LOCUS       NM_012146               1227 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens double homeobox 1 (DUX1), mRNA.
ACCESSION   NM_012146
VERSION     NM_012146.1  GI:11120735
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1227)
  AUTHORS   Ostlund,C., Garcia-Carrasquillo,R.M., Belayew,A. and Worman,H.J.
  TITLE     Intracellular trafficking and dynamics of double homeodomain
            proteins
  JOURNAL   Biochemistry 44 (7), 2378-2384 (2005)
   PUBMED   15709750
  REMARK    GeneRIF: Report shows that full-length DUX1 is actively transported
            into the nuclei of transfected C2C12 myoblasts, and that DUX1
            homeodomains contain the signals required for this localization.
REFERENCE   2  (bases 1 to 1227)
  AUTHORS   Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A.,
            Frants,R.R., Collen,D. and Belayew,A.
  TITLE     Active genes in junk DNA? Characterization of DUX genes embedded
            within 3.3 kb repeated elements
  JOURNAL   Gene 264 (1), 51-57 (2001)
   PUBMED   11245978
REFERENCE   3  (bases 1 to 1227)
  AUTHORS   Ding,H., Beckers,M.C., Plaisance,S., Marynen,P., Collen,D. and
            Belayew,A.
  TITLE     Characterization of a double homeodomain protein (DUX1) encoded by
            a cDNA homologous to 3.3 kb dispersed repeated elements
  JOURNAL   Hum. Mol. Genet. 7 (11), 1681-1694 (1998)
   PUBMED   9736770
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AJ001481.1.
            
            Summary: The human genome contains hundreds of repeats of the
            3.3-kb family in regions associated with heterochromatin. The DUX
            gene family, including DUX1, resides within these 3.3-kb repeated
            elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM
            606009).[supplied by OMIM, Mar 2008].
            
            ##Evidence-Data-START##
            Transcript exon combination :: AJ001481.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1227
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10"
     gene            1..1227
                     /gene="DUX1"
                     /note="double homeobox 1"
                     /db_xref="GeneID:26584"
                     /db_xref="HGNC:3079"
                     /db_xref="HPRD:10609"
                     /db_xref="MIM:611441"
     CDS             113..625
                     /gene="DUX1"
                     /function="transcription factor"
                     /note="double homeobox, 1"
                     /codon_start=1
                     /product="double homeobox protein 1"
                     /protein_id="NP_036278.1"
                     /db_xref="GI:11120736"
                     /db_xref="GeneID:26584"
                     /db_xref="HGNC:3079"
                     /db_xref="HPRD:10609"
                     /db_xref="MIM:611441"
                     /translation="

MALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEELAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHRGQSGRAPTQASIRCNAAPIG

"
     misc_feature    191..346
                     /gene="DUX1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(239..241,257..259,296..298,302..307,314..319,
                     323..331,335..340)
                     /gene="DUX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(305..307,314..319,326..328)
                     /gene="DUX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    395..571
                     /gene="DUX1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(395..409,413..415,464..466,482..484,521..523,
                     527..532,539..544,548..556,560..565)
                     /gene="DUX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(401..403,410..412,530..532,539..544,551..553)
                     /gene="DUX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    167..346
                     /gene="DUX1"
                     /note="homeobox"
     variation       complement(212)
                     /gene="DUX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36134074"
     misc_feature    392..571
                     /gene="DUX1"
                     /note="homeobox"
ORIGIN      

caggcctcctggcagcacctgcgcagtgaacaggctggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtcagtccgtgaaattccggccggggctccctgagatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagtgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaagagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgtgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcaccggggacagtctggcagggcgcccacgcaggcaagcatccggtgcaatgcagccccaattgggtgacaccctgctctctcgtgggtcgcctttgcccacactggcgcatggggaaaggggcttcctgcaccacacatgctctcccacagtgggctttcgtgagccatggattgagggccgtccctgtgctcctgcccagccaggccgcgcaggcagaagggatctcccaacctgccccagcacatggggattttgcctacaccgcccaggctcctccagaaggggcgctctcccacactcacactcctaggtggcatccacacaagggcaaaatccggaaggactgggacgcgcagcgcgacggccttccgggcacttgcgcggtgggacagcctgggccctctcaagcggggccacagggccaaggtgtgcttgcgccacccgcgtcccagggaagtccgtggtgggggtggagcaggggtacccaggtcgccggtgtggcgtggaacctcaagcaggggcaattccacctcaccagcccacgcccccagaggcctccacacggcaggggcagatgcaaggcatctcagcaccctcccaggcgctcctggagccagggtgctcgtctgcactccactccatcctgctgctggatgagctcctggcga

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:26584 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA
            GeneID:26584 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:26584 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:26584 -> Cellular component: GO:0005634 [nucleus] evidence: IEA