2024-04-27 05:06:37, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_006168 1116 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens NK6 homeobox 1 (NKX6-1), mRNA. ACCESSION NM_006168 VERSION NM_006168.2 GI:111120317 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1116) AUTHORS Mamaeva,D., Ripoll,C., Bony,C., Teigell,M., Perrin,F.E., Rothhut,B., Bieche,I., Lidereau,R., Privat,A., Rigau,V., Guillon,H., Vachiery-Lahaye,F., Noel,D., Bauchet,L. and Hugnot,J.P. TITLE Isolation of mineralizing Nestin+ Nkx6.1+ vascular muscular cells from the adult human spinal cord JOURNAL BMC Neurosci 12, 99 (2011) PUBMED 21985235 REMARK GeneRIF: Smooth muscle cells expressing nestin and Nkx6.1 are the main cell population derived from culturing human spinal cord cells in adherent conditions with serum. Publication Status: Online-Only REFERENCE 2 (bases 1 to 1116) AUTHORS Gefen-Halevi,S., Rachmut,I.H., Molakandov,K., Berneman,D., Mor,E., Meivar-Levy,I. and Ferber,S. TITLE NKX6.1 promotes PDX-1-induced liver to pancreatic beta-cells reprogramming JOURNAL Cell Reprogram 12 (6), 655-664 (2010) PUBMED 21108535 REMARK GeneRIF: Data suggest that NKX6.1 activates immature pancreatic markers but not pancreatic hormone gene expression in human liver cells, and suggest a potential role for NKX6.1 in promoting PDX-1 reprogrammed maturation along a beta-cell-like lineage. REFERENCE 3 (bases 1 to 1116) AUTHORS Donelan,W., Koya,V., Li,S.W. and Yang,L.J. TITLE Distinct regulation of hepatic nuclear factor 1alpha by NKX6.1 in pancreatic beta cells JOURNAL J. Biol. Chem. 285 (16), 12181-12189 (2010) PUBMED 20106981 REMARK GeneRIF: identified an NKX6.1 recognition sequence in the distal region of the HNF1alpha promoter and demonstrated specific binding of NKX6.1 in beta cells REFERENCE 4 (bases 1 to 1116) AUTHORS Zhu,S., Xia,H.H., Yang,Y., Ma,J., Chen,M., Hu,P., Gu,Q., Liang,Y., Lin,H. and Wong,B.C. TITLE Alterations of gastric homeoprotein expression in Helicobacter pylori infection, incisural antralisation, and intestinal metaplasia JOURNAL Dig. Dis. Sci. 54 (5), 996-1002 (2009) PUBMED 18754095 REMARK GeneRIF: Alterations of gastric NKX6.1 expression in Helicobacter pylori infection, incisural antralisation, and intestinal metaplasia. REFERENCE 5 (bases 1 to 1116) AUTHORS Schisler,J.C., Fueger,P.T., Babu,D.A., Hohmeier,H.E., Tessem,J.S., Lu,D., Becker,T.C., Naziruddin,B., Levy,M., Mirmira,R.G. and Newgard,C.B. TITLE Stimulation of human and rat islet beta-cell proliferation with retention of function by the homeodomain transcription factor Nkx6.1 JOURNAL Mol. Cell. Biol. 28 (10), 3465-3476 (2008) PUBMED 18347054 REMARK GeneRIF: overexpression of Nkx6.1 in islets caused an increase in the level of [(3)H]thymidine incorporation that was twice the control level, along with complete retention of glucose-stimulated insulin secretion REFERENCE 6 (bases 1 to 1116) AUTHORS Yokoi,N., Kanamori,M., Horikawa,Y., Takeda,J., Sanke,T., Furuta,H., Nanjo,K., Mori,H., Kasuga,M., Hara,K., Kadowaki,T., Tanizawa,Y., Oka,Y., Iwami,Y., Ohgawara,H., Yamada,Y., Seino,Y., Yano,H., Cox,N.J. and Seino,S. TITLE Association studies of variants in the genes involved in pancreatic beta-cell function in type 2 diabetes in Japanese subjects JOURNAL Diabetes 55 (8), 2379-2386 (2006) PUBMED 16873704 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 7 (bases 1 to 1116) AUTHORS Hori,Y., Gu,X., Xie,X. and Kim,S.K. TITLE Differentiation of insulin-producing cells from human neural progenitor cells JOURNAL PLoS Med. 2 (4), E103 (2005) PUBMED 15839736 REFERENCE 8 (bases 1 to 1116) AUTHORS Iype,T., Taylor,D.G., Ziesmann,S.M., Garmey,J.C., Watada,H. and Mirmira,R.G. TITLE The transcriptional repressor Nkx6.1 also functions as a deoxyribonucleic acid context-dependent transcriptional activator during pancreatic beta-cell differentiation: evidence for feedback activation of the nkx6.1 gene by Nkx6.1 JOURNAL Mol. Endocrinol. 18 (6), 1363-1375 (2004) PUBMED 15056733 REMARK GeneRIF: Nkx6.1 is a bifunctional transcription factor that serves to maintain the specific expression of its own gene during beta-cell differentiation while simultaneously effecting broader gene repression events REFERENCE 9 (bases 1 to 1116) AUTHORS Jorgensen,M.C., Vestergard Petersen,H., Ericson,J., Madsen,O.D. and Serup,P. TITLE Cloning and DNA-binding properties of the rat pancreatic beta-cell-specific factor Nkx6.1 JOURNAL FEBS Lett. 461 (3), 287-294 (1999) PUBMED 10567713 REFERENCE 10 (bases 1 to 1116) AUTHORS Inoue,H., Rudnick,A., German,M.S., Veile,R., Donis-Keller,H. and Permutt,M.A. TITLE Isolation, characterization, and chromosomal mapping of the human Nkx6.1 gene (NKX6A), a new pancreatic islet homeobox gene JOURNAL Genomics 40 (2), 367-370 (1997) PUBMED 9119408 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from U66797.1, AC096766.3, U66798.1 and U66799.1. On Aug 3, 2006 this sequence version replaced gi:5453787. Summary: In the pancreas, NKX6.1 is required for the development of beta cells and is a potent bifunctional transcription regulator that binds to AT-rich sequences within the promoter region of target genes Iype et al. (2004) [PubMed 15056733].[supplied by OMIM, Mar 2008]. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns ERS025084, ERS025088 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-300 U66797.1 1-300 301-307 AC096766.3 119394-119400 c 308-676 U66797.1 308-676 677-849 U66798.1 7-179 850-1116 U66799.1 7-273 FEATURES Location/Qualifiers source 1..1116 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="4" /map="4q21.33" gene 1..1116 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /note="NK6 homeobox 1" /db_xref="GeneID:4825" /db_xref="HGNC:7839" /db_xref="MIM:602563" STS 1..1116 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /db_xref="UniSTS:481848" exon 1..676 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /inference="alignment:Splign:1.39.8" variation complement(1) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="g" /db_xref="dbSNP:367744315" CDS 7..1110 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /note="NK homeo box, family 6, member A; NK homeobox, family 6, A; homeobox protein NK-6 homolog A; NK6 transcription factor homolog A; NK6 transcription factor related, locus 1" /codon_start=1 /product="homeobox protein Nkx-6.1" /protein_id="NP_006159.2" /db_xref="GI:111120318" /db_xref="CCDS:CCDS3607.1" /db_xref="GeneID:4825" /db_xref="HGNC:7839" /db_xref="MIM:602563" /translation="
MLAVGAMEGTRQSAFLLSSPPLAALHSMAEMKTPLYPAAYPPLPAGPPSSSSSSSSSSSPSPPLGTHNPGGLKPPATGGLSSLGSPPQQLSAATPHGINDILSRPSMPVASGAALPSASPSGSSSSSSSSASASSASAAAAAAAAAAAAASSPAGLLAGLPRFSSLSPPPPPPGLYFSPSAAAVAAVGRYPKPLAELPGRTPIFWPGVMQSPPWRDARLACTPHQGSILLDKDGKRKHTRPTFSGQQIFALEKTFEQTKYLAGPERARLAYSLGMTESQVKVWFQNRRTKWRKKHAAEMATAKKKQDSETERLKGASENEEEDDDYNKPLDPNSDDEKITQLLKKHKSSSGGGGGLLLHASEPESSS
" misc_feature 310..810 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P78426.2); Region: Repressor domain (By similarity)" misc_feature 715..891 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(715..729,733..735,784..786,802..804,841..843, 847..852,859..864,868..876,880..885) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(721..723,730..732,850..852,859..864,871..873) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 922..1107 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P78426.2); Region: Involved in DNA-binding (By similarity)" variation complement(30) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:374001076" variation complement(53) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:374301540" variation complement(88) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:201655481" variation complement(90) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="g" /db_xref="dbSNP:369821275" variation complement(110) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:201007716" variation complement(243) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="g" /replace="t" /db_xref="dbSNP:371770743" variation complement(262) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="g" /db_xref="dbSNP:373841554" variation complement(468) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:141490572" variation complement(576) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:189519658" variation complement(659) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:199629267" exon 677..849 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /inference="alignment:Splign:1.39.8" variation complement(707) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="g" /replace="t" /db_xref="dbSNP:144073689" variation complement(722) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:370071295" variation complement(723) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:111718959" variation complement(787) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:377234787" exon 850..1116 /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /inference="alignment:Splign:1.39.8" variation complement(897) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:140353706" variation complement(909) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:147737825" variation complement(918) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:373335616" variation complement(933) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="g" /db_xref="dbSNP:202149574" variation complement(948) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:200968120" variation complement(950) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="g" /db_xref="dbSNP:369226825" variation complement(963) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:201751400" variation complement(973) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:200037772" variation complement(981) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:200148742" variation complement(982) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="t" /db_xref="dbSNP:200695937" variation complement(1014) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="c" /replace="t" /db_xref="dbSNP:201225646" variation complement(1026) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:369343185" variation complement(1043) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:182911773" variation complement(1060) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:200051548" variation complement(1069) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="g" /replace="t" /db_xref="dbSNP:143458004" variation complement(1080) /gene="NKX6-1" /gene_synonym="NKX6.1; NKX6A" /replace="a" /replace="g" /db_xref="dbSNP:374937515" ORIGIN
cgtgggatgttagcggtgggggcaatggagggcacccggcagagcgcattcctgctcagcagccctcccctggccgccctgcacagcatggccgagatgaagaccccgctgtaccctgccgcgtatcccccgctgcctgccggccccccctcctcctcgtcctcgtcgtcgtcctcctcgtcgccctccccgcctctgggcacccacaacccaggcggcctgaagcccccggccacgggggggctctcatccctcggcagccccccgcagcagctctcggccgccaccccacacggcatcaacgatatcctgagccggccctccatgcccgtggcctcgggggccgccctgccctccgcctcgccctccggttcctcctcctcctcttcctcgtccgcctctgcctcctccgcctctgccgccgccgcggctgctgccgcggccgcagccgccgcctcatccccggcggggctgctggccggactgccacgctttagcagcctgagcccgccgccgccgccgcccgggctctacttcagccccagcgccgcggccgtggccgccgtgggccggtaccccaagccgctggctgagctgcctggccggacgcccatcttctggcccggagtgatgcagagcccgccctggagggacgcacgcctggcctgtacccctcatcaaggatccattttgttggacaaagacgggaagagaaaacacacgagacccactttttccggacagcagatcttcgccctggagaagactttcgaacaaacaaaatacttggcggggcccgagagggctcgtttggcctattcgttggggatgacagagagtcaggtcaaggtctggttccagaaccgccggaccaagtggaggaagaagcacgctgccgagatggccacggccaagaagaagcaggactcggagacagagcgcctcaagggggcctcggagaacgaggaagaggacgacgactacaataagcctctggatcccaactcggacgacgagaaaatcacgcagctgttgaagaagcacaagtccagcagcggcggcggcggcggcctcctactgcacgcgtccgagccggagagctcatcctgaacgccg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:4825 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA GeneID:4825 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA GeneID:4825 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:4825 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: ISS GeneID:4825 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: IEA GeneID:4825 -> Biological process: GO:0007224 [smoothened signaling pathway] evidence: IEA GeneID:4825 -> Biological process: GO:0008283 [cell proliferation] evidence: IEA GeneID:4825 -> Biological process: GO:0009887 [organ morphogenesis] evidence: TAS GeneID:4825 -> Biological process: GO:0021912 [regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification] evidence: IEA GeneID:4825 -> Biological process: GO:0021913 [regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification] evidence: IEA GeneID:4825 -> Biological process: GO:0031016 [pancreas development] evidence: ISS GeneID:4825 -> Biological process: GO:0031018 [endocrine pancreas development] evidence: TAS GeneID:4825 -> Biological process: GO:0032024 [positive regulation of insulin secretion] evidence: IEA GeneID:4825 -> Biological process: GO:0035094 [response to nicotine] evidence: IEA GeneID:4825 -> Biological process: GO:0042493 [response to drug] evidence: IEA GeneID:4825 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IEA GeneID:4825 -> Biological process: GO:0045686 [negative regulation of glial cell differentiation] evidence: IEA GeneID:4825 -> Biological process: GO:0045687 [positive regulation of glial cell differentiation] evidence: IEA GeneID:4825 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: ISS GeneID:4825 -> Biological process: GO:0048709 [oligodendrocyte differentiation] evidence: IEA GeneID:4825 -> Biological process: GO:0051091 [positive regulation of sequence-specific DNA binding transcription factor activity] evidence: ISS GeneID:4825 -> Biological process: GO:0051594 [detection of glucose] evidence: ISS GeneID:4825 -> Biological process: GO:0071345 [cellular response to cytokine stimulus] evidence: IEA GeneID:4825 -> Biological process: GO:0071375 [cellular response to peptide hormone stimulus] evidence: IEA GeneID:4825 -> Biological process: GO:0072560 [type B pancreatic cell maturation] evidence: ISS GeneID:4825 -> Biological process: GO:2000078 [positive regulation of type B pancreatic cell development] evidence: ISS GeneID:4825 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:4825 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.