Home |
Help |
Advanced search
2024-04-20 04:23:43, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_020799 2094 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens STAM binding protein-like 1 (STAMBPL1), mRNA.
ACCESSION NM_020799
VERSION NM_020799.3 GI:375298740
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2094)
AUTHORS Lavorgna,A. and Harhaj,E.W.
TITLE An RNA interference screen identifies the Deubiquitinase STAMBPL1
as a critical regulator of human T-cell leukemia virus type 1 tax
nuclear export and NF-kappaB activation
JOURNAL J. Virol. 86 (6), 3357-3369 (2012)
PUBMED 22258247
REMARK GeneRIF: Cellular STAMBPL1 is a positive regulator of human T-cell
leukemia virus type 1 Tax-mediated NF-kappaB signaling.
Erratum:[J Virol. 2012 May;86(9):5409]
REFERENCE 2 (bases 1 to 2094)
AUTHORS Reyes-Ibarra,A.P., Garcia-Regalado,A., Ramirez-Rangel,I.,
Esparza-Silva,A.L., Valadez-Sanchez,M., Vazquez-Prado,J. and
Reyes-Cruz,G.
TITLE Calcium-sensing receptor endocytosis links extracellular calcium
signaling to parathyroid hormone-related peptide secretion via a
Rab11a-dependent and AMSH-sensitive mechanism
JOURNAL Mol. Endocrinol. 21 (6), 1394-1407 (2007)
PUBMED 17426287
REMARK GeneRIF: AMSH redirects CaR from slow recycling to down-regulation,
reducing CaR expression and decreasing PTHrP secretion.
REFERENCE 3 (bases 1 to 2094)
AUTHORS Nakamura,M., Tanaka,N., Kitamura,N. and Komada,M.
TITLE Clathrin anchors deubiquitinating enzymes, AMSH and AMSH-like
protein, on early endosomes
JOURNAL Genes Cells 11 (6), 593-606 (2006)
PUBMED 16716190
REMARK GeneRIF: AMSH and AMSH-LP are anchored on the early endosomal
membrane via interaction with the clathrin coat
REFERENCE 4 (bases 1 to 2094)
AUTHORS Grupe,A., Li,Y., Rowland,C., Nowotny,P., Hinrichs,A.L., Smemo,S.,
Kauwe,J.S., Maxwell,T.J., Cherny,S., Doil,L., Tacey,K., van
Luchene,R., Myers,A., Wavrant-De Vrieze,F., Kaleem,M.,
Hollingworth,P., Jehu,L., Foy,C., Archer,N., Hamilton,G.,
Holmans,P., Morris,C.M., Catanese,J., Sninsky,J., White,T.J.,
Powell,J., Hardy,J., O'Donovan,M., Lovestone,S., Jones,L.,
Morris,J.C., Thal,L., Owen,M., Williams,J. and Goate,A.
TITLE A scan of chromosome 10 identifies a novel locus showing strong
association with late-onset Alzheimer disease
JOURNAL Am. J. Hum. Genet. 78 (1), 78-88 (2006)
PUBMED 16385451
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 5 (bases 1 to 2094)
AUTHORS Deloukas,P., Earthrowl,M.E., Grafham,D.V., Rubenfield,M.,
French,L., Steward,C.A., Sims,S.K., Jones,M.C., Searle,S.,
Scott,C., Howe,K., Hunt,S.E., Andrews,T.D., Gilbert,J.G.,
Swarbreck,D., Ashurst,J.L., Taylor,A., Battles,J., Bird,C.P.,
Ainscough,R., Almeida,J.P., Ashwell,R.I., Ambrose,K.D.,
Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Bates,K.,
Beasley,H., Bray-Allen,S., Brown,A.J., Brown,J.Y., Burford,D.C.,
Burrill,W., Burton,J., Cahill,P., Camire,D., Carter,N.P.,
Chapman,J.C., Clark,S.Y., Clarke,G., Clee,C.M., Clegg,S., Corby,N.,
Coulson,A., Dhami,P., Dutta,I., Dunn,M., Faulkner,L., Frankish,A.,
Frankland,J.A., Garner,P., Garnett,J., Gribble,S., Griffiths,C.,
Grocock,R., Gustafson,E., Hammond,S., Harley,J.L., Hart,E.,
Heath,P.D., Ho,T.P., Hopkins,B., Horne,J., Howden,P.J., Huckle,E.,
Hynds,C., Johnson,C., Johnson,D., Kana,A., Kay,M., Kimberley,A.M.,
Kershaw,J.K., Kokkinaki,M., Laird,G.K., Lawlor,S., Lee,H.M.,
Leongamornlert,D.A., Laird,G., Lloyd,C., Lloyd,D.M., Loveland,J.,
Lovell,J., McLaren,S., McLay,K.E., McMurray,A.,
Mashreghi-Mohammadi,M., Matthews,L., Milne,S., Nickerson,T.,
Nguyen,M., Overton-Larty,E., Palmer,S.A., Pearce,A.V., Peck,A.I.,
Pelan,S., Phillimore,B., Porter,K., Rice,C.M., Rogosin,A.,
Ross,M.T., Sarafidou,T., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
Smith,M., Standring,L., Sycamore,N., Tester,J., Thorpe,A.,
Torcasso,W., Tracey,A., Tromans,A., Tsolas,J., Wall,M., Walsh,J.,
Wang,H., Weinstock,K., West,A.P., Willey,D.L., Whitehead,S.L.,
Wilming,L., Wray,P.W., Young,L., Chen,Y., Lovering,R.C.,
Moschonas,N.K., Siebert,R., Fechtel,K., Bentley,D., Durbin,R.,
Hubbard,T., Doucette-Stamm,L., Beck,S., Smith,D.R. and Rogers,J.
TITLE The DNA sequence and comparative analysis of human chromosome 10
JOURNAL Nature 429 (6990), 375-381 (2004)
PUBMED 15164054
REFERENCE 6 (bases 1 to 2094)
AUTHORS Ibarrola,N., Kratchmarova,I., Nakajima,D., Schiemann,W.P.,
Moustakas,A., Pandey,A. and Mann,M.
TITLE Cloning of a novel signaling molecule, AMSH-2, that potentiates
transforming growth factor beta signaling
JOURNAL BMC Cell Biol. 5, 2 (2004)
PUBMED 14728725
REMARK Publication Status: Online-Only
REFERENCE 7 (bases 1 to 2094)
AUTHORS Kitajima,K., Matsumoto,K., Tahara,M., Takahashi,H., Nakamura,T. and
Nakamura,T.
TITLE A newly identified AMSH-family protein is specifically expressed in
haploid stages of testicular germ cells
JOURNAL Biochem. Biophys. Res. Commun. 309 (1), 135-142 (2003)
PUBMED 12943674
REFERENCE 8 (bases 1 to 2094)
AUTHORS Kikuchi,K., Ishii,N., Asao,H. and Sugamura,K.
TITLE Identification of AMSH-LP containing a Jab1/MPN domain
metalloenzyme motif
JOURNAL Biochem. Biophys. Res. Commun. 306 (3), 637-643 (2003)
PUBMED 12810066
REMARK GeneRIF: Data show that associated molecule with the SH3 domain of
STAM-like protein (AMSH-LP), unlike AMSH, fails to bind to the SH3
domains of STAM1 (signal transducing adaptor molecule 1) and Grb2.
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
CD244526.1, AK056086.1 and AW006657.1.
On Feb 14, 2012 this sequence version replaced gi:52694663.
##Evidence-Data-START##
Transcript exon combination :: AK056086.1, BC010846.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025082, ERS025084 [ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-71 CD244526.1 26-96
72-2077 AK056086.1 1-2006
2078-2094 AW006657.1 4-20 c
FEATURES Location/Qualifiers
source 1..2094
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="10"
/map="10q23.31"
gene 1..2094
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/note="STAM binding protein-like 1"
/db_xref="GeneID:57559"
/db_xref="HGNC:24105"
/db_xref="HPRD:16486"
/db_xref="MIM:612352"
exon 1..452
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 204
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370413959"
variation 285
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374626664"
variation 347
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:12255810"
variation 383
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:78561402"
exon 453..535
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 457
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369091157"
variation 476
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:184154094"
variation 480
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:7907004"
variation 481
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="t"
/db_xref="dbSNP:374001893"
variation 485..486
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace=""
/replace="g"
/db_xref="dbSNP:34656976"
misc_feature 497..499
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/note="upstream in-frame stop codon"
variation 501
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:61736945"
CDS 506..1816
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/EC_number="3.1.2.15"
/note="associated molecule with the SH3 domain of STAM
(AMSH) like protein; associated molecule with the SH3
domain of STAM (AMSH) - Family Protein"
/codon_start=1
/product="AMSH-like protease"
/protein_id="NP_065850.1"
/db_xref="GI:33147080"
/db_xref="CCDS:CCDS7391.1"
/db_xref="GeneID:57559"
/db_xref="HGNC:24105"
/db_xref="HPRD:16486"
/db_xref="MIM:612352"
/translation="
MDQPFTVNSLKKLAAMPDHTDVSLSPEERVRALSKLGCNITISEDITPRRYFRSGVEMERMASVYLEEGNLENAFVLYNKFITLFVEKLPNHRDYQQCAVPEKQDIMKKLKEIAFPRTDELKNDLLKKYNVEYQEYLQSKNKYKAEILKKLEHQRLIEAERKRIAQMRQQQLESEQFLFFEDQLKKQELARGQMRSQQTSGLSEQIDGSALSCFSTHQNNSLLNVFADQPNKSDATNYASHSPPVNRALTPAATLSAVQNLVVEGLRCVVLPEDLCHKFLQLAESNTVRGIETCGILCGKLTHNEFTITHVIVPKQSAGPDYCDMENVEELFNVQDQHDLLTLGWIHTHPTQTAFLSSVDLHTHCSYQLMLPEAIAIVCSPKHKDTGIFRLTNAGMLEVSACKKKGFHPHTKEPRLFSICKHVLVKDIKIIVLDLR
"
misc_feature 578..580
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q96FJ0.2); phosphorylation site"
misc_feature 1229..1231
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q96FJ0.2); phosphorylation site"
misc_feature 1229..1231
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1301..1813
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/note="Mov34/MPN/PAD-1 family; Region: MPN_AMSH_like;
cd08066"
/db_xref="CDD:163697"
misc_feature order(1379..1381,1544..1546,1550..1552,1574..1576,
1583..1585)
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/note="MPN+ (JAMM) motif; other site"
/db_xref="CDD:163697"
misc_feature 1379..1381
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/experiment="experimental evidence, no additional details
recorded"
/note="Indirect zinc-binding; propagated from
UniProtKB/Swiss-Prot (Q96FJ0.2); other site"
misc_feature order(1385..1393,1466..1480,1487..1492,1499..1501,
1508..1510,1526..1531,1538..1540,1544..1546,1550..1552,
1574..1576,1580..1585,1589..1594,1601..1606,1610..1615,
1724..1726)
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/note="Distal ubiquitin recognition interface [polypeptide
binding]; other site"
/db_xref="CDD:163697"
misc_feature order(1466..1468,1550..1552,1559..1564,1568..1570,
1574..1579,1724..1732)
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/note="Proximal ubiquitin recognition interface; other
site"
/db_xref="CDD:163697"
misc_feature 1544..1585
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q96FJ0.2);
Region: JAMM motif"
misc_feature order(1544..1546,1550..1552,1583..1585)
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/note="Zinc-binding site [ion binding]; other site"
/db_xref="CDD:163697"
variation 514
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="g"
/replace="t"
/db_xref="dbSNP:370446280"
variation 530
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372477377"
exon 536..753
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 545
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370800113"
variation 593
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="g"
/db_xref="dbSNP:375222641"
variation 597
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368354676"
variation 606
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200795909"
variation 664
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370720049"
variation 671
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145411494"
variation 690
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199596291"
variation 691
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:17114071"
variation 733
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374975621"
variation 753
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375576635"
exon 754..829
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 783
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:181446155"
variation 806
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368542029"
exon 830..925
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 856
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="g"
/db_xref="dbSNP:201314718"
variation 896
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:148947892"
exon 926..1283
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 977
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143664611"
variation 993
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372282218"
variation 1026
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:148096389"
variation 1043
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:367672326"
variation 1045
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371730681"
variation 1053
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="t"
/db_xref="dbSNP:143813797"
variation 1054
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200055658"
variation 1089
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146916734"
variation 1092
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:12254856"
variation 1108
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:41284104"
variation 1115
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:34270879"
variation 1132
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139103435"
variation 1133
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:9988723"
variation 1138
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:35493467"
variation 1194
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="c"
/db_xref="dbSNP:139826615"
variation 1224
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="g"
/replace="t"
/db_xref="dbSNP:200966286"
variation 1225
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="g"
/db_xref="dbSNP:200014710"
variation 1255
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:17850686"
variation 1266
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:202238568"
variation 1271
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146759776"
exon 1284..1408
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 1286
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="t"
/db_xref="dbSNP:369751532"
variation 1289
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139363999"
variation 1305
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200651856"
variation 1338
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373894376"
variation 1368
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="g"
/replace="t"
/db_xref="dbSNP:142629776"
variation 1375
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="c"
/db_xref="dbSNP:139001360"
exon 1409..1546
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 1409
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="t"
/db_xref="dbSNP:377504895"
variation 1458
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140820995"
variation 1459
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:183704316"
variation 1479
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371236373"
variation 1521
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="t"
/db_xref="dbSNP:374147577"
variation 1537..1538
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace=""
/replace="t"
/db_xref="dbSNP:71022548"
exon 1547..1659
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 1555
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:34083181"
variation 1566
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372446951"
variation 1580
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:375685316"
variation 1593
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369740177"
variation 1599
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="g"
/db_xref="dbSNP:372860750"
variation 1614
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199781509"
variation 1654
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377199878"
exon 1660..1759
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 1681
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376816365"
variation 1693
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371084787"
variation 1753
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="g"
/db_xref="dbSNP:374576837"
exon 1760..2094
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/inference="alignment:Splign:1.39.8"
variation 1764
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145246768"
variation 1778
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368433252"
variation 1784
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="g"
/replace="t"
/db_xref="dbSNP:142754924"
variation 1792
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="c"
/db_xref="dbSNP:374507048"
variation 1796
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="t"
/db_xref="dbSNP:367828982"
STS 1799..2075
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/standard_name="WI-10275"
/db_xref="UniSTS:79799"
variation 1820
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200476724"
STS 1834..2000
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/standard_name="RH66053"
/db_xref="UniSTS:40315"
variation 1837
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376278638"
variation 1856
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:184125227"
variation 1875
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147342229"
variation 1891
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="g"
/replace="t"
/db_xref="dbSNP:80093227"
variation 1959
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1530281"
variation 1991
/gene="STAMBPL1"
/gene_synonym="ALMalpha; AMSH-FP; AMSH-LP; bA399O19.2"
/replace="c"
/replace="t"
/db_xref="dbSNP:188575421"
ORIGIN
gcggaggcagaggcggaggcggcacccaggggccggggcaggggaggccgggaccatcgcagtgacaatttattttcctgcagcagcggcagcagggacggttgctgcaggttcggggtcggccggcctgcgcgtgggcttgcgaggacgctgttcgtcccctgcgctggggtgtccgacagcgaggaggagaacgacgcacggagcccgcgcgactggaaccagcaaagctccatctgtcggcagaggagaagggggaggaggcacggccgaggcaaacgagcggacgcctcgtcgccgggtgccggtatcaccccgctgcaacgccttccagcaaaagccaccgcggcccgggttgcagcagccggacggatgccaaggccacacggcagccacgggggcagccgtcgcagtcgccgtcccacacgggctgcggacaccaagggttgctaatgaagtgattgagaagaaacagtgaacatcctcatttcacagataagacaacatggatcagccttttactgtgaattctctgaaaaagttagctgctatgcctgaccatacagatgtttccctaagcccagaagagcgagtccgtgccctaagcaagcttggttgtaatatcaccatcagtgaagacatcactccacgacgttactttaggtctggagtagagatggagaggatggcgtctgtgtatttggaagaaggaaatttggaaaatgcctttgttctttataataaatttataaccttatttgtagaaaagcttcctaaccatcgagattaccagcaatgtgcagtacctgaaaagcaggatattatgaagaaactgaaggagattgcattcccaaggacagatgaattgaaaaacgaccttttaaagaaatataacgtagaataccaagaatatttgcaaagcaaaaacaaatataaagctgaaattctcaaaaaattggagcatcagagattgatagaggcagaaaggaagcggattgctcagatgcgccagcagcagctagaatcggagcagtttctgtttttcgaagatcaactcaagaagcaagagttagcccgaggtcaaatgcgaagtcagcaaacctcagggctgtcagagcagattgatgggagcgctttgtcctgcttttccacacaccagaacaattccttgctgaatgtatttgcagatcaacctaataaaagtgatgcaaccaattatgctagccactctcctcctgtaaacagggccttaacgccagctgctactctaagtgctgttcagaatttagtggttgaaggactgcgatgtgtagttttgccagaagatctttgccacaaatttctgcaactggcagaatctaatacagtgagaggaatagaaacctgtggaatactctgtggaaaactgacacataatgaatttactattacccatgtaattgtgccaaagcagtctgcgggaccagactattgtgacatggagaatgtagaggaattattcaatgttcaggatcaacatgatctcctcactctaggatggatccatacacatcccactcaaactgcatttttatccagcgttgatcttcacactcactgttcctatcaactcatgttgccagaggccattgccattgtttgctcaccaaagcataaagacactggcatcttcaggctcaccaatgctggcatgcttgaggtttctgcttgtaaaaaaaagggctttcatccacacaccaaggagcccaggctgttcagtatatgcaaacatgtgttggtaaaagacataaaaataattgtgttggatctgaggtgatatgttctgaatgtaagcaccgtcaacatcagacacctactcatggacatgtggttgccggattttcttaagatgtttccagaaatgactgatattttatatttatacattttagatgacaaagcttgatatttattgctgttgcacattttaaagttttctttttgggttgctctgtgtcaagagaggttacatggtgttaaatcggtacctgataatgtacccaaatactatggccagataataaattgtgctgcaaacaacatgtcttgtattta
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:57559 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:57559 -> Molecular function: GO:0008237 [metallopeptidase activity] evidence: IEA
GeneID:57559 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
GeneID:57559 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_065850 -> EC 3.1.2.15
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.