Home |
Help |
Advanced search
2024-04-21 00:45:27, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_020996 744 bp mRNA linear PRI 15-JUN-2013
DEFINITION Homo sapiens fibroblast growth factor 6 (FGF6), mRNA.
ACCESSION NM_020996
VERSION NM_020996.1 GI:10337586
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 744)
AUTHORS Jia,W.H., Zhang,B., Matsuo,K., Shin,A., Xiang,Y.B., Jee,S.H.,
Kim,D.H., Ren,Z., Cai,Q., Long,J., Shi,J., Wen,W., Yang,G.,
Delahanty,R.J., Ji,B.T., Pan,Z.Z., Matsuda,F., Gao,Y.T., Oh,J.H.,
Ahn,Y.O., Park,E.J., Li,H.L., Park,J.W., Jo,J., Jeong,J.Y.,
Hosono,S., Casey,G., Peters,U., Shu,X.O., Zeng,Y.X. and Zheng,W.
CONSRTM Colon Cancer Family Registry (CCFR); Genetics and Epidemiology of
Colorectal Cancer Consortium (GECCO)
TITLE Genome-wide association analyses in East Asians identify new
susceptibility loci for colorectal cancer
JOURNAL Nat. Genet. 45 (2), 191-196 (2013)
PUBMED 23263487
REFERENCE 2 (bases 1 to 744)
AUTHORS Bosetti,M., Leigheb,M., Brooks,R.A., Boccafoschi,F. and Cannas,M.F.
TITLE Regulation of osteoblast and osteoclast functions by FGF-6
JOURNAL J. Cell. Physiol. 225 (2), 466-471 (2010)
PUBMED 20458746
REMARK GeneRIF: These data demonstrate that FGF-6 may be considered a
regulator of bone metabolism as shown by its activity on both
osteoblasts and osteoclasts.
REFERENCE 3 (bases 1 to 744)
AUTHORS Kestenbaum,B., Glazer,N.L., Kottgen,A., Felix,J.F., Hwang,S.J.,
Liu,Y., Lohman,K., Kritchevsky,S.B., Hausman,D.B., Petersen,A.K.,
Gieger,C., Ried,J.S., Meitinger,T., Strom,T.M., Wichmann,H.E.,
Campbell,H., Hayward,C., Rudan,I., de Boer,I.H., Psaty,B.M.,
Rice,K.M., Chen,Y.D., Li,M., Arking,D.E., Boerwinkle,E., Coresh,J.,
Yang,Q., Levy,D., van Rooij,F.J., Dehghan,A., Rivadeneira,F.,
Uitterlinden,A.G., Hofman,A., van Duijn,C.M., Shlipak,M.G.,
Kao,W.H., Witteman,J.C., Siscovick,D.S. and Fox,C.S.
TITLE Common genetic variants associate with serum phosphorus
concentration
JOURNAL J. Am. Soc. Nephrol. 21 (7), 1223-1232 (2010)
PUBMED 20558539
REFERENCE 4 (bases 1 to 744)
AUTHORS Moffa,A.B. and Ethier,S.P.
TITLE Differential signal transduction of alternatively spliced FGFR2
variants expressed in human mammary epithelial cells
JOURNAL J. Cell. Physiol. 210 (3), 720-731 (2007)
PUBMED 17133345
REFERENCE 5 (bases 1 to 744)
AUTHORS Zhang,X., Ibrahimi,O.A., Olsen,S.K., Umemori,H., Mohammadi,M. and
Ornitz,D.M.
TITLE Receptor specificity of the fibroblast growth factor family. The
complete mammalian FGF family
JOURNAL J. Biol. Chem. 281 (23), 15694-15700 (2006)
PUBMED 16597617
REFERENCE 6 (bases 1 to 744)
AUTHORS Vainikka,S., Partanen,J., Bellosta,P., Coulier,F., Birnbaum,D.,
Basilico,C., Jaye,M. and Alitalo,K.
TITLE Fibroblast growth factor receptor-4 shows novel features in genomic
structure, ligand binding and signal transduction
JOURNAL EMBO J. 11 (12), 4273-4280 (1992)
PUBMED 1385111
REMARK Erratum:[EMBO J 1993 Feb;12(2):810]
REFERENCE 7 (bases 1 to 744)
AUTHORS Iida,S., Yoshida,T., Naito,K., Sakamoto,H., Katoh,O., Hirohashi,S.,
Sato,T., Onda,M., Sugimura,T. and Terada,M.
TITLE Human hst-2 (FGF-6) oncogene: cDNA cloning and characterization
JOURNAL Oncogene 7 (2), 303-309 (1992)
PUBMED 1549352
REFERENCE 8 (bases 1 to 744)
AUTHORS Coulier,F., Batoz,M., Marics,I., de Lapeyriere,O. and Birnbaum,D.
TITLE Putative structure of the FGF6 gene product and role of the signal
peptide
JOURNAL Oncogene 6 (8), 1437-1444 (1991)
PUBMED 1886714
REFERENCE 9 (bases 1 to 744)
AUTHORS Dionne,C.A., Crumley,G., Bellot,F., Kaplow,J.M., Searfoss,G.,
Ruta,M., Burgess,W.H., Jaye,M. and Schlessinger,J.
TITLE Cloning and expression of two distinct high-affinity receptors
cross-reacting with acidic and basic fibroblast growth factors
JOURNAL EMBO J. 9 (9), 2685-2692 (1990)
PUBMED 1697263
REFERENCE 10 (bases 1 to 744)
AUTHORS Marics,I., Adelaide,J., Raybaud,F., Mattei,M.G., Coulier,F.,
Planche,J., de Lapeyriere,O. and Birnbaum,D.
TITLE Characterization of the HST-related FGF.6 gene, a new member of the
fibroblast growth factor gene family
JOURNAL Oncogene 4 (3), 335-340 (1989)
PUBMED 2649847
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from X63454.1.
Summary: The protein encoded by this gene is a member of the
fibroblast growth factor (FGF) family. FGF family members possess
broad mitogenic and cell survival activities, and are involved in a
variety of biological processes, including embryonic development,
cell growth, morphogenesis, tissue repair, tumor growth and
invasion. This gene displayed oncogenic transforming activity when
transfected into mammalian cells. The mouse homolog of this gene
exhibits a restricted expression profile predominantly in the
myogenic lineage, which suggested a role in muscle regeneration or
differentiation. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: X63454.1, BC121097.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025084, ERS025088 [ECO:0000350]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..744
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="12"
/map="12p13"
gene 1..744
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/note="fibroblast growth factor 6"
/db_xref="GeneID:2251"
/db_xref="HGNC:3684"
/db_xref="HPRD:00623"
/db_xref="MIM:134921"
STS 1..721
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/db_xref="UniSTS:480860"
exon 1..390
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/inference="alignment:Splign:1.39.8"
STS 12..691
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/db_xref="UniSTS:482119"
STS 17..738
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/db_xref="UniSTS:490467"
misc_feature 30..32
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/note="upstream in-frame stop codon"
CDS 45..671
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/note="FGF-6; HST-2; HSTF-2; heparin-binding growth factor
6; heparin secretory-transforming protein 2"
/codon_start=1
/product="fibroblast growth factor 6 precursor"
/protein_id="NP_066276.2"
/db_xref="GI:15147343"
/db_xref="CCDS:CCDS8527.1"
/db_xref="GeneID:2251"
/db_xref="HGNC:3684"
/db_xref="HPRD:00623"
/db_xref="MIM:134921"
/translation="
MALGQKLFITMSRGAGRLQGTLWALVFLGILVGMVVPSPAGTRANNTLLDSRGWGTLLSRSRAGLAGEIAGVNWESGYLVGIKRQRRLYCNVGIGFHLQVLPDGRISGTHEENPYSLLEISTVERGVVSLFGVRSALFVAMNSKGRLYATPSFQEECKFRETLLPNNYNAYESDLYQGTYIALSKYGRVKRGSKVSPIMTVTHFLPRI
"
sig_peptide 45..155
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
misc_feature 75..77
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Region: alternative start codon"
misc_feature 144..146
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Region: alternative start codon"
mat_peptide 156..638
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/product="fibroblast growth factor 6"
misc_feature 300..668
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/note="Acidic and basic fibroblast growth factor family;
FGFs are mitogens, which stimulate growth or
differentiation of cells of mesodermal or neuroectodermal
origin. The family plays essential roles in patterning and
differentiation during vertebrate...; Region: FGF;
cd00058"
/db_xref="CDD:28940"
misc_feature order(300..302,309..311,405..407,411..413,417..419,
501..503,525..527,534..551,555..557,651..653,657..659,
663..665)
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/note="receptor interaction site; other site"
/db_xref="CDD:28940"
misc_feature order(594..599,612..614,624..626,642..644)
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/note="heparin binding site (glycine box) [chemical
binding]; other site"
/db_xref="CDD:28940"
variation 119
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/replace="c"
/replace="t"
/db_xref="dbSNP:17183515"
variation 232
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/replace="c"
/replace="t"
/db_xref="dbSNP:17183529"
exon 391..494
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/inference="alignment:Splign:1.39.8"
variation 410
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2241279"
variation 461
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2241280"
exon 495..744
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/inference="alignment:Splign:1.39.8"
variation 615
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/replace="c"
/replace="t"
/db_xref="dbSNP:17183778"
variation 691
/gene="FGF6"
/gene_synonym="HBGF-6; HST2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2241286"
ORIGIN
tttagggccattaattctgaccacgtgcctgagaggcaaggtggatggccctgggacagaaactgttcatcactatgtcccggggagcaggacgtctgcagggcacgctgtgggctctcgtcttcctaggcatcctagtgggcatggtggtgccctcgcctgcaggcacccgtgccaacaacacgctgctggactcgaggggctggggcaccctgctgtccaggtctcgcgcggggctagctggagagattgccggggtgaactgggaaagtggctatttggtggggatcaagcggcagcggaggctctactgcaacgtgggcatcggctttcacctccaggtgctccccgacggccggatcagcgggacccacgaggagaacccctacagcctgctggaaatttccactgtggagcgaggcgtggtgagtctctttggagtgagaagtgccctcttcgttgccatgaacagtaaaggaagattgtacgcaacgcccagcttccaagaagaatgcaagttcagagaaaccctcctgcccaacaattacaatgcctacgagtcagacttgtaccaagggacctacattgccctgagcaaatacggacgggtaaagcggggcagcaaggtgtccccgatcatgactgtcactcatttccttcccaggatctaaggacccacaaaagaaggcttacagatttaaagcatcatctgttcgattgaaattttgcaccagcgaagaattc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:2251 -> Molecular function: GO:0008083 [growth factor activity] evidence: IEA
GeneID:2251 -> Biological process: GO:0001502 [cartilage condensation] evidence: IEA
GeneID:2251 -> Biological process: GO:0001525 [angiogenesis] evidence: IEA
GeneID:2251 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:2251 -> Biological process: GO:0007173 [epidermal growth factor receptor signaling pathway] evidence: TAS
GeneID:2251 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS
GeneID:2251 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:2251 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: IGI
GeneID:2251 -> Biological process: GO:0008286 [insulin receptor signaling pathway] evidence: TAS
GeneID:2251 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: IGI
GeneID:2251 -> Biological process: GO:0008543 [fibroblast growth factor receptor signaling pathway] evidence: TAS
GeneID:2251 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: TAS
GeneID:2251 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:2251 -> Biological process: GO:0045445 [myoblast differentiation] evidence: IEA
GeneID:2251 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS
GeneID:2251 -> Biological process: GO:0048015 [phosphatidylinositol-mediated signaling] evidence: TAS
GeneID:2251 -> Biological process: GO:0051781 [positive regulation of cell division] evidence: IEA
GeneID:2251 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:2251 -> Cellular component: GO:0005615 [extracellular space] evidence: IEA
GeneID:2251 -> Cellular component: GO:0042383 [sarcolemma] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.