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:375803588"
variation 1039
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:370072424"
variation 1063
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:201619391"
variation 1069
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374599445"
variation 1078
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:147311787"
variation 1081
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368877264"
variation 1091
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:199501910"
exon 1107..1158
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1126
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:371577332"
variation 1149
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376436608"
variation 1150
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:148241851"
variation 1154
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:141382375"
variation 1156
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:139123058"
variation 1158
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:370155414"
exon 1159..1200
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1159
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:150375046"
variation 1187
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:137919521"
variation 1188
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:143386679"
variation 1197
/gene="CDC25B"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:143369164"
exon 1201..1237
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1212
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:111654983"
variation 1220
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:147172963"
variation 1221
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371528141"
variation 1228
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:61755298"
variation 1231
/gene="CDC25B"
/replace="a"
/replace="t"
/db_xref="dbSNP:368675680"
variation 1232
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:140433155"
variation 1237
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201436986"
exon 1238..1360
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1262
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:375465916"
variation 1265
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:201911534"
variation 1268
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371350767"
variation 1290
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:373068861"
variation 1291
/gene="CDC25B"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:11552106"
variation 1298
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:367573455"
variation 1302
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:144359318"
variation 1307
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:199988612"
variation 1312
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376072567"
exon 1361..1483
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1365
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:202155757"
variation 1409
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:368042199"
variation 1430
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:142459784"
variation 1448
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:200968688"
exon 1484..1618
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1486..1487
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35741868"
variation 1490
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:111545759"
variation 1499
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:202222511"
variation 1500
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201435494"
variation 1542
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:151315259"
variation 1554
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:372916640"
variation 1555
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375854669"
variation 1556
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:202059655"
variation 1560
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:139531565"
variation 1613
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:373171092"
exon 1619..1699
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1634
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:144187197"
variation 1688
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201902192"
variation 1698..1699
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35824153"
exon 1700..1876
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1705
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:145108436"
variation 1723
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:200104998"
variation 1736
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141314132"
variation 1743
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375465349"
variation 1748
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371407165"
variation 1760
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:149795416"
variation 1766
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376224294"
variation 1809
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:369403610"
variation 1810
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372954698"
variation 1813
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:61746575"
variation 1830
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:376488245"
variation 1831
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:2228465"
exon 1877..1972
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1885
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:143612466"
variation 1888
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570010"
variation 1893
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:374005977"
variation 1928
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376924240"
variation 1931
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371158244"
variation 1946
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:138180783"
exon 1973..2035
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1996
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371343744"
exon 2036..2134
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2045
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:2228464"
variation 2052
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376914644"
variation 2053
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:146556613"
variation 2072
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:199832947"
exon 2135..2268
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2159
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:377681163"
variation 2160
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:138651339"
variation 2162
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:61742036"
variation 2164
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570015"
variation 2167
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141229949"
variation 2192
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:370128666"
variation 2194
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056720"
variation 2196
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:61755297"
variation 2236
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374888909"
variation 2260
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:149394412"
variation 2264
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:199659921"
variation 2265
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:200957584"
exon 2269..2380
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2350
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:146399677"
variation 2374
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:143897481"
exon 2381..3675
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2395
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374526361"
variation 2420
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11570019"
variation 2464
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368410035"
variation 2477
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371947700"
variation 2484
/gene="CDC25B"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:514523"
variation 2485
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:514521"
variation 2504
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:369357260"
variation 2517
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:200551395"
variation 2530
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371951429"
variation 2540
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372117595"
variation 2559
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:375603041"
variation 2585
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:41279402"
variation 2586
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:2229592"
variation 2649
/gene="CDC25B"
/replace=""
/replace="t"
/db_xref="dbSNP:201707296"
variation 2732
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570020"
variation 2743
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:368742502"
variation 2754
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:139271260"
variation 2762
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:55732615"
variation 2791
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:189019990"
variation 2871
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:6052085"
variation 2891
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11087604"
variation 2897
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11087605"
variation 2965
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:142635163"
variation 3006..3007
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35980638"
variation 3019
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570021"
STS 3090..3426
/gene="CDC25B"
/standard_name="D20S1012"
/db_xref="UniSTS:32857"
variation 3160
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:181412320"
variation 3187..3208
/gene="CDC25B"
/replace=""
/replace="tacccactcggtcccagttttg"
/db_xref="dbSNP:71331068"
variation 3188..3209
/gene="CDC25B"
/replace=""
/replace="acccactcggtcccagttttgt"
/db_xref="dbSNP:11570022"
variation 3196
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11570023"
variation 3258
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:367792437"
variation 3405
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:186687615"
variation 3480
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:1803263"
STS 3527..3651
/gene="CDC25B"
/standard_name="SHGC-30160"
/db_xref="UniSTS:79344"
variation 3550
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:8156"
variation 3594
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:3516"
polyA_signal 3650..3655
/gene="CDC25B"
polyA_site 3671
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 3675
/gene="CDC25B"
ORIGIN
gcagccagtcgcggaggcggggaggctgcgcggtcagaggcgcctggagcgagcgaatcctggcccaccgcctgcccaaccgcgtgaccttgattgagttaatgaacttcacgcctcagcgtccaggtctgtaaaatggggtgtctaacgcagaccgtacagcccagctgggtttagcaaacttccgggagccagttggagcctctccccatccctagcggtgatcccaggtgacgacatgccgcggggggtcctgcggaggccaccctagggcgttgctgctgcctttgggagtgtggagctccaaaccatgtcgcgagaggcggattttgggaggccgggatcctcgcgccagggggatgtgcgagggtgtgggataaatcttaattcctccggcccacccaaagcctggaaatccagcctccgcgcctcttgccctgcgggccccgccctcagtcccgccctcatctaacccgctaccccattggtggcgtccggcggcgcggctgctgttatttttcgaatatataaggaggtggaagtggcagctgcaactagaggcttccctggctggtgcctgagcccggcgtccctcgccccccgccctccccgcatccctctcctccctcgcgcctggccctgtggctcttcctccctccctccttccccccccccccacccctcgcccgctgcctccctcggcccagccagctgtgccggcgtttgttggctgccctgcgcccggccctccagccagccttctgccggccccgccgcgatggaggtgccccagccggagcccgcgccaggctcggctctcagtccagcaggcgtgtgcggtggcgcccagcgtccgggccacctcccgggcctcctgctgggatctcatggcctcctggggtccccggtgcgggcggccgcttcctcgccggtcaccaccctcacccagaccatgcacgacctcgccgggctcggcagcgaaaccccaaagagtcaggtagggaccctgctcttccgcagccgcagccgcctgacgcacctatccctgtctcgacgggcatccgaatcctccctgtcgtctgaatcctccgaatcttctgatgcaggtctctgcatggattcccccagccctatggacccccacatggcggagcagacgtttgaacaggccatccaggcagccagccggatcattcgaaacgagcagtttgccatcagacgcttccagtctatgccggtgaggctgctgggccacagccccgtgcttcggaacatcaccaactcccaggcgcccgacggccggaggaagagcgaggcgggcagtggagctgccagcagctctggggaagacaaggagaatgatggatttgtcttcaagatgccatggaagcccacacatcccagctccacccatgctctggcagagtgggccagccgcagggaagcctttgcccagagacccagctcggcccccgacctgatgtgtctcagtcctgaccggaagatggaagtggaggagctcagccccctggccctaggtcgcttctctctgacccctgcagagggggatactgaggaagatgatggatttgtggacatcctagagagtgacttaaaggatgatgatgcagttcccccaggcatggagagtctcattagtgccccactggtcaagaccttggaaaaggaagaggaaaaggacctcgtcatgtacagcaagtgccagcggctcttccgctctccgtccatgccctgcagcgtgatccggcccatcctcaagaggctggagcggccccaggacagggacacgcccgtgcagaataagcggaggcggagcgtgacccctcctgaggagcagcaggaggctgaggaacctaaagcccgcgtcctccgctcaaaatcactgtgtcacgatgagatcgagaacctcctggacagtgaccaccgagagctgattggagattactctaaggccttcctcctacagacagtagacggaaagcaccaagacctcaagtacatctcaccagaaacgatggtggccctattgacgggcaagttcagcaacatcgtggataagtttgtgattgtagactgcagatacccctatgaatatgaaggcgggcacatcaagactgcggtgaacttgcccctggaacgcgacgccgagagcttcctactgaagagccccatcgcgccctgtagcctggacaagagagtcatcctcattttccactgtgaattctcatctgagcgtgggccccgcatgtgccgtttcatcagggaacgagaccgtgctgtcaacgactaccccagcctctactaccctgagatgtatatcctgaaaggcggctacaaggagttcttccctcagcacccgaacttctgtgaaccccaggactaccggcccatgaaccacgaggccttcaaggatgagctaaagaccttccgcctcaagactcgcagctgggctggggagcggagccggcgggagctctgtagccggctgcaggaccagtgaggggcctgcgccagtcctgctacctcccttgcctttcgaggcctgaagccagctgccctatgggcctgccgggctgagggcctgctggaggcctcaggtgctgtccatgggaaagatggtgtgggtgtcctgcctgtctgccccagcccagattcccctgtgtcatcccatcattttccatatcctggtgccccccacccctggaagagcccagtctgttgagttagttaagttgggttaataccagcttaaaggcagtattttgtgtcctccaggagcttcttgtttccttgttagggttaacccttcatcttcctgtgtcctgaaacgctcctttgtgtgtgtgtcagctgaggctgggggagagccgtggtccctgaggatgggtcagagctaaactccttcctggcctgagagtcagctctctgccctgtgtacttcccgggccagggctgcccctaatctctgtaggaaccgtggtatgtctgccatgttgcccctttctcttttcccctttcctgtcccaccatacgagcacctccagcctgaacagaagctcttactctttcctatttcagtgttacctgtgtgcttggtctgtttgactttacgcccatctcaggacacttccgtagactgtttaggttcccctgtcaaatatcagttacccactcggtcccagttttgttgccccagaaagggatgttattatccttgggggctcccagggcaagggttaaggcctgaatcatgagcctgctggaagcccagcccctactgctgtgaaccctggggcctgactgctcagaacttgctgctgtcttgttgcggatggatggaaggttggatggatgggtggatggccgtggatggccgtggatgcgcagtgccttgcatacccaaaccaggtgggagcgttttgttgagcatgacagcctgcagcaggaatatatgtgtgcctatttgtgtggacaaaaatatttacacttagggtttggagctattcaagaggaaatgtcacagaagcagctaaaccaaggactgagcaccctctggattctgaatctcaagatgggggcagggctgtgcttgaaggccctgctgagtcatctgttagggccttggttcaataaagcactgagcaagttgagaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:994 -> Molecular function: GO:0004725 [protein tyrosine phosphatase activity] evidence: TAS
GeneID:994 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
GeneID:994 -> Biological process: GO:0000086 [G2/M transition of mitotic cell cycle] evidence: TAS
GeneID:994 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:994 -> Biological process: GO:0001556 [oocyte maturation] evidence: IEA
GeneID:994 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:994 -> Biological process: GO:0007067 [mitosis] evidence: IEA
GeneID:994 -> Biological process: GO:0007144 [female meiosis I] evidence: IEA
GeneID:994 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: TAS
GeneID:994 -> Biological process: GO:0032467 [positive regulation of cytokinesis] evidence: IMP
GeneID:994 -> Biological process: GO:0035335 [peptidyl-tyrosine dephosphorylation] evidence: TAS
GeneID:994 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IEA
GeneID:994 -> Biological process: GO:0045931 [positive regulation of mitotic cell cycle] evidence: IMP
GeneID:994 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:994 -> Cellular component: GO:0000922 [spindle pole] evidence: IDA
GeneID:994 -> Cellular component: GO:0005622 [intracellular] evidence: NAS
GeneID:994 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:994 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
GeneID:994 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_068659 -> EC 3.1.3.48
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.