LOCUS       NM_021192               1463 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens homeobox D11 (HOXD11), mRNA.
ACCESSION   NM_021192
VERSION     NM_021192.2  GI:23510367
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1463)
  AUTHORS   Sugie,Y., Sugie,H., Fukuda,T. and Osawa,J.
  TITLE     Study of HOXD genes in autism particularly regarding the ratio of
            second to fourth digit length
  JOURNAL   Brain Dev. 32 (5), 356-361 (2010)
   PUBMED   19540081
  REMARK    GeneRIF: data show no significant difference in HOXD11, HOXD12 &
            HOXD13 genotype frequencies between the autism spectrum disorder &
            healthy controls, but one SNP in promoter region of HOXD11 was
            observed in only 4 patients with ASD
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   2  (bases 1 to 1463)
  AUTHORS   Woo,C.J., Kharchenko,P.V., Daheron,L., Park,P.J. and Kingston,R.E.
  TITLE     A region of the human HOXD cluster that confers polycomb-group
            responsiveness
  JOURNAL   Cell 140 (1), 99-110 (2010)
   PUBMED   20085705
  REMARK    GeneRIF: In human embryonic stem cell (hESCs)differentiation, a
            1.8kb region between HOXD11 and HOXD12 (D11.12) that is associated
            with PcG proteins was discovered, it shows alteration in nuclease
            sensitivity as hESCs differentiate.
REFERENCE   3  (bases 1 to 1463)
  AUTHORS   Ester,A.R., Weymouth,K.S., Burt,A., Wise,C.A., Scott,A.,
            Gurnett,C.A., Dobbs,M.B., Blanton,S.H. and Hecht,J.T.
  TITLE     Altered transmission of HOX and apoptotic SNPs identify a potential
            common pathway for clubfoot
  JOURNAL   Am. J. Med. Genet. A 149A (12), 2745-2752 (2009)
   PUBMED   19938081
  REMARK    GeneRIF: Observational study of gene-disease association and
            gene-gene interaction. (HuGE Navigator)
REFERENCE   4  (bases 1 to 1463)
  AUTHORS   Yerges,L.M., Klei,L., Cauley,J.A., Roeder,K., Kammerer,C.M.,
            Moffett,S.P., Ensrud,K.E., Nestlerode,C.S., Marshall,L.M.,
            Hoffman,A.R., Lewis,C., Lang,T.F., Barrett-Connor,E., Ferrell,R.E.,
            Orwoll,E.S. and Zmuda,J.M.
  CONSRTM   MrOS Research Group
  TITLE     High-density association study of 383 candidate genes for
            volumetric BMD at the femoral neck and lumbar spine among older men
  JOURNAL   J. Bone Miner. Res. 24 (12), 2039-2049 (2009)
   PUBMED   19453261
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 1463)
  AUTHORS   Bouba,I., Siomou,E., Stefanidis,C.J., Emmanouilidou,A., Galidi,A.,
            Hatzi,E., Markoula,S., Mitsioni,A., Siamopoulou,A. and Georgiou,I.
  TITLE     Absence of mutations in the HOXA11 and HOXD11 genes in children
            with congenital renal malformations
  JOURNAL   Pediatr. Nephrol. 24 (8), 1569-1572 (2009)
   PUBMED   19255789
  REMARK    GeneRIF: Our findings do not support the hypothesis that mutations
            in the HOXD11 coding regions are involved in the pathogenesis of
            human non-syndromal congenital renal parenchymal malformations.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   6  (bases 1 to 1463)
  AUTHORS   Del Campo,M., Jones,M.C., Veraksa,A.N., Curry,C.J., Jones,K.L.,
            Mascarello,J.T., Ali-Kahn-Catts,Z., Drumheller,T. and McGinnis,W.
  TITLE     Monodactylous limbs and abnormal genitalia are associated with
            hemizygosity for the human 2q31 region that includes the HOXD
            cluster
  JOURNAL   Am. J. Hum. Genet. 65 (1), 104-110 (1999)
   PUBMED   10364522
REFERENCE   7  (bases 1 to 1463)
  AUTHORS   Herault,Y., Beckers,J., Gerard,M. and Duboule,D.
  TITLE     Hox gene expression in limbs: colinearity by opposite regulatory
            controls
  JOURNAL   Dev. Biol. 208 (1), 157-165 (1999)
   PUBMED   10075849
REFERENCE   8  (bases 1 to 1463)
  AUTHORS   Shen,W.F., Montgomery,J.C., Rozenfeld,S., Moskow,J.J.,
            Lawrence,H.J., Buchberg,A.M. and Largman,C.
  TITLE     AbdB-like Hox proteins stabilize DNA binding by the Meis1
            homeodomain proteins
  JOURNAL   Mol. Cell. Biol. 17 (11), 6448-6458 (1997)
   PUBMED   9343407
REFERENCE   9  (bases 1 to 1463)
  AUTHORS   Johnson,R.L. and Tabin,C.J.
  TITLE     Molecular models for vertebrate limb development
  JOURNAL   Cell 90 (6), 979-990 (1997)
   PUBMED   9323126
  REMARK    Review article
REFERENCE   10 (bases 1 to 1463)
  AUTHORS   Acampora,D., D'Esposito,M., Faiella,A., Pannese,M., Migliaccio,E.,
            Morelli,F., Stornaiuolo,A., Nigro,V., Simeone,A. and Boncinelli,E.
  TITLE     The human HOX gene family
  JOURNAL   Nucleic Acids Res. 17 (24), 10385-10402 (1989)
   PUBMED   2574852
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AF154915.1 and BE260674.1.
            On Oct 7, 2002 this sequence version replaced gi:10864000.
            
            Summary: This gene belongs to the homeobox family of genes. The
            homeobox genes encode a highly conserved family of transcription
            factors that play an important role in morphogenesis in all
            multicellular organisms. Mammals possess four similar homeobox gene
            clusters, HOXA, HOXB, HOXC and HOXD, located on different
            chromosomes, consisting of 9 to 11 genes arranged in tandem. This
            gene is one of several homeobox HOXD genes located in a cluster on
            chromosome 2. Deletions that remove the entire HOXD gene cluster or
            the 5' end of this cluster have been associated with severe limb
            and genital abnormalities. The product of the mouse Hoxd11 gene
            plays a role in forelimb morphogenesis. [provided by RefSeq, Jul
            2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AI139039.1, AI139039.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025088, ERS025092 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1463
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31.1"
     gene            1..1463
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /note="homeobox D11"
                     /db_xref="GeneID:3237"
                     /db_xref="HGNC:5134"
                     /db_xref="HPRD:00869"
                     /db_xref="MIM:142986"
     STS             1..1118
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /db_xref="UniSTS:482718"
     STS             1..1067
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /db_xref="UniSTS:481748"
     CDS             1..1017
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /note="homeo box D11; Hox-4.6, mouse, homolog of; homeo
                     box 4F; homeobox protein Hox-4F"
                     /codon_start=1
                     /product="homeobox protein Hox-D11"
                     /protein_id="NP_067015.2"
                     /db_xref="GI:23510368"
                     /db_xref="CCDS:CCDS2265.1"
                     /db_xref="GeneID:3237"
                     /db_xref="HGNC:5134"
                     /db_xref="HPRD:00869"
                     /db_xref="MIM:142986"
                     /translation="

MNDFDECGQSAASMYLPGCAYYVAPSDFASKPSFLSQPSSCQMTFPYSSNLAPHVQPVREVAFRDYGLERAKWPYRGGGGGGSAGGGSSGGGPGGGGGGAGGYAPYYAAAAAAAAAAAAAEEAAMQRELLPPAGRRPDVLFKAPEPVCAAPGPPHGPAGAASNFYSAVGRNGILPQGFDQFYEAAPGPPFAGPQPPPPPAPPQPEGAADKGDPRTGAGGGGGSPCTKATPGSEPKGAAEGSGGDGEGPPGEAGAEKSSSAVAPQRSRKKRCPYTKYQIRELEREFFFNVYINKEKRLQLSRMLNLTDRQVKIWFQNRRMKEKKLNRDRLQYFTGNPLF

"
     misc_feature    76..>546
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /note="Protein of unknown function (DUF3528); Region:
                     DUF3528; pfam12045"
                     /db_xref="CDD:152480"
     misc_feature    799..969
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(799..813,817..819,868..870,886..888,925..927,
                     931..936,943..948,952..960,964..969)
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(805..807,814..816,934..936,943..948,955..957)
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            1..781
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /inference="alignment:Splign:1.39.8"
     variation       1
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368940007"
     variation       15
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373484117"
     variation       25
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376820727"
     variation       32
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369053074"
     variation       85
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149509317"
     variation       153
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373052673"
     variation       156
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141812814"
     variation       159
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146278916"
     variation       181
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368573737"
     variation       211
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371551703"
     variation       347..348
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace=""
                     /replace="tgcggc"
                     /db_xref="dbSNP:35035619"
     variation       405
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111816201"
     variation       706
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112003616"
     variation       734
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376305712"
     exon            782..1463
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /inference="alignment:Splign:1.39.8"
     variation       785
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369831126"
     variation       791
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200498866"
     variation       804
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142296120"
     variation       809
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377313208"
     variation       828
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139282132"
     STS             843..955
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /standard_name="Hoxd11"
                     /db_xref="UniSTS:536668"
     variation       871
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142560088"
     variation       879
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78492630"
     variation       943
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199668165"
     variation       947
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201893095"
     variation       954
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138394594"
     variation       955
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200581206"
     variation       972
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141775342"
     variation       981
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200124286"
     variation       1013
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202193020"
     variation       1030
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201268571"
     variation       1040
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200232040"
     variation       1045
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373344847"
     variation       1060
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184710706"
     variation       1251
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:863678"
     variation       1262..1263
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:139208090"
     variation       1266
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12995279"
     variation       1267
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12995280"
     variation       1269
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6745764"
     variation       1327
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189079614"
     variation       1328
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114956387"
     variation       1448..1449
                     /gene="HOXD11"
                     /gene_synonym="HOX4; HOX4F"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34390618"
ORIGIN      

atgaacgactttgacgagtgcggccagagcgcagccagcatgtacctgccgggctgcgcctactatgtggccccgtctgacttcgctagcaagccttcgttcctttcccaaccgtcgtcctgccagatgactttcccctactcttccaacctggctccgcacgtccagcccgtgcgcgaagtggccttccgcgactacggcctggagcgcgccaagtggccgtaccgcggcggcggcggcggcggcagcgcggggggcggcagcagcgggggcggccccggcgggggcggcggcggcgcggggggctacgctccctactacgcggcggcggcggcggcggctgcggcggccgcggcggccgaggaggcggccatgcaacgcgagcttctcccgcccgcgggccgccggccggacgtgctcttcaaggcgcctgagccggtgtgcgctgcgccggggccgccgcacggccccgcgggcgccgcctccaacttctacagcgcggtgggccgcaatggcatcttgccacagggcttcgaccagttctacgaggcagcgcccgggcccccgttcgccgggccgcagcccccgccgccacccgcgccgccacagcccgagggcgcagccgacaagggcgaccccaggaccggggctggtggcggcgggggcagtccctgcaccaaggcgacccctggctcggagcccaagggggcagcagaaggcagcggtggcgacggcgagggccccccgggagaggcgggggccgagaagagcagcagcgcagttgccccccagcggtcccggaaaaagcgctgtccctataccaagtaccagatccgcgaactggaacgcgagtttttctttaacgtgtacataaacaaagagaaaagacttcaactctctcggatgctcaacctcactgaccggcaagtcaaaatctggttccagaatcgcaggatgaaagaaaagaaactgaacagagaccgtctgcagtatttcactggaaaccccttattttgagagctccaggaagcgccctcaccccagccccactcacccaccctccttcccaccagcctgctctccgcaggcccactgtccttgggtttaatgacgtctcttctctgtggaacttcacgattccttcccacggtcaactcgggacctcccagcgaccactgcagcctgcggacgaggccgggacttggccgagcggatcctaataaggggaaaatggtaaatgcaaacgtcccgttacaattttaccgccagtgtgctgtcgttccccctccccctctccgagtcctcgtggggacacggcggggtctgtaggaagttgggccgggttgggggttgctagaaggcgctggtgttttgctctgagttttaagagatcccttccttcctcttcggtgaatgcaggttatttaaactttgggaaatgtacttttagtctgtcatatcaa

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3237 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: NAS
            GeneID:3237 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:3237 -> Biological process: GO:0001656 [metanephros development] evidence: IEA
            GeneID:3237 -> Biological process: GO:0001658 [branching involved in ureteric bud morphogenesis] evidence: ISS
            GeneID:3237 -> Biological process: GO:0001759 [organ induction] evidence: IEA
            GeneID:3237 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:3237 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS
            GeneID:3237 -> Biological process: GO:0009952 [anterior/posterior pattern specification] evidence: IEA
            GeneID:3237 -> Biological process: GO:0009953 [dorsal/ventral pattern formation] evidence: ISS
            GeneID:3237 -> Biological process: GO:0009954 [proximal/distal pattern formation] evidence: IEA
            GeneID:3237 -> Biological process: GO:0010720 [positive regulation of cell development] evidence: IEA
            GeneID:3237 -> Biological process: GO:0032332 [positive regulation of chondrocyte differentiation] evidence: IEA
            GeneID:3237 -> Biological process: GO:0035115 [embryonic forelimb morphogenesis] evidence: IEA
            GeneID:3237 -> Biological process: GO:0042733 [embryonic digit morphogenesis] evidence: IEA
            GeneID:3237 -> Biological process: GO:0048589 [developmental growth] evidence: IEA
            GeneID:3237 -> Biological process: GO:0060272 [embryonic skeletal joint morphogenesis] evidence: IEA
            GeneID:3237 -> Biological process: GO:0060351 [cartilage development involved in endochondral bone morphogenesis] evidence: IEA
            GeneID:3237 -> Cellular component: GO:0005634 [nucleus] evidence: NAS