GGRNA Home | Help | Advanced search

2024-03-29 14:23:52, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_007113               6995 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens trichohyalin (TCHH), mRNA.
ACCESSION   NM_007113
VERSION     NM_007113.3  GI:444909136
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6995)
  AUTHORS   Leung,M.C., Sutton,C.W., Fenton,D.A. and Tobin,D.J.
  TITLE     Trichohyalin is a potential major autoantigen in human alopecia
            areata
  JOURNAL   J. Proteome Res. 9 (10), 5153-5163 (2010)
   PUBMED   20722389
  REMARK    GeneRIF: Data suggest that an immune response to trichohyalin and
            K16 may have a role in the pathogenesis of the enigmatic disorder.
REFERENCE   2  (bases 1 to 6995)
  AUTHORS   Eriksson,N., Macpherson,J.M., Tung,J.Y., Hon,L.S., Naughton,B.,
            Saxonov,S., Avey,L., Wojcicki,A., Pe'er,I. and Mountain,J.
  TITLE     Web-based, participant-driven studies yield novel genetic
            associations for common traits
  JOURNAL   PLoS Genet. 6 (6), E1000993 (2010)
   PUBMED   20585627
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 6995)
  AUTHORS   Medland,S.E., Nyholt,D.R., Painter,J.N., McEvoy,B.P., McRae,A.F.,
            Zhu,G., Gordon,S.D., Ferreira,M.A., Wright,M.J., Henders,A.K.,
            Campbell,M.J., Duffy,D.L., Hansell,N.K., Macgregor,S.,
            Slutske,W.S., Heath,A.C., Montgomery,G.W. and Martin,N.G.
  TITLE     Common variants in the trichohyalin gene are associated with
            straight hair in Europeans
  JOURNAL   Am. J. Hum. Genet. 85 (5), 750-755 (2009)
   PUBMED   19896111
  REMARK    GeneRIF: Common variants in the TCHH gene are associated with
            straight hair in Europeans.
            GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
REFERENCE   4  (bases 1 to 6995)
  AUTHORS   Yamamoto,S., Hirai,K., Hasegawa-Oka,Y. and Hirai,Y.
  TITLE     Molecular elements of the regulatory control of keratin filament
            modulator AHF/trichohyalin in the hair follicle
  JOURNAL   Exp. Dermatol. 18 (2), 152-159 (2009)
   PUBMED   18643848
  REMARK    GeneRIF: In human keratinocytes, we found BMP-4 facilitates
            trichohyalin (THH) transcription, and lamin C plays a key role in
            the posttranslational stabilization of THH.
            GeneRIF: BMP-4 signalling activates AHF transcription in hair
            follicles.
REFERENCE   5  (bases 1 to 6995)
  AUTHORS   Steinert,P.M., Parry,D.A. and Marekov,L.N.
  TITLE     Trichohyalin mechanically strengthens the hair follicle: multiple
            cross-bridging roles in the inner root shealth
  JOURNAL   J. Biol. Chem. 278 (42), 41409-41419 (2003)
   PUBMED   12853460
REFERENCE   6  (bases 1 to 6995)
  AUTHORS   O'Keefe,E.J., Hamilton,E.H., Lee,S.C. and Steinert,P.
  TITLE     Trichohyalin: a structural protein of hair, tongue, nail, and
            epidermis
  JOURNAL   J. Invest. Dermatol. 101 (1 SUPPL), 65S-71S (1993)
   PUBMED   7686953
REFERENCE   7  (bases 1 to 6995)
  AUTHORS   Lee,S.C., Kim,I.G., Marekov,L.N., O'Keefe,E.J., Parry,D.A. and
            Steinert,P.M.
  TITLE     The structure of human trichohyalin. Potential multiple roles as a
            functional EF-hand-like calcium-binding protein, a cornified cell
            envelope precursor, and an intermediate filament-associated
            (cross-linking) protein
  JOURNAL   J. Biol. Chem. 268 (16), 12164-12176 (1993)
   PUBMED   7685034
REFERENCE   8  (bases 1 to 6995)
  AUTHORS   Lee,S.C., Wang,M., McBride,O.W., O'Keefe,E.J., Kim,I.G. and
            Steinert,P.M.
  TITLE     Human trichohyalin gene is clustered with the genes for other
            epidermal structural proteins and calcium-binding proteins at
            chromosomal locus 1q21
  JOURNAL   J. Invest. Dermatol. 100 (1), 65-68 (1993)
   PUBMED   8423399
REFERENCE   9  (bases 1 to 6995)
  AUTHORS   Fietz,M.J., Rogers,G.E., Eyre,H.J., Baker,E., Callen,D.F. and
            Sutherland,G.R.
  TITLE     Mapping of the trichohyalin gene: co-localization with the
            profilaggrin, involucrin, and loricrin genes
  JOURNAL   J. Invest. Dermatol. 99 (5), 542-544 (1992)
   PUBMED   1431214
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL589986.15.
            On Feb 2, 2013 this sequence version replaced gi:148746194.
            
            Summary: Trichohyalin confers mechanical strength to the hair
            follicle inner root sheath and to other toughened epithelial
            tissues, such as the hard palate and filiform ridges of the tongue,
            by forming multiple complex crosslinks with itself and with other
            structural proteins (Steinert et al., 2003 [PubMed
            12853460]).[supplied by OMIM, Dec 2009].
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025088, ERS025098
                              [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-64                AL589986.15        19649-19712         c
            65-233              AL589986.15        18201-18369         c
            234-6995            AL589986.15        10575-17336         c
FEATURES             Location/Qualifiers
     source          1..6995
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q21.3"
     gene            1..6995
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /note="trichohyalin"
                     /db_xref="GeneID:7062"
                     /db_xref="HGNC:11791"
                     /db_xref="MIM:190370"
     exon            1..64
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /inference="alignment:Splign:1.39.8"
     exon            65..233
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    78..80
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /note="upstream in-frame stop codon"
     CDS             96..5927
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /codon_start=1
                     /product="trichohyalin"
                     /protein_id="NP_009044.2"
                     /db_xref="GI:148746195"
                     /db_xref="CCDS:CCDS41396.1"
                     /db_xref="GeneID:7062"
                     /db_xref="HGNC:11791"
                     /db_xref="MIM:190370"
                     /translation="
MSPLLRSICDITEIFNQYVSHDCDGAALTKKDLKNLLEREFGAVLRRPHDPKTVDLILELLDLDSNGRVDFNEFLLFIFKVAQACYYALGQATGLDEEKRARCDGKESLLQDRRQEEDQRRFEPRDRQLEEEPGQRRRQKRQEQERELAEGEEQSEKQERLEQRDRQRRDEELWRQRQEWQEREERRAEEEQLQSCKGHETEEFPDEEQLRRRELLELRRKGREEKQQQRRERQDRVFQEEEEKEWRKRETVLRKEEEKLQEEEPQRQRELQEEEEQLRKLERQELRRERQEEEQQQQRLRREQQLRRKQEEERREQQEERREQQERREQQEERREQQLRREQEERREQQLRREQEEERREQQLRREQEEERREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQQLRREQEEERHEQKHEQERREQRLKREQEERRDWLKREEETERHEQERRKQQLKRDQEEERRERWLKLEEEERREQQERREQQLRREQEERREQRLKRQEEEERLQQRLRSEQQLRREQEERREQLLKREEEKRLEQERREQRLKREQEERRDQLLKREEERRQQRLKREQEERLEQRLKREEVERLEQEERREQRLKREEPEEERRQQLLKSEEQEERRQQQLRREQQERREQRLKREEEEERLEQRLKREHEEERREQELAEEEQEQARERIKSRIPKWQWQLESEADARQSKVYSRPRKQEGQRRRQEQEEKRRRRESELQWQEEERAHRQQQEEEQRRDFTWQWQAEEKSERGRQRLSARPPLREQRERQLRAEERQQREQRFLPEEEEKEQRRRQRREREKELQFLEEEEQLQRRERAQQLQEEEDGLQEDQERRRSQEQRRDQKWRWQLEEERKRRRHTLYAKPALQEQLRKEQQLLQEEEEELQREEREKRRRQEQERQYREEEQLQQEEEQLLREEREKRRRQERERQYRKDKKLQQKEEQLLGEEPEKRRRQEREKKYREEEELQQEEEQLLREEREKRRRQEWERQYRKKDELQQEEEQLLREEREKRRLQERERQYREEEELQQEEEQLLGEERETRRRQELERQYRKEEELQQEEEQLLREEPEKRRRQERERQCREEEELQQEEEQLLREEREKRRRQELERQYREEEEVQQEEEQLLREEPEKRRRQELERQYREEEELQQEEEQLLREEQEKRRQERERQYREEEELQRQKRKQRYRDEDQRSDLKWQWEPEKENAVRDNKVYCKGRENEQFRQLEDSQLRDRQSQQDLQHLLGEQQERDREQERRRWQQRDRHFPEEEQLEREEQKEAKRRDRKSQEEKQLLREEREEKRRRQETDRKFREEEQLLQEREEQPLRRQERDRKFREEELRHQEQGRKFLEEEQRLRRQERERKFLKEEQQLRCQEREQQLRQDRDRKFREEEQQLSRQERDRKFREEEQQVRRQERERKFLEEEQQLRQERHRKFREEEQLLQEREEQQLHRQERDRKFLEEEQQLRRQERDRKFREQELRSQEPERKFLEEEQQLHRQQRQRKFLQEEQQLRRQERGQQRRQDRDRKFREEEQLRQEREEQQLSRQERDRKFRLEEQKVRRQEQERKFMEDEQQLRRQEGQQQLRQERDRKFREDEQLLQEREEQQLHRQERDRKFLEEEPQLRRQEREQQLRHDRDRKFREEEQLLQEGEEQQLRRQERDRKFREEEQQLRRQERERKFLQEEQQLRRQELERKFREEEQLRQETEQEQLRRQERYRKILEEEQLRPEREEQQLRRQERDRKFREEEQLRQEREEQQLRSQESDRKFREEEQLRQEREEQQLRPQQRDGKYRWEEEQLQLEEQEQRLRQERDRQYRAEEQFATQEKSRREEQELWQEEEQKRRQERERKLREEHIRRQQKEEQRHRQVGEIKSQEGKGHGRLLEPGTHQFASVPVRSSPLYEYIQEQRSQYRP
"
     misc_feature    96..368
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
                     Region: S-100-like"
     misc_feature    99..362
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /note="S-100: S-100 domain, which represents the largest
                     family within the superfamily of proteins carrying the
                     Ca-binding EF-hand motif. Note that this S-100 hierarchy
                     contains only S-100 EF-hand domains, other EF-hands have
                     been modeled separately. S100...; Region: S-100; cd00213"
                     /db_xref="CDD:88292"
     misc_feature    order(99..152,168..176,201..206,210..218,300..311,
                     315..320,324..335,339..362)
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:88292"
     misc_feature    order(150..152,165..167,174..176,189..194,279..281,
                     285..287,291..293,297..299,303..305,312..314)
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:88292"
     misc_feature    156..329
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /note="EF-hand domain pair; Region: EF_hand_5; pfam13499"
                     /db_xref="CDD:205677"
     misc_feature    846..848
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1035..1226
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
                     Region: 5 X 13 AA tandem repeats of
                     R-R-E-Q-E-E-E-R-R-E-Q-Q-L"
     misc_feature    1227..1370
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
                     Region: 8 X 6 AA tandem repeats of R-R-E-Q-Q-L"
     misc_feature    1368..2144
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
                     Region: 9 X 28 AA approximate tandem repeats"
     misc_feature    2811..3707
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
                     Region: 10 X 30 AA tandem repeats"
     misc_feature    3969..5777
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q07283.2);
                     Region: 23 X 26 AA approximate tandem repeats"
     exon            234..6995
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /inference="alignment:Splign:1.39.8"
     variation       283
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2515663"
     variation       804
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3134814"
     variation       2027..2028
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3020643"
     variation       2036
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2515664"
     variation       2555..2556
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2515665"
     variation       5440..5441
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2515667"
     variation       5628
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201647177"
     variation       5799
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1131471"
     variation       5965
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1131473"
     STS             6159..6496
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /standard_name="D1S2399"
                     /db_xref="UniSTS:19448"
     variation       6474
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9050"
     STS             6815..6897
                     /gene="TCHH"
                     /gene_synonym="THH; THL; TRHY"
                     /standard_name="RH69475"
                     /db_xref="UniSTS:6245"
ORIGIN      
gttacccagtacacttgcctgtggtgtcagcaagcactgtcgacttcttcctctggtgaagtgggtttacttgaacttgaaggaaagaaaaaaaaatgtctccacttctgagaagcatctgtgacatcactgaaattttcaatcagtatgtctctcatgattgtgatggagcagcattaactaagaaagacctgaagaacctccttgaaagggaatttggagctgtgcttcggagaccacatgaccctaagacggtagatctgatcctggaacttctggatcttgacagtaatgggcgtgtcgatttcaacgaattcctcctatttattttcaaagtggctcaagcttgttactatgctctcggccaggccacgggactggatgaggagaagcgagcccggtgtgacggaaaggagagcctgttacaagatcgcaggcaagaagaagaccaaaggagattcgagccccgggacagacaactggaagaagaacctgggcaacgacgcaggcagaagaggcaggaacaggagagggagctagctgagggagaggagcaaagtgagaaacaagagcgacttgaacagcgcgacaggcagcgccgcgacgaggagctgtggcggcaaaggcaagaatggcaagaacgggaagagcgccgtgcagaggaagagcagctgcagagttgcaaaggtcacgaaactgaggagtttccagacgaagagcaactgcgaaggcgggagctgctggagctgaggaggaagggccgcgaggagaaacagcagcaaaggcgagagcggcaagacagagtgttccaggaggaagaagagaaagagtggaggaagcgcgagacagtgctccggaaggaagaagagaagttgcaggaagaggagccgcagcggcaaagagagctccaggaggaagaagagcagctacggaagctggagcggcaagagctgaggagggagcgccaggaggaagagcagcagcagcaaaggctgaggcgcgagcagcaactaaggcgcaagcaggaggaggagaggcgcgagcagcaggaggagaggcgcgagcagcaggagaggcgcgagcagcaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcagcagctgaggcgcgagcaggaggaggagaggcacgagcagaagcacgagcaggagaggcgcgagcagcggctgaagcgcgagcaggaggagaggcgcgattggctgaagcgcgaggaggagacggagaggcacgagcaggagaggcgcaagcagcagctgaagcgcgaccaggaggaggagaggcgcgaacgttggctgaagctcgaggaggaggagaggcgcgagcagcaggagaggcgcgagcagcaactaaggcgggagcaagaggagaggcgcgagcagcggctgaagcgccaggaggaggaagagaggctccagcagcggttgaggagcgagcaacaactaagacgcgagcaggaggagaggcgcgagcagctgctgaagcgcgaggaggagaagaggctcgagcaggagaggcgagagcagcggctgaagcgcgagcaggaggagaggcgcgatcagctgctgaagcgcgaggaggagaggcgccagcagcggctgaagcgcgagcaggaagagaggctcgagcagcgactgaagcgcgaggaggtggagagactcgagcaggaggagaggcgcgagcagcggctgaagcgcgaggagccggaggaagagaggcgccagcagctgctgaagagcgaggagcaggaggagaggcgccagcagcaactaaggcgcgagcagcaggaaaggcgcgagcagcggctgaagcgcgaggaggaggaagagaggctcgagcagcggctgaagcgcgagcatgaggaagagaggcgcgagcaggagctagctgaggaggagcaggaacaggcccgggagcggattaagagccgcatcccgaagtggcagtggcagctagaaagcgaggccgacgcacggcaaagcaaagtctactcgaggccccgcaagcaggaagggcagaggcgccgccaagagcaggaggaaaagaggcggcgccgggagagtgagctgcaatggcaggaggaggaacgggctcaccggcagcagcaggaagaggagcagcgccgggacttcacatggcagtggcaggcggaggaaaagagcgagaggggccgtcagaggctgtcggccaggcccccattgcgggagcagcgggagaggcagctgagggccgaggagcgccagcagcgggaacaacggtttctcccggaggaggaggagaaggagcagcggcgccgccagcgacgcgagagggagaaagagctgcagttcctggaggaagaggagcagctccagcggcgggagcgtgcccaacagctccaggaggaggaggacggcctccaggaggatcaggagaggaggcgaagccaggagcagcgccgcgaccaaaaatggaggtggcaactagaagaagaaaggaagagacgccgccacacgctgtacgccaagccagccctacaagagcagctgaggaaggaacagcagctgctgcaggaggaggaggaggagctacagagagaggagcgcgagaagagaaggcgccaagaacaggagagacaataccgcgaggaagagcagctgcagcaggaggaagagcagctgctgagagaggaacgggagaaaagaagacgccaggagcgggaaaggcaatatcggaaggataagaagctgcagcagaaggaagagcagctgctgggagaggaaccggagaagagaaggcgccaggagcgggagaaaaaataccgcgaggaagaggagttgcagcaggaggaagagcagctgctgagagaggaacgggagaagagaaggcgccaggagtgggagaggcagtaccgcaaaaaagacgagctgcagcaggaagaagagcagctgctgagagaggaacgggagaaaagaagactccaggagcgggagaggcaatatcgggaggaagaggagctgcagcaggaggaagagcagctgctgggagaggaacgggagacgagaaggcgccaggagctggagaggcaatatcggaaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaaccggagaagagaaggcgccaggagcgggagaggcaatgtcgggaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaacgggagaagagaaggcgccaggagctggagaggcaatatcgggaggaagaggaggtgcagcaggaggaagagcagctgctgagagaggaaccggagaagagaaggcgccaggagctggagaggcaataccgcgaggaagaggagctgcagcaggaggaagagcagctgctgagagaggaacaggagaaaaggcgccaggagcgggagaggcagtatcgggaggaggaagagcttcagcgccagaaaaggaagcagcgataccgggatgaggatcagcgcagtgatctgaaatggcagtgggaaccagaaaaagaaaatgcagttcgtgataacaaggtttactgcaaaggcagagagaatgaacagttccggcagttggaagattcccagctgcgcgacagacaatcccagcaagatctgcagcacctgctgggtgaacagcaagagcgagatcgtgagcaagagaggaggcgctggcagcagcgcgacaggcatttcccagaggaagaacagctggagcgagaagagcaaaaggaagccaaaaggcgcgacaggaagtcccaagaggaaaagcagttgctgagagaggaaagagaagagaagagacgccgtcaagagacagacagaaaattccgcgaggaggaacagctgctccaggaaagggaggaacagccgctgcgccgccaagagcgtgacagaaaattccgcgaagaggaactgcgccatcaggaacaagggagaaaattcctcgaggaggaacagcggctgcgccgccaggaacgggagagaaaattccttaaggaggaacagcagctgcgctgccaggagcgcgagcaacagctgcgtcaggaccgcgacagaaaattccgcgaggaggaacagcagctgagccgccaagagcgtgacagaaaattccgtgaagaggaacagcaggtgcgccgccaggaacgagagagaaaattcctggaggaggaacagcagctgcgccaggagcgtcacagaaaattccgcgaagaggaacagctgctccaggaaagggaagaacagcagctgcaccgccaagagcgtgacagaaaattcctggaggaggaacaacagctgcgccgccaagagcgtgacagaaaattccgcgaacaggaactgcgcagtcaggaaccagagagaaaattcctcgaggaggaacagcagctgcaccgccagcaacggcagagaaaattcctccaggaggaacagcagctgcgccgccaggagcgcgggcaacagcggcgtcaggaccgtgacagaaaattccgcgaggaggaacagctgcgccaggagagggaggaacagcagctgagccgccaagagcgtgacagaaaattccgtttagaggaacagaaagtgcgccgccaggaacaagagagaaaattcatggaggacgaacagcagctgcgccgccaggagggccaacaacagctgcgccaggagcgcgacagaaaattccgcgaagacgaacagctgctccaggaaagggaagaacagcagctgcaccgccaagagcgtgacagaaaattcctcgaggaggaaccgcagctgcgccgccaggagcgcgaacaacagctgcgtcacgaccgcgacagaaaattccgtgaagaggaacagctgctccaggaaggggaggaacagcagctgcgccgccaagagcgtgacagaaaattccgcgaagaggaacagcagctccgccgtcaggaacgagagagaaaattcctccaggaggaacagcagctgcgccgccaggaactggagagaaaattccgtgaggaggaacagctgcgccaagaaacggagcaagagcagctgcgccgccaagaacgctacagaaaaatcctagaggaagagcagctccgtccggaaagggaagaacagcagctgcgccgccaggagcgcgacagaaaattccgcgaggaggaacagctccgccaggagagggaggaacagcagctgcgcagccaagagtctgacagaaaattccgcgaggaggaacagctacgccaggagagggaagaacagcagctgcgcccccaacagcgtgacggaaagtatcgctgggaagaagagcagctccaacttgaggaacaagagcagaggctgcggcaggagcgagaccggcagtaccgggcggaggagcagtttgccacgcaggagaagagtcgtcgtgaggaacaagaactatggcaagaagaggagcagaaacgtcgccaggaacgggaaaggaaattacgggaagaacacatccgccgccagcagaaggaggaacagaggcaccgccaagtcggggagataaaatcccaagaagggaagggccatgggcggcttctggagcccggcactcatcagtttgccagtgtcccagtgcgctccagccctctctatgagtacatccaagagcagagatctcaataccgcccttaagtgatgttgccaatatcttgacacctgccaaagcttcgagcacgggaaaatgagaaacactgggtaccaagtgataactcagatgtttctggttgtgggaaaactctctgatattagaatgtcttttcttccaaaatcttaaactacgctcattttacgcactttgtacttctgctttttattcttcctcaagtagttctttactgcaagatgtctttcttttgctctttgatgcagatgtggtgtgcatttaaaaaaaatataaatcatttaatttgtttaagaaattttgtttgaggaacatgttcatttattgctttcagaagtaacaagagtaataggatgatttgagattctaaacaatgggtcggtttgtttaatgactgacccatcttgtggaaagtgcagatacttttaatgttcaagttgctatttcttcttgaacctaaattgatcattgcctccaaacagcatttcatcttttgtggcatagttagcacaaattccaggtaactaaatttttataacccttgaatagtgcagggggagtgacctctgcataaaaacttcctgtaaaatcagcccattactggaagaaatatctgttaagaataggtttagctttgaagatttagaatttaaattagattttttttaaactcaactccacttaaacacataatctcatgaagaaataatgaggtgtttctcaacttcagagttcaaattttaaaactgtgtctgttgtagtctatagtgttcattctacttccccaagttttgatgagtttcagaatattatgaacctttgttaattttagcttgttagaaggaagctgctcagaatcccataaacatctgtcttactctagggccaataagagatcacatagagcatgttgggggtgtaaaagggaaaaatgtgtgaacataggggcaaatttctagaggccctttgacaagacccatttgcccacaatcatttgaggcctattgataataccttagatatattcttgttgaaataattggactgtgaaaaattaataataaatgtttggcaagtaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:7062 -> Molecular function: GO:0005509 [calcium ion binding] evidence: TAS
            GeneID:7062 -> Biological process: GO:0008150 [biological_process] evidence: ND
            GeneID:7062 -> Biological process: GO:0031424 [keratinization] evidence: IEA
            GeneID:7062 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:7062 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
            GeneID:7062 -> Cellular component: GO:0005856 [cytoskeleton] evidence: NAS
            GeneID:7062 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:7062 -> Cellular component: GO:0045111 [intermediate filament cytoskeleton] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.