Home |
Help |
Advanced search
2024-04-20 00:01:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_020063 1496 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens BarH-like homeobox 2 (BARHL2), mRNA. ACCESSION NM_020063 XM_291583 VERSION NM_020063.1 GI:39930382 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1496) AUTHORS Bulfone,A., Menguzzato,E., Broccoli,V., Marchitiello,A., Gattuso,C., Mariani,M., Consalez,G.G., Martinez,S., Ballabio,A. and Banfi,S. TITLE Barhl1, a gene belonging to a new subfamily of mammalian homeobox genes, is expressed in migrating neurons of the CNS JOURNAL Hum. Mol. Genet. 9 (9), 1443-1452 (2000) PUBMED 10814725 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AY338397.1. On Jan 1, 2004 this sequence version replaced gi:37548900. ##Evidence-Data-START## Transcript exon combination :: AY338397.1, BC126439.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025085 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1496 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1p22.2" gene 1..1496 /gene="BARHL2" /note="BarH-like homeobox 2" /db_xref="GeneID:343472" /db_xref="HGNC:954" /db_xref="HPRD:05555" /db_xref="MIM:605212" exon 1..667 /gene="BARHL2" /inference="alignment:Splign:1.39.8" variation complement(1) /gene="BARHL2" /replace="a" /replace="g" /db_xref="dbSNP:377349086" variation complement(2) /gene="BARHL2" /replace="a" /replace="g" /db_xref="dbSNP:201655982" variation complement(5) /gene="BARHL2" /replace="g" /replace="t" /db_xref="dbSNP:369995490" misc_feature 10..12 /gene="BARHL2" /note="upstream in-frame stop codon" variation complement(11) /gene="BARHL2" /replace="g" /replace="t" /db_xref="dbSNP:201344199" STS 17..1303 /gene="BARHL2" /db_xref="UniSTS:485834" variation complement(19) /gene="BARHL2" /replace="a" /replace="g" /db_xref="dbSNP:200060831" variation complement(32) /gene="BARHL2" /replace="c" /replace="t" /db_xref="dbSNP:191773358" CDS 43..1206 /gene="BARHL2" /codon_start=1 /product="barH-like 2 homeobox protein" /protein_id="NP_064447.1" /db_xref="GI:39930383" /db_xref="CCDS:CCDS730.1" /db_xref="GeneID:343472" /db_xref="HGNC:954" /db_xref="HPRD:05555" /db_xref="MIM:605212" /translation="
MTMEGASGSSFGIDTILSSASSGSPGMMNGDFRPLGEARTADFRSQATPSPCSEIDTVGTAPSSPISVTMEPPEPHLVADATQHHHHLHHSQQPPPPAAAPTQSLQPLPQQQQPLPPQQPPPPPPQQLGSAASAPRTSTSSFLIKDILGDSKPLAACAPYSTSVSSPHHTPKQESNAVHESFRPKLEQEDSKTKLDKREDSQSDIKCHGTKEEGDREITSSRESPPVRAKKPRKARTAFSDHQLNQLERSFERQKYLSVQDRMDLAAALNLTDTQVKTWYQNRRTKWKRQTAVGLELLAEAGNYSALQRMFPSPYFYHPSLLGSMDSTTAAAAAAAMYSSMYRTPPAPHPQLQRPLVPRVLIHGLGPGGQPALNPLSSPIPGTPHPR
"
misc_feature 739..912
/gene="BARHL2"
/note="Homeodomain; DNA binding domains involved in the
transcriptional regulation of key eukaryotic developmental
processes; may bind to DNA as monomers or as homo- and/or
heterodimers, in a sequence-specific manner; Region:
homeodomain; cd00086"
/db_xref="CDD:28970"
misc_feature order(739..753,757..759,808..810,826..828,865..867,
871..876,883..888,892..900,904..909)
/gene="BARHL2"
/note="DNA binding site [nucleotide binding]"
/db_xref="CDD:28970"
misc_feature order(745..747,754..756,874..876,883..888,895..897)
/gene="BARHL2"
/note="specific DNA base contacts [nucleotide binding];
other site"
/db_xref="CDD:28970"
variation complement(55)
/gene="BARHL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:376915184"
variation complement(82)
/gene="BARHL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:373178647"
variation complement(86)
/gene="BARHL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:368872732"
variation complement(102)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377177651"
variation complement(167)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200681160"
variation complement(204)
/gene="BARHL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:145559721"
variation complement(213)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369627381"
variation complement(214)
/gene="BARHL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:150916366"
variation complement(224)
/gene="BARHL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:377585562"
variation complement(246)
/gene="BARHL2"
/replace="a"
/replace="c"
/db_xref="dbSNP:148411180"
variation complement(264)
/gene="BARHL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:377127285"
variation complement(267)
/gene="BARHL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:141603891"
variation complement(344)
/gene="BARHL2"
/replace="a"
/replace="c"
/db_xref="dbSNP:375986324"
variation complement(483)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138592538"
STS 506..573
/gene="BARHL2"
/standard_name="Barhl2"
/db_xref="UniSTS:507945"
variation complement(537)
/gene="BARHL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:75192719"
variation complement(545)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199834270"
variation complement(548)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:151239451"
variation complement(560)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201396859"
variation complement(581)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146412001"
variation complement(607)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201827905"
variation complement(610)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:147696781"
variation complement(613)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201997253"
variation complement(634)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200065986"
exon 668..893
/gene="BARHL2"
/inference="alignment:Splign:1.39.8"
variation complement(691)
/gene="BARHL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1335726"
variation complement(708)
/gene="BARHL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:190448640"
variation complement(762)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:115396841"
variation complement(765)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140007404"
variation complement(774)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200161940"
variation complement(788)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200810979"
variation complement(801)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374816489"
variation complement(810)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371535178"
variation complement(816)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:367953586"
variation complement(846)
/gene="BARHL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:187585491"
variation complement(864)
/gene="BARHL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:374374681"
exon 894..1496
/gene="BARHL2"
/inference="alignment:Splign:1.39.8"
variation complement(918)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370927916"
variation complement(939)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:141540345"
variation complement(981)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:116715073"
variation complement(992)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199523003"
variation complement(999)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141724152"
variation complement(1020)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:113868658"
variation complement(1037)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377759812"
variation complement(1039)
/gene="BARHL2"
/replace="c"
/replace="g"
/db_xref="dbSNP:200824967"
variation complement(1042)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374453417"
variation complement(1078)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149316850"
variation complement(1117)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369760372"
variation complement(1118)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374597157"
variation complement(1146)
/gene="BARHL2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369524532"
variation complement(1177)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200399976"
variation complement(1211)
/gene="BARHL2"
/replace="a"
/replace="t"
/db_xref="dbSNP:190029175"
variation complement(1243)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372034213"
variation complement(1257)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:371381754"
variation complement(1428)
/gene="BARHL2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2390606"
variation complement(1458)
/gene="BARHL2"
/replace="c"
/replace="t"
/db_xref="dbSNP:7538780"
ORIGIN
ggcggctgctgaacggcggagtggcgtggacctcatgtagcaatgacaatggaaggggccagcgggtcgagttttggaatagacacgattttgtccagtgccagttcaggcagcccaggcatgatgaatggagatttccgcccgctcggtgaggccaggaccgcggattttaggagtcaggccaccccatctccctgttcggagattgataccgtagggacggcgccttcttctcctatctcagtcaccatggagcccccggagccgcatctggtagcagacgcgacccagcatcatcaccacctccaccacagccagcagccgccgccgccggccgcggccccgacgcaaagtttgcagcctttgccccaacagcagcagccgctgccgccacagcagccgccgccgccgcccccccagcagctgggctcggccgcctcggcccccaggacttccacgtcttcttttttaattaaggacatcttgggcgacagcaaacctctggcggcatgtgcaccctacagcaccagcgtatcctctccccaccacaccccgaagcaggagagcaacgcagtgcacgagagcttcaggccaaagctcgagcaggaggacagcaagaccaaactcgacaagcgggaggattcccagagcgacatcaaatgccacgggacaaaggaggaaggagaccgggagattacgagtagccgtgagagtccccctgtgagagccaagaagcctcgaaaagcaaggacagctttttccgaccaccagctcaatcaactggagcgtagctttgagcggcagaagtacctgagcgtgcaggatcgcatggacctggctgcagcgctcaacctcactgacacccaagtcaagacctggtaccagaaccgcaggaccaagtggaagcggcagacagcggtgggcctggagttgctggccgaggcagggaactactcggcgctgcagaggatgtttccatcgccttatttctatcacccaagcctgctgggcagcatggacagcactacggcggcggcggctgccgctgccatgtacagcagcatgtaccggactcctccagcaccccatccccagctgcagcggcccctggtgccccgtgtgctcatccacggcctagggcctgggggacagccagcccttaatccattgtccagccccatcccaggcaccccacacccccggtgaaaacattgcagcgaaggcactgcaatcccttccccatatccctgcccaacccggactgctgcccgtcctctccctgctccaggccactaggcctcccttgcagccaactctggaaggcagaggagtaagagaggaagatgcttaccagtgggcaggggacccccaaagaggagccagccctctgctctccatctccccacccctagaaacagggctggaaatctcccccacagcagtgtgactggtgaaaatgctgaccccacacagagtgcaaccagtaagtgaaaaca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:343472 -> Molecular function: GO:0001077 [RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription] evidence: IEA
GeneID:343472 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
GeneID:343472 -> Biological process: GO:0001709 [cell fate determination] evidence: IEA
GeneID:343472 -> Biological process: GO:0001764 [neuron migration] evidence: IEA
GeneID:343472 -> Biological process: GO:0030182 [neuron differentiation] evidence: IEA
GeneID:343472 -> Biological process: GO:0030516 [regulation of axon extension] evidence: IEA
GeneID:343472 -> Biological process: GO:0045727 [positive regulation of translation] evidence: IEA
GeneID:343472 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.