GGRNA Home | Help | Advanced search

2024-04-27 12:11:41, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_020064               1907 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens BarH-like homeobox 1 (BARHL1), mRNA.
ACCESSION   NM_020064
VERSION     NM_020064.3  GI:187829503
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1907)
  AUTHORS   Poschl,J., Lorenz,A., Hartmann,W., von Bueren,A.O., Kool,M., Li,S.,
            Peraud,A., Tonn,J.C., Herms,J., Xiang,M., Rutkowski,S.,
            Kretzschmar,H.A. and Schuller,U.
  TITLE     Expression of BARHL1 in medulloblastoma is associated with
            prolonged survival in mice and humans
  JOURNAL   Oncogene 30 (47), 4721-4730 (2011)
   PUBMED   21602885
  REMARK    GeneRIF: expression of Barhl1 decelerates tumor growth both in
            human and in murine medulloblastomas.
REFERENCE   2  (bases 1 to 1907)
  AUTHORS   Bulfone,A., Menguzzato,E., Broccoli,V., Marchitiello,A.,
            Gattuso,C., Mariani,M., Consalez,G.G., Martinez,S., Ballabio,A. and
            Banfi,S.
  TITLE     Barhl1, a gene belonging to a new subfamily of mammalian homeobox
            genes, is expressed in migrating neurons of the CNS
  JOURNAL   Hum. Mol. Genet. 9 (9), 1443-1452 (2000)
   PUBMED   10814725
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK054797.1 and AF325688.1.
            On May 9, 2008 this sequence version replaced gi:31542183.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK054797.1, AF325688.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1789              AK054797.1         1-1789
            1790-1857           AF325688.1         1613-1680
            1858-1907           AK054797.1         1858-1907
FEATURES             Location/Qualifiers
     source          1..1907
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="9"
                     /map="9q34"
     gene            1..1907
                     /gene="BARHL1"
                     /note="BarH-like homeobox 1"
                     /db_xref="GeneID:56751"
                     /db_xref="HGNC:953"
                     /db_xref="HPRD:05554"
                     /db_xref="MIM:605211"
     exon            1..658
                     /gene="BARHL1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    118..120
                     /gene="BARHL1"
                     /note="upstream in-frame stop codon"
     variation       148
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374375190"
     variation       181
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368046401"
     variation       192
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371662867"
     CDS             193..1176
                     /gene="BARHL1"
                     /codon_start=1
                     /product="barH-like 1 homeobox protein"
                     /protein_id="NP_064448.1"
                     /db_xref="GI:14149728"
                     /db_xref="CCDS:CCDS6950.1"
                     /db_xref="GeneID:56751"
                     /db_xref="HGNC:953"
                     /db_xref="HPRD:05554"
                     /db_xref="MIM:605211"
                     /translation="
MEGSNGFGIDSILSHRAGSPALPKGDPLLGDCRSPLELSPRSESSSDCSSPASPGRDCLETGTPRPGGASGPGLDSHLQPGQLSAPAQSRTVTSSFLIRDILADCKPLAACAPYSSSGQPAAPEPGGRLAAKAAEDFRDKLDKSGSNASSDSEYKVKEEGDREISSSRDSPPVRLKKPRKARTAFTDHQLAQLERSFERQKYLSVQDRMELAASLNLTDTQVKTWYQNRRTKWKRQTAVGLELLAEAGNYSALQRMFPSPYFYPQSLVSNLDPGAALYLYRGPSAPPPALQRPLVPRILIHGLQGASEPPPPLPPLAGVLPRAAQPR
"
     misc_feature    727..900
                     /gene="BARHL1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(727..741,745..747,796..798,814..816,853..855,
                     859..864,871..876,880..888,892..897)
                     /gene="BARHL1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(733..735,742..744,862..864,871..876,883..885)
                     /gene="BARHL1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     variation       239
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376566705"
     variation       241
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73659100"
     variation       242
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141976331"
     variation       271
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147143563"
     variation       295
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140268500"
     variation       344
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370488202"
     variation       346
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373735108"
     variation       348
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376698987"
     variation       353
                     /gene="BARHL1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371086101"
     variation       380
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111444940"
     variation       385
                     /gene="BARHL1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144334349"
     variation       404
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147374258"
     variation       441
                     /gene="BARHL1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11243834"
     variation       444
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139167917"
     variation       447
                     /gene="BARHL1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145113690"
     variation       459
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374889537"
     variation       471
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200079573"
     variation       516
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35351645"
     variation       530
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368144490"
     variation       534
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201325944"
     variation       584
                     /gene="BARHL1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149116109"
     exon            659..881
                     /gene="BARHL1"
                     /inference="alignment:Splign:1.39.8"
     variation       674
                     /gene="BARHL1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371655690"
     variation       684
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201129187"
     variation       713
                     /gene="BARHL1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:55836017"
     variation       732
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143453765"
     variation       765
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146556792"
     variation       804
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368358949"
     variation       814
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141204847"
     variation       828
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115324433"
     exon            882..1907
                     /gene="BARHL1"
                     /inference="alignment:Splign:1.39.8"
     variation       909
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111570450"
     variation       921
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200018434"
     variation       1002
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201426274"
     variation       1059
                     /gene="BARHL1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200567501"
     variation       1082
                     /gene="BARHL1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377171961"
     variation       1339
                     /gene="BARHL1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183364605"
     variation       1517
                     /gene="BARHL1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:394916"
     variation       1790
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:381977"
     variation       1806
                     /gene="BARHL1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:58476421"
ORIGIN      
cttttggatctaatgcgcagaggaggttggcccagagctcccgggctcccccaaggctgaactccgtccaaggtgcccgcaggctccctgcccgccttccccatgccagcccgcagctaggggcaggggcagcggcggctggggttgggggtgggtggggagcttttggggaggacaggtcgcagcttggctatggaaggctccaatggctttgggatcgactccattctctcccaccgcgcgggcagccccgcccttcccaagggggaccccttgctcggggactgccgttcgcccctggagctgagtccacgctcagagagcagcagcgactgctcttcgccagcctctccaggaagggactgtttggagacggggaccccacggcctggcggggcatccggcccaggtttggactcccacctgcagcccgggcagctctcagccccggcccagtcgcgcaccgtcacctcctcctttctgatcagggacatccttgccgactgcaaaccactcgcggcctgtgcaccctactctagcagcgggcagccggcagcccctgagcctgggggccgccttgcggccaaggccgcggaggactttagagacaagctggacaaaagtggcagcaacgcctcatcggactctgagtataaagtgaaggaggagggcgaccgcgagatctccagctccagggacagtcccccggtgcgcctgaaaaagccacgcaaggcgcgcacggccttcaccgaccatcagctggcgcagctggagcgcagcttcgagcggcagaagtacctgagcgtgcaggaccgcatggagctcgccgcctcgctcaacctcaccgacacgcaggtcaagacctggtaccagaaccgcaggactaaatggaagcgacagacggccgtcgggttggagctgctggcggaggcaggcaattactcagcgctccagcggatgttcccgtcgccttatttctacccgcagagtctggtttccaacctggaccccggcgcggcgctctacctgtaccgcggccccagcgcgccgccgcctgctctccagagacctctggtgccccgcatcctcatccacggactccagggcgccagcgagccgcccccgccgctgccccccctggccggcgtcctcccacgcgccgcgcagcctcggtgaggcgcccgtcggctccggggcctcctcccgcgggctcggcgtggccccttccgcccgcctttctgagggcgcaggttcgacgccctttcccgggagggggccctgcccggccctccctggcgccccagcccagtgccccccgaagggccaaatgccaagtccactgaggcccggaccccggactgcgtctccccagcccccctcggcgtcctctctcgcggccgctctgtccgggagccatccccacccgccgggtgtacatacgcgtctctgccactccccacccccagcctctgccggctcccctaggcaacccctttctccccaggagcgggtgcggctgattcccaggcttcgctctctcccacgccccttctacgctccaggtggagaacagcccctctccccgcgcccccgccagggagagaaggggagtgcggagccccgtctccctacccctcgagcacctgggccagcggctgagctgtacataccgtgtgcaaagtgtatatgaagttatttattcgtgacccatgagcccgtgaccgtgtccgtggattagtgagtctgtggcctgtgccctccccactcccaggcggggcaggaaggggccaagggggcttgcccacccaccccgaccccagcccccagcctcagccccggtccgggggcagccaggcctctcgggttctctcttttttaaatgtcgaaataaacttcttacaaatgac
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:56751 -> Molecular function: GO:0001077 [RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription] evidence: IEA
            GeneID:56751 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:56751 -> Biological process: GO:0001764 [neuron migration] evidence: IEA
            GeneID:56751 -> Biological process: GO:0007605 [sensory perception of sound] evidence: IEA
            GeneID:56751 -> Biological process: GO:0030901 [midbrain development] evidence: IEA
            GeneID:56751 -> Biological process: GO:0043524 [negative regulation of neuron apoptotic process] evidence: IEA
            GeneID:56751 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.