Home |
Help |
Advanced search
2024-04-19 07:43:00, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_021872 3578 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens cell division cycle 25B (CDC25B), transcript variant
3, mRNA.
ACCESSION NM_021872
VERSION NM_021872.2 GI:47078251
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3578)
AUTHORS Hsieh,W.L., Lin,Y.K., Tsai,C.N., Wang,T.M., Chen,T.Y. and Pang,J.H.
TITLE Indirubin, an acting component of indigo naturalis, inhibits EGFR
activation and EGF-induced CDC25B gene expression in epidermal
keratinocytes
JOURNAL J. Dermatol. Sci. 67 (2), 140-146 (2012)
PUBMED 22721997
REMARK GeneRIF: Indirubin, an acting component of indigo naturalis,
inhibits EGFR activation and EGF-induced CDC25B gene expression in
epidermal ke
REFERENCE 2 (bases 1 to 3578)
AUTHORS Yu,X.Y., Zhang,Z., Zhang,G.J., Guo,K.F. and Kong,C.Z.
TITLE Knockdown of Cdc25B in renal cell carcinoma is associated with
decreased malignant features
JOURNAL Asian Pac. J. Cancer Prev. 13 (3), 931-935 (2012)
PUBMED 22631674
REMARK GeneRIF: downregulation of Cdc25B resulted in slower growth, more
G2/M cells, weaker capacity for migration and invasion and
induction of apoptosis in renal carcinoma cell line 769-P
transfectants; findings suggest an important role of Cdc25B in
renal cell carcinoma development
REFERENCE 3 (bases 1 to 3578)
AUTHORS Liffers,S.T., Munding,J.B., Vogt,M., Kuhlmann,J.D., Verdoodt,B.,
Nambiar,S., Maghnouj,A., Mirmohammadsadegh,A., Hahn,S.A. and
Tannapfel,A.
TITLE MicroRNA-148a is down-regulated in human pancreatic ductal
adenocarcinomas and regulates cell survival by targeting CDC25B
JOURNAL Lab. Invest. 91 (10), 1472-1479 (2011)
PUBMED 21709669
REMARK GeneRIF: We identified CDC25B as novel miR-148a target which may
confer a proliferative advantage in pancreatic ductal
adenocarcinomas.
REFERENCE 4 (bases 1 to 3578)
AUTHORS Lobjois,V., Froment,C., Braud,E., Grimal,F., Burlet-Schiltz,O.,
Ducommun,B. and Bouche,J.P.
TITLE Study of the docking-dependent PLK1 phosphorylation of the CDC25B
phosphatase
JOURNAL Biochem. Biophys. Res. Commun. 410 (1), 87-90 (2011)
PUBMED 21640712
REMARK GeneRIF: there are 13 sites phosphorylated by PLK1 in CDC25B.This
study illustrates the complexity of the phosphorylation pattern and
of the subsequent regulation of CDC25B activity.
REFERENCE 5 (bases 1 to 3578)
AUTHORS Nakamura,S., Nagata,Y., Tan,L., Takemura,T., Shibata,K., Fujie,M.,
Fujisawa,S., Tanaka,Y., Toda,M., Makita,R., Tsunekawa,K.,
Yamada,M., Yamaoka,M., Yamashita,J., Ohnishi,K. and Yamashita,M.
TITLE Transcriptional repression of Cdc25B by IER5 inhibits the
proliferation of leukemic progenitor cells through NF-YB and p300
in acute myeloid leukemia
JOURNAL PLoS ONE 6 (11), E28011 (2011)
PUBMED 22132193
REMARK GeneRIF: Transcriptional repression mediated by IER5 regulates
Cdc25B expression levels via the release of NF-YB and p300 in acute
myeloid leukemia.
REFERENCE 6 (bases 1 to 3578)
AUTHORS Baldin,V., Cans,C., Superti-Furga,G. and Ducommun,B.
TITLE Alternative splicing of the human CDC25B tyrosine phosphatase.
Possible implications for growth control?
JOURNAL Oncogene 14 (20), 2485-2495 (1997)
PUBMED 9188863
REFERENCE 7 (bases 1 to 3578)
AUTHORS Conklin,D.S., Galaktionov,K. and Beach,D.
TITLE 14-3-3 proteins associate with cdc25 phosphatases
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (17), 7892-7896 (1995)
PUBMED 7644510
REFERENCE 8 (bases 1 to 3578)
AUTHORS Galaktionov,K. and Beach,D.
TITLE Specific activation of cdc25 tyrosine phosphatases by B-type
cyclins: evidence for multiple roles of mitotic cyclins
JOURNAL Cell 67 (6), 1181-1194 (1991)
PUBMED 1836978
REFERENCE 9 (bases 1 to 3578)
AUTHORS Nagata,A., Igarashi,M., Jinno,S., Suto,K. and Okayama,H.
TITLE An additional homolog of the fission yeast cdc25+ gene occurs in
humans and is highly expressed in some cancer cells
JOURNAL New Biol. 3 (10), 959-968 (1991)
PUBMED 1662986
REFERENCE 10 (bases 1 to 3578)
AUTHORS Strausfeld,U., Labbe,J.C., Fesquet,D., Cavadore,J.C., Picard,A.,
Sadhu,K., Russell,P. and Doree,M.
TITLE Dephosphorylation and activation of a p34cdc2/cyclin B complex in
vitro by human CDC25 protein
JOURNAL Nature 351 (6323), 242-245 (1991)
PUBMED 1828290
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK092713.1, BC051711.1,
S78187.1, Z68092.1 and BX640836.1.
On May 7, 2004 this sequence version replaced gi:11641410.
Summary: CDC25B is a member of the CDC25 family of phosphatases.
CDC25B activates the cyclin dependent kinase CDC2 by removing two
phosphate groups and it is required for entry into mitosis. CDC25B
shuttles between the nucleus and the cytoplasm due to nuclear
localization and nuclear export signals. The protein is nuclear in
the M and G1 phases of the cell cycle and moves to the cytoplasm
during S and G2. CDC25B has oncogenic properties, although its role
in tumor formation has not been determined. Multiple transcript
variants for this gene exist. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (3), also known as CDC25B2, lacks
an alternate in-frame exon, compared to variant 1, resulting in a
shorter protein (isoform 3) compared to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: Z68092.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025095 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-86 AK092713.1 16-101
87-556 BC051711.1 6-475
557-745 S78187.1 19-207
746-2520 Z68092.1 69-1843
2521-2922 BC051711.1 2564-2965
2923-3543 BX640836.1 1984-2604
3544-3578 S78187.1 3084-3118
FEATURES Location/Qualifiers
source 1..3578
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="20"
/map="20p13"
gene 1..3578
/gene="CDC25B"
/note="cell division cycle 25B"
/db_xref="GeneID:994"
/db_xref="HGNC:1726"
/db_xref="HPRD:00307"
/db_xref="MIM:116949"
exon 1..978
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 69
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:183999341"
variation 158
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11569978"
variation 251
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:374054731"
misc_feature 470..472
/gene="CDC25B"
/note="upstream in-frame stop codon"
variation 568
/gene="CDC25B"
/replace="a"
/replace="t"
/db_xref="dbSNP:6116042"
variation 662
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:13038734"
variation 665..666
/gene="CDC25B"
/replace=""
/replace="c"
/db_xref="dbSNP:11462398"
variation 666..667
/gene="CDC25B"
/replace=""
/replace="c"
/db_xref="dbSNP:71678223"
variation 772
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11087603"
variation 775
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:372029025"
CDS 779..2398
/gene="CDC25B"
/EC_number="3.1.3.48"
/note="isoform 3 is encoded by transcript variant 3;
M-phase inducer phosphatase 2; dual specificity
phosphatase Cdc25B"
/codon_start=1
/product="M-phase inducer phosphatase 2 isoform 3"
/protein_id="NP_068658.1"
/db_xref="GI:11641411"
/db_xref="CCDS:CCDS13066.1"
/db_xref="GeneID:994"
/db_xref="HGNC:1726"
/db_xref="HPRD:00307"
/db_xref="MIM:116949"
/translation="
MEVPQPEPAPGSALSPAGVCGGAQRPGHLPGLLLGSHGLLGSPVRAAASSPVTTLTQTMHDLAGLGSETPKSQVGTLLFRSRSRLTHLSLSRRASESSLSSESSESSDAGLCMDSPSPMDPHMAEQTFEQAIQAASRIIRNEQFAIRRFQSMPDGFVFKMPWKPTHPSSTHALAEWASRREAFAQRPSSAPDLMCLSPDRKMEVEELSPLALGRFSLTPAEGDTEEDDGFVDILESDLKDDDAVPPGMESLISAPLVKTLEKEEEKDLVMYSKCQRLFRSPSMPCSVIRPILKRLERPQDRDTPVQNKRRRSVTPPEEQQEAEEPKARVLRSKSLCHDEIENLLDSDHRELIGDYSKAFLLQTVDGKHQDLKYISPETMVALLTGKFSNIVDKFVIVDCRYPYEYEGGHIKTAVNLPLERDAESFLLKSPIAPCSLDKRVILIFHCEFSSERGPRMCRFIRERDRAVNDYPSLYYPEMYILKGGYKEFFPQHPNFCEPQDYRPMNHEAFKDELKTFRLKTRSWAGERSRRELCSRLQDQ
"
misc_feature 1115..1807
/gene="CDC25B"
/note="M-phase inducer phosphatase; Region:
M-inducer_phosp; pfam06617"
/db_xref="CDD:115287"
misc_feature 1616..1618
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:06119"
misc_feature 1712..1714
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:04066"
misc_feature 1889..2248
/gene="CDC25B"
/note="Cdc25 phosphatases are members of the Rhodanese
Homology Domain superfamily. They activate the cell
division kinases throughout the cell cycle progression.
Cdc25 phosphatases dephosphorylate phosphotyrosine and
phosphothreonine residues, in order to...; Region: Cdc25;
cd01530"
/db_xref="CDD:29093"
misc_feature 2114..2134
/gene="CDC25B"
/note="oxyanion binding site; other site"
/db_xref="CDD:29093"
misc_feature 2114..2116
/gene="CDC25B"
/note="active site residue [active]"
/db_xref="CDD:29093"
variation 820
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11569979"
variation 838
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375122468"
variation 889
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368274446"
variation 953
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372183442"
variation 965
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:145700972"
variation 973
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:373847564"
exon 979..1106
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 984
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:373910055"
variation 1014
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:202156665"
variation 1017
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:76772959"
variation 1023
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:146567070"
variation 1031
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141031701"
variation 1038
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:375803588"
variation 1039
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:370072424"
variation 1063
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:201619391"
variation 1069
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374599445"
variation 1078
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:147311787"
variation 1081
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368877264"
variation 1091
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:199501910"
exon 1107..1158
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1126
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:371577332"
variation 1149
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376436608"
variation 1150
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:148241851"
variation 1154
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:141382375"
variation 1156
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:139123058"
variation 1158
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:370155414"
exon 1159..1200
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1159
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:150375046"
variation 1187
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:137919521"
variation 1188
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:143386679"
variation 1197
/gene="CDC25B"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:143369164"
exon 1201..1237
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1212
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:111654983"
variation 1220
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:147172963"
variation 1221
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371528141"
variation 1228
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:61755298"
variation 1231
/gene="CDC25B"
/replace="a"
/replace="t"
/db_xref="dbSNP:368675680"
variation 1232
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:140433155"
variation 1237
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201436986"
exon 1238..1360
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1242
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:202155757"
variation 1286
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:368042199"
variation 1307
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:142459784"
variation 1325
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:200968688"
exon 1361..1495
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1363..1364
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35741868"
variation 1367
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:111545759"
variation 1376
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:202222511"
variation 1377
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201435494"
variation 1419
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:151315259"
variation 1431
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:372916640"
variation 1432
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375854669"
variation 1433
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:202059655"
variation 1437
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:139531565"
variation 1490
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:373171092"
exon 1496..1576
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1511
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:144187197"
variation 1565
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:201902192"
variation 1575..1576
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35824153"
exon 1577..1753
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1582
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:145108436"
variation 1600
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:200104998"
variation 1613
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141314132"
variation 1620
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:375465349"
variation 1625
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371407165"
variation 1637
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:149795416"
variation 1643
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376224294"
variation 1686
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:369403610"
variation 1687
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372954698"
variation 1690
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:61746575"
variation 1707
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:376488245"
variation 1708
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:2228465"
exon 1754..1849
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1762
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:143612466"
variation 1765
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570010"
variation 1770
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:374005977"
variation 1805
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376924240"
variation 1808
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371158244"
variation 1823
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:138180783"
exon 1850..1912
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1873
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371343744"
exon 1913..2011
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 1922
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:2228464"
variation 1929
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:376914644"
variation 1930
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:146556613"
variation 1949
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:199832947"
exon 2012..2145
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2036
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:377681163"
variation 2037
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:138651339"
variation 2039
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:61742036"
variation 2041
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570015"
variation 2044
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:141229949"
variation 2069
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:370128666"
variation 2071
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056720"
variation 2073
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:61755297"
variation 2113
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374888909"
variation 2137
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:149394412"
variation 2141
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:199659921"
variation 2142
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:200957584"
exon 2146..2257
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2227
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:146399677"
variation 2251
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:143897481"
exon 2258..3552
/gene="CDC25B"
/inference="alignment:Splign:1.39.8"
variation 2272
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:374526361"
variation 2297
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11570019"
variation 2341
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:368410035"
variation 2354
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:371947700"
variation 2361
/gene="CDC25B"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:514523"
variation 2362
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:514521"
variation 2381
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:369357260"
variation 2394
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:200551395"
variation 2407
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:371951429"
variation 2417
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:372117595"
variation 2436
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:375603041"
variation 2462
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:41279402"
variation 2463
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:2229592"
variation 2526
/gene="CDC25B"
/replace=""
/replace="t"
/db_xref="dbSNP:201707296"
variation 2609
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570020"
variation 2620
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:368742502"
variation 2631
/gene="CDC25B"
/replace="g"
/replace="t"
/db_xref="dbSNP:139271260"
variation 2639
/gene="CDC25B"
/replace="a"
/replace="c"
/db_xref="dbSNP:55732615"
variation 2668
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:189019990"
variation 2748
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:6052085"
variation 2768
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11087604"
variation 2774
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11087605"
variation 2842
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:142635163"
variation 2883..2884
/gene="CDC25B"
/replace=""
/replace="a"
/db_xref="dbSNP:35980638"
variation 2896
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:11570021"
STS 2967..3303
/gene="CDC25B"
/standard_name="D20S1012"
/db_xref="UniSTS:32857"
variation 3037
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:181412320"
variation 3064..3085
/gene="CDC25B"
/replace=""
/replace="tacccactcggtcccagttttg"
/db_xref="dbSNP:71331068"
variation 3065..3086
/gene="CDC25B"
/replace=""
/replace="acccactcggtcccagttttgt"
/db_xref="dbSNP:11570022"
variation 3073
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:11570023"
variation 3135
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:367792437"
variation 3282
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:186687615"
variation 3357
/gene="CDC25B"
/replace="c"
/replace="t"
/db_xref="dbSNP:1803263"
STS 3404..3528
/gene="CDC25B"
/standard_name="SHGC-30160"
/db_xref="UniSTS:79344"
variation 3427
/gene="CDC25B"
/replace="c"
/replace="g"
/db_xref="dbSNP:8156"
variation 3471
/gene="CDC25B"
/replace="a"
/replace="g"
/db_xref="dbSNP:3516"
polyA_signal 3527..3532
/gene="CDC25B"
polyA_site 3548
/gene="CDC25B"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 3552
/gene="CDC25B"
ORIGIN
gcagccagtcgcggaggcggggaggctgcgcggtcagaggcgcctggagcgagcgaatcctggcccaccgcctgcccaaccgcgtgaccttgattgagttaatgaacttcacgcctcagcgtccaggtctgtaaaatggggtgtctaacgcagaccgtacagcccagctgggtttagcaaacttccgggagccagttggagcctctccccatccctagcggtgatcccaggtgacgacatgccgcggggggtcctgcggaggccaccctagggcgttgctgctgcctttgggagtgtggagctccaaaccatgtcgcgagaggcggattttgggaggccgggatcctcgcgccagggggatgtgcgagggtgtgggataaatcttaattcctccggcccacccaaagcctggaaatccagcctccgcgcctcttgccctgcgggccccgccctcagtcccgccctcatctaacccgctaccccattggtggcgtccggcggcgcggctgctgttatttttcgaatatataaggaggtggaagtggcagctgcaactagaggcttccctggctggtgcctgagcccggcgtccctcgccccccgccctccccgcatccctctcctccctcgcgcctggccctgtggctcttcctccctccctccttccccccccccccacccctcgcccgctgcctccctcggcccagccagctgtgccggcgtttgttggctgccctgcgcccggccctccagccagccttctgccggccccgccgcgatggaggtgccccagccggagcccgcgccaggctcggctctcagtccagcaggcgtgtgcggtggcgcccagcgtccgggccacctcccgggcctcctgctgggatctcatggcctcctggggtccccggtgcgggcggccgcttcctcgccggtcaccaccctcacccagaccatgcacgacctcgccgggctcggcagcgaaaccccaaagagtcaggtagggaccctgctcttccgcagccgcagccgcctgacgcacctatccctgtctcgacgggcatccgaatcctccctgtcgtctgaatcctccgaatcttctgatgcaggtctctgcatggattcccccagccctatggacccccacatggcggagcagacgtttgaacaggccatccaggcagccagccggatcattcgaaacgagcagtttgccatcagacgcttccagtctatgccggatggatttgtcttcaagatgccatggaagcccacacatcccagctccacccatgctctggcagagtgggccagccgcagggaagcctttgcccagagacccagctcggcccccgacctgatgtgtctcagtcctgaccggaagatggaagtggaggagctcagccccctggccctaggtcgcttctctctgacccctgcagagggggatactgaggaagatgatggatttgtggacatcctagagagtgacttaaaggatgatgatgcagttcccccaggcatggagagtctcattagtgccccactggtcaagaccttggaaaaggaagaggaaaaggacctcgtcatgtacagcaagtgccagcggctcttccgctctccgtccatgccctgcagcgtgatccggcccatcctcaagaggctggagcggccccaggacagggacacgcccgtgcagaataagcggaggcggagcgtgacccctcctgaggagcagcaggaggctgaggaacctaaagcccgcgtcctccgctcaaaatcactgtgtcacgatgagatcgagaacctcctggacagtgaccaccgagagctgattggagattactctaaggccttcctcctacagacagtagacggaaagcaccaagacctcaagtacatctcaccagaaacgatggtggccctattgacgggcaagttcagcaacatcgtggataagtttgtgattgtagactgcagatacccctatgaatatgaaggcgggcacatcaagactgcggtgaacttgcccctggaacgcgacgccgagagcttcctactgaagagccccatcgcgccctgtagcctggacaagagagtcatcctcattttccactgtgaattctcatctgagcgtgggccccgcatgtgccgtttcatcagggaacgagaccgtgctgtcaacgactaccccagcctctactaccctgagatgtatatcctgaaaggcggctacaaggagttcttccctcagcacccgaacttctgtgaaccccaggactaccggcccatgaaccacgaggccttcaaggatgagctaaagaccttccgcctcaagactcgcagctgggctggggagcggagccggcgggagctctgtagccggctgcaggaccagtgaggggcctgcgccagtcctgctacctcccttgcctttcgaggcctgaagccagctgccctatgggcctgccgggctgagggcctgctggaggcctcaggtgctgtccatgggaaagatggtgtgggtgtcctgcctgtctgccccagcccagattcccctgtgtcatcccatcattttccatatcctggtgccccccacccctggaagagcccagtctgttgagttagttaagttgggttaataccagcttaaaggcagtattttgtgtcctccaggagcttcttgtttccttgttagggttaacccttcatcttcctgtgtcctgaaacgctcctttgtgtgtgtgtcagctgaggctgggggagagccgtggtccctgaggatgggtcagagctaaactccttcctggcctgagagtcagctctctgccctgtgtacttcccgggccagggctgcccctaatctctgtaggaaccgtggtatgtctgccatgttgcccctttctcttttcccctttcctgtcccaccatacgagcacctccagcctgaacagaagctcttactctttcctatttcagtgttacctgtgtgcttggtctgtttgactttacgcccatctcaggacacttccgtagactgtttaggttcccctgtcaaatatcagttacccactcggtcccagttttgttgccccagaaagggatgttattatccttgggggctcccagggcaagggttaaggcctgaatcatgagcctgctggaagcccagcccctactgctgtgaaccctggggcctgactgctcagaacttgctgctgtcttgttgcggatggatggaaggttggatggatgggtggatggccgtggatggccgtggatgcgcagtgccttgcatacccaaaccaggtgggagcgttttgttgagcatgacagcctgcagcaggaatatatgtgtgcctatttgtgtggacaaaaatatttacacttagggtttggagctattcaagaggaaatgtcacagaagcagctaaaccaaggactgagcaccctctggattctgaatctcaagatgggggcagggctgtgcttgaaggccctgctgagtcatctgttagggccttggttcaataaagcactgagcaagttgagaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:994 -> Molecular function: GO:0004725 [protein tyrosine phosphatase activity] evidence: TAS
GeneID:994 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
GeneID:994 -> Biological process: GO:0000086 [G2/M transition of mitotic cell cycle] evidence: TAS
GeneID:994 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:994 -> Biological process: GO:0001556 [oocyte maturation] evidence: IEA
GeneID:994 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:994 -> Biological process: GO:0007067 [mitosis] evidence: IEA
GeneID:994 -> Biological process: GO:0007144 [female meiosis I] evidence: IEA
GeneID:994 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: TAS
GeneID:994 -> Biological process: GO:0032467 [positive regulation of cytokinesis] evidence: IMP
GeneID:994 -> Biological process: GO:0035335 [peptidyl-tyrosine dephosphorylation] evidence: TAS
GeneID:994 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IEA
GeneID:994 -> Biological process: GO:0045931 [positive regulation of mitotic cell cycle] evidence: IMP
GeneID:994 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:994 -> Cellular component: GO:0000922 [spindle pole] evidence: IDA
GeneID:994 -> Cellular component: GO:0005622 [intracellular] evidence: NAS
GeneID:994 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:994 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
GeneID:994 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_068658 -> EC 3.1.3.48
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.