GGRNA Home | Help | Advanced search

2024-03-29 09:13:33, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_012149                594 bp    mRNA    linear   PRI 07-JAN-2013
DEFINITION  Homo sapiens double homeobox 5 (DUX5), mRNA.
ACCESSION   NM_012149
VERSION     NM_012149.2  GI:63985969
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 594)
  AUTHORS   Ostlund,C., Garcia-Carrasquillo,R.M., Belayew,A. and Worman,H.J.
  TITLE     Intracellular trafficking and dynamics of double homeodomain
            proteins
  JOURNAL   Biochemistry 44 (7), 2378-2384 (2005)
   PUBMED   15709750
REFERENCE   2  (bases 1 to 594)
  AUTHORS   Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A.,
            Frants,R.R., Collen,D. and Belayew,A.
  TITLE     Active genes in junk DNA? Characterization of DUX genes embedded
            within 3.3 kb repeated elements
  JOURNAL   Gene 264 (1), 51-57 (2001)
   PUBMED   11245978
REFERENCE   3  (bases 1 to 594)
  AUTHORS   Ding,H., Beckers,M.C., Plaisance,S., Marynen,P., Collen,D. and
            Belayew,A.
  TITLE     Characterization of a double homeodomain protein (DUX1) encoded by
            a cDNA homologous to 3.3 kb dispersed repeated elements
  JOURNAL   Hum. Mol. Genet. 7 (11), 1681-1694 (1998)
   PUBMED   9736770
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AF133131.1.
            On May 13, 2005 this sequence version replaced gi:11120737.
            
            Summary: The human genome contains hundreds of repeats of the
            3.3-kb family in regions associated with heterochromatin. The DUX
            gene family, including DUX5, resides within these 3.3-kb repeated
            elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM
            606009).[supplied by OMIM, Mar 2008].
            
            Sequence Note: The 5'-most translation start codon is selected for
            this RefSeq. The use of an alternative downstream start codon would
            result in a protein that is 27 aa shorter at the N-terminus. In
            vitro translation studies in PMID:11245978 indicate that both the
            longer and shorter proteins can be produced from this transcript.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-594               AF133131.1         266-859
FEATURES             Location/Qualifiers
     source          1..594
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3"
     gene            1..594
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="double homeobox 5"
                     /db_xref="GeneID:26581"
                     /db_xref="HGNC:3083"
                     /db_xref="MIM:611444"
     CDS             1..594
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="double homeobox protein; alternative translation
                     start site; double homeobox, 5; double homeobox protein 1"
                     /codon_start=1
                     /product="double homeobox protein 5"
                     /protein_id="NP_036281.2"
                     /db_xref="GI:207442670"
                     /db_xref="GeneID:26581"
                     /db_xref="HGNC:3083"
                     /db_xref="MIM:611444"
                     /translation="
MPAEVHGSPPASLCPCQSVKFRPGLPEMALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEELAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHRGQSGRAPTQASIRCNAAPIG
"
     misc_feature    160..315
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(208..210,226..228,265..267,271..276,283..288,
                     292..300,304..309)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(274..276,283..288,295..297)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    364..540
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(364..378,382..384,433..435,451..453,490..492,
                     496..501,508..513,517..525,529..534)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(370..372,379..381,499..501,508..513,520..522)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            1..594
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(80)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74198112"
     variation       complement(174)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74220307"
     variation       complement(257)
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74188150"
     variation       400
                     /gene="DUX5"
                     /gene_synonym="DUX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36183646"
ORIGIN      
atgccggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtcagtccgtgaaattccggccggggctccctgagatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagtgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaagagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgtgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcaccggggacagtctggcagggcgcccacgcaggcaagcatccggtgcaatgcagccccaattgggtga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:26581 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA
            GeneID:26581 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:26581 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.