2024-03-29 14:23:52, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_007113 6995 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens trichohyalin (TCHH), mRNA. ACCESSION NM_007113 VERSION NM_007113.3 GI:444909136 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 6995) AUTHORS Leung,M.C., Sutton,C.W., Fenton,D.A. and Tobin,D.J. TITLE Trichohyalin is a potential major autoantigen in human alopecia areata JOURNAL J. Proteome Res. 9 (10), 5153-5163 (2010) PUBMED 20722389 REMARK GeneRIF: Data suggest that an immune response to trichohyalin and K16 may have a role in the pathogenesis of the enigmatic disorder. REFERENCE 2 (bases 1 to 6995) AUTHORS Eriksson,N., Macpherson,J.M., Tung,J.Y., Hon,L.S., Naughton,B., Saxonov,S., Avey,L., Wojcicki,A., Pe'er,I. and Mountain,J. TITLE Web-based, participant-driven studies yield novel genetic associations for common traits JOURNAL PLoS Genet. 6 (6), E1000993 (2010) PUBMED 20585627 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) Publication Status: Online-Only REFERENCE 3 (bases 1 to 6995) AUTHORS Medland,S.E., Nyholt,D.R., Painter,J.N., McEvoy,B.P., McRae,A.F., Zhu,G., Gordon,S.D., Ferreira,M.A., Wright,M.J., Henders,A.K., Campbell,M.J., Duffy,D.L., Hansell,N.K., Macgregor,S., Slutske,W.S., Heath,A.C., Montgomery,G.W. and Martin,N.G. TITLE Common variants in the trichohyalin gene are associated with straight hair in Europeans JOURNAL Am. J. Hum. Genet. 85 (5), 750-755 (2009) PUBMED 19896111 REMARK GeneRIF: Common variants in the TCHH gene are associated with straight hair in Europeans. GeneRIF: Observational study and genome-wide association study of gene-disease association. (HuGE Navigator) REFERENCE 4 (bases 1 to 6995) AUTHORS Yamamoto,S., Hirai,K., Hasegawa-Oka,Y. and Hirai,Y. TITLE Molecular elements of the regulatory control of keratin filament modulator AHF/trichohyalin in the hair follicle JOURNAL Exp. Dermatol. 18 (2), 152-159 (2009) PUBMED 18643848 REMARK GeneRIF: In human keratinocytes, we found BMP-4 facilitates trichohyalin (THH) transcription, and lamin C plays a key role in the posttranslational stabilization of THH. GeneRIF: BMP-4 signalling activates AHF transcription in hair follicles. REFERENCE 5 (bases 1 to 6995) AUTHORS Steinert,P.M., Parry,D.A. and Marekov,L.N. TITLE Trichohyalin mechanically strengthens the hair follicle: multiple cross-bridging roles in the inner root shealth JOURNAL J. Biol. Chem. 278 (42), 41409-41419 (2003) PUBMED 12853460 REFERENCE 6 (bases 1 to 6995) AUTHORS O'Keefe,E.J., Hamilton,E.H., Lee,S.C. and Steinert,P. TITLE Trichohyalin: a structural protein of hair, tongue, nail, and epidermis JOURNAL J. Invest. Dermatol. 101 (1 SUPPL), 65S-71S (1993) PUBMED 7686953 REFERENCE 7 (bases 1 to 6995) AUTHORS Lee,S.C., Kim,I.G., Marekov,L.N., O'Keefe,E.J., Parry,D.A. and Steinert,P.M. TITLE The structure of human trichohyalin. Potential multiple roles as a functional EF-hand-like calcium-binding protein, a cornified cell envelope precursor, and an intermediate filament-associated (cross-linking) protein JOURNAL J. Biol. Chem. 268 (16), 12164-12176 (1993) PUBMED 7685034 REFERENCE 8 (bases 1 to 6995) AUTHORS Lee,S.C., Wang,M., McBride,O.W., O'Keefe,E.J., Kim,I.G. and Steinert,P.M. TITLE Human trichohyalin gene is clustered with the genes for other epidermal structural proteins and calcium-binding proteins at chromosomal locus 1q21 JOURNAL J. Invest. Dermatol. 100 (1), 65-68 (1993) PUBMED 8423399 REFERENCE 9 (bases 1 to 6995) AUTHORS Fietz,M.J., Rogers,G.E., Eyre,H.J., Baker,E., Callen,D.F. and Sutherland,G.R. TITLE Mapping of the trichohyalin gene: co-localization with the profilaggrin, involucrin, and loricrin genes JOURNAL J. Invest. Dermatol. 99 (5), 542-544 (1992) PUBMED 1431214 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL589986.15. On Feb 2, 2013 this sequence version replaced gi:148746194. Summary: Trichohyalin confers mechanical strength to the hair follicle inner root sheath and to other toughened epithelial tissues, such as the hard palate and filiform ridges of the tongue, by forming multiple complex crosslinks with itself and with other structural proteins (Steinert et al., 2003 [PubMed 12853460]).[supplied by OMIM, Dec 2009]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025088, ERS025098 [ECO:0000350] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-64 AL589986.15 19649-19712 c 65-233 AL589986.15 18201-18369 c 234-6995 AL589986.15 10575-17336 c FEATURES Location/Qualifiers source 1..6995 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1q21.3" gene 1..6995 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /note="trichohyalin" /db_xref="GeneID:7062" /db_xref="HGNC:11791" /db_xref="MIM:190370" exon 1..64 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /inference="alignment:Splign:1.39.8" exon 65..233 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /inference="alignment:Splign:1.39.8" misc_feature 78..80 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /note="upstream in-frame stop codon" CDS 96..5927 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /codon_start=1 /product="trichohyalin" /protein_id="NP_009044.2" /db_xref="GI:148746195" /db_xref="CCDS:CCDS41396.1" /db_xref="GeneID:7062" /db_xref="HGNC:11791" /db_xref="MIM:190370" /translation="
MSPLLRSICDITEIFNQYVSHDCDGAALTKKDLKNLLEREFGAVLRRPHDPKTVDLILELLDLDSNGRVDFNEFLLFIFKVAQACYYALGQATGLDEEKRARCDGKESLLQDRRQEEDQRRFEPRDRQLEEEPGQRRRQKRQEQERELAEGEEQSEKQERLEQRDRQRRDEELWRQRQEWQEREERRAEEEQLQSCKGHETEEFPDEEQLRRRELLELRRKGREEKQQQRRERQDRVFQEEEEKEWRKRETVLRKEEEKLQEEEPQRQRELQEEEEQLRKLERQELRRERQEEEQQQQRLRREQQLRRKQEEERREQQEERREQQERREQQEERREQQLRREQEERREQQLRREQEEERREQQLRREQEEERREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQEEERHEQKHEQERREQRLKREQEERRDWLKREEETERHEQERRKQQLKRDQEEERRERWLKLEEEERREQQERREQQLRREQEERREQRLKRQEEEERLQQRLRSEQQLRREQEERREQLLKREEEKRLEQERREQRLKREQEERRDQLLKREEERRQQRLKREQEERLEQRLKREEVERLEQEERREQRLKREEPEEERRQQLLKSEEQEERRQQQLRREQQERREQRLKREEEEERLEQRLKREHEEERREQELAEEEQEQARERIKSRIPKWQWQLESEADARQSKVYSRPRKQEGQRRRQEQEEKRRRRESELQWQEEERAHRQQQEEEQRRDFTWQWQAEEKSERGRQRLSARPPLREQRERQLRAEERQQREQRFLPEEEEKEQRRRQRREREKELQFLEEEEQLQRRERAQQLQEEEDGLQEDQERRRSQEQRRDQKWRWQLEEERKRRRHTLYAKPALQEQLRKEQQLLQEEEEELQREEREKRRRQEQERQYREEEQLQQEEEQLLREEREKRRRQERERQYRKDKKLQQKEEQLLGEEPEKRRRQEREKKYREEEELQQEEEQLLREEREKRRRQEWERQYRKKDELQQEEEQLLREEREKRRLQERERQYREEEELQQEEEQLLGEERETRRRQELERQYRKEEELQQEEEQLLREEPEKRRRQERERQCREEEELQQEEEQLLREEREKRRRQELERQYREEEEVQQEEEQLLREEPEKRRRQELERQYREEEELQQEEEQLLREEQEKRRQERERQYREEEELQRQKRKQRYRDEDQRSDLKWQWEPEKENAVRDNKVYCKGRENEQFRQLEDSQLRDRQSQQDLQHLLGEQQERDREQERRRWQQRDRHFPEEEQLEREEQKEAKRRDRKSQEEKQLLREEREEKRRRQETDRKFREEEQLLQEREEQPLRRQERDRKFREEELRHQEQGRKFLEEEQRLRRQERERKFLKEEQQLRCQEREQQLRQDRDRKFREEEQQLSRQERDRKFREEEQQVRRQERERKFLEEEQQLRQERHRKFREEEQLLQEREEQQLHRQERDRKFLEEEQQLRRQERDRKFREQELRSQEPERKFLEEEQQLHRQQRQRKFLQEEQQLRRQERGQQRRQDRDRKFREEEQLRQEREEQQLSRQERDRKFRLEEQKVRRQEQERKFMEDEQQLRRQEGQQQLRQERDRKFREDEQLLQEREEQQLHRQERDRKFLEEEPQLRRQEREQQLRHDRDRKFREEEQLLQEGEEQQLRRQERDRKFREEEQQLRRQERERKFLQEEQQLRRQELERKFREEEQLRQETEQEQLRRQERYRKILEEEQLRPEREEQQLRRQERDRKFREEEQLRQEREEQQLRSQESDRKFREEEQLRQEREEQQLRPQQRDGKYRWEEEQLQLEEQEQRLRQERDRQYRAEEQFATQEKSRREEQELWQEEEQKRRQERERKLREEHIRRQQKEEQRHRQVGEIKSQEGKGHGRLLEPGTHQFASVPVRSSPLYEYIQEQRSQYRP
" misc_feature 96..368 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q07283.2); Region: S-100-like" misc_feature 99..362 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /note="S-100: S-100 domain, which represents the largest family within the superfamily of proteins carrying the Ca-binding EF-hand motif. Note that this S-100 hierarchy contains only S-100 EF-hand domains, other EF-hands have been modeled separately. S100...; Region: S-100; cd00213" /db_xref="CDD:88292" misc_feature order(99..152,168..176,201..206,210..218,300..311, 315..320,324..335,339..362) /gene="TCHH" /gene_synonym="THH; THL; TRHY" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:88292" misc_feature order(150..152,165..167,174..176,189..194,279..281, 285..287,291..293,297..299,303..305,312..314) /gene="TCHH" /gene_synonym="THH; THL; TRHY" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:88292" misc_feature 156..329 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /note="EF-hand domain pair; Region: EF_hand_5; pfam13499" /db_xref="CDD:205677" misc_feature 846..848 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1035..1226 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q07283.2); Region: 5 X 13 AA tandem repeats of R-R-E-Q-E-E-E-R-R-E-Q-Q-L" misc_feature 1227..1370 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q07283.2); Region: 8 X 6 AA tandem repeats of R-R-E-Q-Q-L" misc_feature 1368..2144 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q07283.2); Region: 9 X 28 AA approximate tandem repeats" misc_feature 2811..3707 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q07283.2); Region: 10 X 30 AA tandem repeats" misc_feature 3969..5777 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q07283.2); Region: 23 X 26 AA approximate tandem repeats" exon 234..6995 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /inference="alignment:Splign:1.39.8" variation 283 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="g" /replace="t" /db_xref="dbSNP:2515663" variation 804 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="c" /replace="g" /db_xref="dbSNP:3134814" variation 2027..2028 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="c" /replace="g" /db_xref="dbSNP:3020643" variation 2036 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="a" /replace="g" /db_xref="dbSNP:2515664" variation 2555..2556 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="c" /replace="g" /db_xref="dbSNP:2515665" variation 5440..5441 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="a" /replace="g" /db_xref="dbSNP:2515667" variation 5628 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="g" /replace="t" /db_xref="dbSNP:201647177" variation 5799 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="a" /replace="c" /db_xref="dbSNP:1131471" variation 5965 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="c" /replace="g" /db_xref="dbSNP:1131473" STS 6159..6496 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /standard_name="D1S2399" /db_xref="UniSTS:19448" variation 6474 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /replace="g" /replace="t" /db_xref="dbSNP:9050" STS 6815..6897 /gene="TCHH" /gene_synonym="THH; THL; TRHY" /standard_name="RH69475" /db_xref="UniSTS:6245" ORIGIN
gttacccagtacacttgcctgtggtgtcagcaagcactgtcgacttcttcctctggtgaagtgggtttacttgaacttgaaggaaagaaaaaaaaatgtctccacttctgagaagcatctgtgacatcactgaaattttcaatcagtatgtctctcatgattgtgatggagcagcattaactaagaaagacctgaagaacctccttgaaagggaatttggagctgtgcttcggagaccacatgaccctaagacggtagatctgatcctggaacttctggatcttgacagtaatgggcgtgtcgatttcaacgaattcctcctatttattttcaaagtggctcaagcttgttactatgctctcggccaggccacgggactggatgaggagaagcgagcccggtgtgacggaaaggagagcctgttacaagatcgcaggcaagaagaagaccaaaggagattcgagccccgggacagacaactggaagaagaacctgggcaacgacgcaggcagaagaggcaggaacaggagagggagctagctgagggagaggagcaaagtgagaaacaagagcgacttgaacagcgcgacaggcagcgccgcgacgaggagctgtggcggcaaaggcaagaatggcaagaacgggaagagcgccgtgcagaggaagagcagctgcagagttgcaaaggtcacgaaactgaggagtttccagacgaagagcaactgcgaaggcgggagctgctggagctgaggaggaagggccgcgaggagaaacagcagcaaaggcgagagcggcaagacagagtgttccaggaggaagaagagaaagagtggaggaagcgcgagacagtgctccggaaggaagaagagaagttgcaggaagaggagccgcagcggcaaagagagctccaggaggaagaagagcagctacggaagctggagcggcaagagctgaggagggagcgccaggaggaagagcagcagcagcaaaggctgaggcgcgagcagcaactaaggcgcaagcaggaggaggagaggcgcgagcagcaggaggagaggcgcgagcagcaggagaggcgcgagcagcaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcacgagcagaagcacgagcaggagaggcgcgagcagcggctgaagcgcgagcaggaggagaggcgcgattggctgaagcgcgaggaggagacggagaggcacgagcaggagaggcgcaagcagcagctgaagcgcgaccaggaggaggagaggcgcgaacgttggctgaagctcgaggaggaggagaggcgcgagcagcaggagaggcgcgagcagcaactaaggcgggagcaagaggagaggcgcgagcagcggctgaagcgccaggaggaggaagagaggctccagcagcggttgaggagcgagcaacaactaagacgcgagcaggaggagaggcgcgagcagctgctgaagcgcgaggaggagaagaggctcgagcaggagaggcgagagcagcggctgaagcgcgagcaggaggagaggcgcgatcagctgctgaagcgcgaggaggagaggcgccagcagcggctgaagcgcgagcaggaagagaggctcgagcagcgactgaagcgcgaggaggtggagagactcgagcaggaggagaggcgcgagcagcggctgaagcgcgaggagccggaggaagagaggcgccagcagctgctgaagagcgaggagcaggaggagaggcgccagcagcaactaaggcgcgagcagcaggaaaggcgcgagcagcggctgaagcgcgaggaggaggaagagaggctcgagcagcggctgaagcgcgagcatgaggaagagaggcgcgagcaggagctagctgaggaggagcaggaacaggcccgggagcggattaagagccgcatcccgaagtggcagtggcagctagaaagcgaggccgacgcacggcaaagcaaagtctactcgaggccccgcaagcaggaagggcagaggcgccgccaagagcaggaggaaaagaggcggcgccgggagagtgagctgcaatggcaggaggaggaacgggctcaccggcagcagcaggaagaggagcagcgccgggacttcacatggcagtggcaggcggaggaaaagagcgagaggggccgtcagaggctgtcggccaggcccccattgcgggagcagcgggagaggcagctgagggccgaggagcgccagcagcgggaacaacggtttctcccggaggaggaggagaaggagcagcggcgccgccagcgacgcgagagggagaaagagctgcagttcctggaggaagaggagcagctccagcggcgggagcgtgcccaacagctccaggaggaggaggacggcctccaggaggatcaggagaggaggcgaagccaggagcagcgccgcgaccaaaaatggaggtggcaactagaagaagaaaggaagagacgccgccacacgctgtacgccaagccagccctacaagagcagctgaggaaggaacagcagctgctgcaggaggaggaggaggagctacagagagaggagcgcgagaagagaaggcgccaagaacaggagagacaataccgcgaggaagagcagctgcagcaggaggaagagcagctgctgagagaggaacgggagaaaagaagacgccaggagcgggaaaggcaatatcggaaggataagaagctgcagcagaaggaagagcagctgctgggagaggaaccggagaagagaaggcgccaggagcgggagaaaaaataccgcgaggaagaggagttgcagcaggaggaagagcagctgctgagagaggaacgggagaagagaaggcgccaggagtgggagaggcagtaccgcaaaaaagacgagctgcagcaggaagaagagcagctgctgagagaggaacgggagaaaagaagactccaggagcgggagaggcaatatcgggaggaagaggagctgcagcaggaggaagagcagctgctgggagaggaacgggagacgagaaggcgccaggagctggagaggcaatatcggaaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaaccggagaagagaaggcgccaggagcgggagaggcaatgtcgggaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaacgggagaagagaaggcgccaggagctggagaggcaatatcgggaggaagaggaggtgcagcaggaggaagagcagctgctgagagaggaaccggagaagagaaggcgccaggagctggagaggcaataccgcgaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaacaggagaaaaggcgccaggagcgggagaggcagtatcgggaggaggaagagcttcagcgccagaaaaggaagcagcgataccgggatgaggatcagcgcagtgatctgaaatggcagtgggaaccagaaaaagaaaatgcagttcgtgataacaaggtttactgcaaaggcagagagaatgaacagttccggcagttggaagattcccagctgcgcgacagacaatcccagcaagatctgcagcacctgctgggtgaacagcaagagcgagatcgtgagcaagagaggaggcgctggcagcagcgcgacaggcatttcccagaggaagaacagctggagcgagaagagcaaaaggaagccaaaaggcgcgacaggaagtcccaagaggaaaagcagttgctgagagaggaaagagaagagaagagacgccgtcaagagacagacagaaaattccgcgaggaggaacagctgctccaggaaagggaggaacagccgctgcgccgccaagagcgtgacagaaaattccgcgaagaggaactgcgccatcaggaacaagggagaaaattcctcgaggaggaacagcggctgcgccgccaggaacgggagagaaaattccttaaggaggaacagcagctgcgctgccaggagcgcgagcaacagctgcgtcaggaccgcgacagaaaattccgcgaggaggaacagcagctgagccgccaagagcgtgacagaaaattccgtgaagaggaacagcaggtgcgccgccaggaacgagagagaaaattcctggaggaggaacagcagctgcgccaggagcgtcacagaaaattccgcgaagaggaacagctgctccaggaaagggaagaacagcagctgcaccgccaagagcgtgacagaaaattcctggaggaggaacaacagctgcgccgccaagagcgtgacagaaaattccgcgaacaggaactgcgcagtcaggaaccagagagaaaattcctcgaggaggaacagcagctgcaccgccagcaacggcagagaaaattcctccaggaggaacagcagctgcgccgccaggagcgcgggcaacagcggcgtcaggaccgtgacagaaaattccgcgaggaggaacagctgcgccaggagagggaggaacagcagctgagccgccaagagcgtgacagaaaattccgtttagaggaacagaaagtgcgccgccaggaacaagagagaaaattcatggaggacgaacagcagctgcgccgccaggagggccaacaacagctgcgccaggagcgcgacagaaaattccgcgaagacgaacagctgctccaggaaagggaagaacagcagctgcaccgccaagagcgtgacagaaaattcctcgaggaggaaccgcagctgcgccgccaggagcgcgaacaacagctgcgtcacgaccgcgacagaaaattccgtgaagaggaacagctgctccaggaaggggaggaacagcagctgcgccgccaagagcgtgacagaaaattccgcgaagaggaacagcagctccgccgtcaggaacgagagagaaaattcctccaggaggaacagcagctgcgccgccaggaactggagagaaaattccgtgaggaggaacagctgcgccaagaaacggagcaagagcagctgcgccgccaagaacgctacagaaaaatcctagaggaagagcagctccgtccggaaagggaagaacagcagctgcgccgccaggagcgcgacagaaaattccgcgaggaggaacagctccgccaggagagggaggaacagcagctgcgcagccaagagtctgacagaaaattccgcgaggaggaacagctacgccaggagagggaagaacagcagctgcgcccccaacagcgtgacggaaagtatcgctgggaagaagagcagctccaacttgaggaacaagagcagaggctgcggcaggagcgagaccggcagtaccgggcggaggagcagtttgccacgcaggagaagagtcgtcgtgaggaacaagaactatggcaagaagaggagcagaaacgtcgccaggaacgggaaaggaaattacgggaagaacacatccgccgccagcagaaggaggaacagaggcaccgccaagtcggggagataaaatcccaagaagggaagggccatgggcggcttctggagcccggcactcatcagtttgccagtgtcccagtgcgctccagccctctctatgagtacatccaagagcagagatctcaataccgcccttaagtgatgttgccaatatcttgacacctgccaaagcttcgagcacgggaaaatgagaaacactgggtaccaagtgataactcagatgtttctggttgtgggaaaactctctgatattagaatgtcttttcttccaaaatcttaaactacgctcattttacgcactttgtacttctgctttttattcttcctcaagtagttctttactgcaagatgtctttcttttgctctttgatgcagatgtggtgtgcatttaaaaaaaatataaatcatttaatttgtttaagaaattttgtttgaggaacatgttcatttattgctttcagaagtaacaagagtaataggatgatttgagattctaaacaatgggtcggtttgtttaatgactgacccatcttgtggaaagtgcagatacttttaatgttcaagttgctatttcttcttgaacctaaattgatcattgcctccaaacagcatttcatcttttgtggcatagttagcacaaattccaggtaactaaatttttataacccttgaatagtgcagggggagtgacctctgcataaaaacttcctgtaaaatcagcccattactggaagaaatatctgttaagaataggtttagctttgaagatttagaatttaaattagattttttttaaactcaactccacttaaacacataatctcatgaagaaataatgaggtgtttctcaacttcagagttcaaattttaaaactgtgtctgttgtagtctatagtgttcattctacttccccaagttttgatgagtttcagaatattatgaacctttgttaattttagcttgttagaaggaagctgctcagaatcccataaacatctgtcttactctagggccaataagagatcacatagagcatgttgggggtgtaaaagggaaaaatgtgtgaacataggggcaaatttctagaggccctttgacaagacccatttgcccacaatcatttgaggcctattgataataccttagatatattcttgttgaaataattggactgtgaaaaattaataataaatgtttggcaagtaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:7062 -> Molecular function: GO:0005509 [calcium ion binding] evidence: TAS GeneID:7062 -> Biological process: GO:0008150 [biological_process] evidence: ND GeneID:7062 -> Biological process: GO:0031424 [keratinization] evidence: IEA GeneID:7062 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:7062 -> Cellular component: GO:0005813 [centrosome] evidence: IDA GeneID:7062 -> Cellular component: GO:0005856 [cytoskeleton] evidence: NAS GeneID:7062 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA GeneID:7062 -> Cellular component: GO:0045111 [intermediate filament cytoskeleton] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.