GGRNA | NM_005315.1

LOCUS       NM_005315                618 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens goosecoid homeobox 2 (GSC2), mRNA.
ACCESSION   NM_005315
VERSION     NM_005315.1  GI:4885362
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 618)
  AUTHORS   Inouye,M., Ripatti,S., Kettunen,J., Lyytikainen,L.P., Oksala,N.,
            Laurila,P.P., Kangas,A.J., Soininen,P., Savolainen,M.J.,
            Viikari,J., Kahonen,M., Perola,M., Salomaa,V., Raitakari,O.,
            Lehtimaki,T., Taskinen,M.R., Jarvelin,M.R., Ala-Korpela,M.,
            Palotie,A. and de Bakker,P.I.
  TITLE     Novel Loci for metabolic networks and multi-tissue expression
            studies reveal genes for atherosclerosis
  JOURNAL   PLoS Genet. 8 (8), E1002907 (2012)
   PUBMED   22916037
REFERENCE   2  (bases 1 to 618)
  AUTHORS   Galili,N., Nayak,S., Epstein,J.A. and Buck,C.A.
  TITLE     Rnf4, a RING protein expressed in the developing nervous and
            reproductive systems, interacts with Gscl, a gene within the
            DiGeorge critical region
  JOURNAL   Dev. Dyn. 218 (1), 102-111 (2000)
   PUBMED   10822263
REFERENCE   3  (bases 1 to 618)
  AUTHORS   Gottlieb,S., Hanes,S.D., Golden,J.A., Oakey,R.J. and Budarf,M.L.
  TITLE     Goosecoid-like, a gene deleted in DiGeorge and velocardiofacial
            syndromes, recognizes DNA with a bicoid-like specificity and is
            expressed in the developing mouse brain
  JOURNAL   Hum. Mol. Genet. 7 (9), 1497-1505 (1998)
   PUBMED   9700206
REFERENCE   4  (bases 1 to 618)
  AUTHORS   Funke,B., Saint-Jore,B., Puech,A., Sirotkin,H., Edelmann,L.,
            Carlson,C., Raft,S., Pandita,R.K., Kucherlapati,R., Skoultchi,A.
            and Morrow,B.E.
  TITLE     Characterization and mutation analysis of goosecoid-like (GSCL), a
            homeodomain-containing gene that maps to the critical region for
            VCFS/DGS on 22q11
  JOURNAL   Genomics 46 (3), 364-372 (1997)
   PUBMED   9441739
REFERENCE   5  (bases 1 to 618)
  AUTHORS   Gottlieb,S., Emanuel,B.S., Driscoll,D.A., Sellinger,B., Wang,Z.,
            Roe,B. and Budarf,M.L.
  TITLE     The DiGeorge syndrome minimal critical region contains a
            goosecoid-like (GSCL) homeobox gene that is expressed early in
            human development
  JOURNAL   Am. J. Hum. Genet. 60 (5), 1194-1201 (1997)
   PUBMED   9150167
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from U96402.1.
            
            Summary: Goosecoidlike (GSCL), a homeodomain-containing gene,
            resides in the critical region for VCFS/DGS on 22q11.
            Velocardiofacial syndrome (VCFS) is a developmental disorder
            characterized by conotruncal heart defects, craniofacial anomalies,
            and learning disabilities. VCFS is phenotypically related to
            DiGeorge syndrome (DGS) and both syndromes are associated with
            hemizygous 22q11 deletions. Because many of the tissues and
            structures affected in VCFS/DGS derive from the pharyngeal arches
            of the developing embryo, it is believed that haploinsufficiency of
            a gene involved in embryonic development may be responsible for its
            etiology. The gene is expressed in a limited number of adult
            tissues, as well as in early human development. [provided by
            RefSeq, Jul 2008].
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data because no single transcript was available for the full length
            of the gene. The extent of this transcript is supported by
            experimental evidence.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025084, ERS025085
                              [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..618
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="22"
                     /map="22q11.21"
     gene            1..618
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /note="goosecoid homeobox 2"
                     /db_xref="GeneID:2928"
                     /db_xref="HGNC:4613"
                     /db_xref="HPRD:03506"
                     /db_xref="MIM:601845"
     CDS             1..618
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /note="GSC-2; GSC-L"
                     /codon_start=1
                     /product="homeobox protein goosecoid-2"
                     /protein_id="NP_005306.1"
                     /db_xref="GI:4885363"
                     /db_xref="CCDS:CCDS13757.1"
                     /db_xref="GeneID:2928"
                     /db_xref="HGNC:4613"
                     /db_xref="HPRD:03506"
                     /db_xref="MIM:601845"
                     /translation="

MAAAAGGAASRRGAGRPCPFSIEHILSSLPERSLPARAACPPQPAGRQSPAKPEEPGAPEAAPCACCCCCGPRAAPCGPPEAAAGLGARLAWPLRLGPAVPLSLGAPAGGSGALPGAVGPGSQRRTRRHRTIFSEEQLQALEALFVQNQYPDVSTRERLAGRIRLREERVEVWFKNRRAKWRHQKRASASARLLPGVKKSPKGSC

"
     misc_feature    379..555
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(379..393,397..399,448..450,466..468,505..507,
                     511..516,523..528,532..540,544..549)
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(385..387,394..396,514..516,523..528,535..537)
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     STS             1..618
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /db_xref="UniSTS:481722"
     exon            1..259
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /inference="alignment:Splign:1.39.8"
     variation       139
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34341950"
     exon            260..513
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /inference="alignment:Splign:1.39.8"
     exon            514..618
                     /gene="GSC2"
                     /gene_synonym="GSCL"
                     /inference="alignment:Splign:1.39.8"
ORIGIN

atggcggcagcggctgggggcgcggcgagccgccggggtgccgggcggccctgccccttctccatcgagcacatcctctccagcctgcccgagcggagcctcccggcccgggccgcctgcccaccgcagcccgccggtcgccagagccccgcgaagccagaggagcccggggcgcccgaggctgcgccctgcgcctgctgctgctgctgcggcccccgcgcggcgccctgcgggcccccagaggcggccgccgggctgggcgctcgtctggcgtggccgctgaggctgggaccggcggtgcccttgtctctgggtgcgccagccggaggttccggggcgctcccgggcgcggtcggcccgggttcgcagcggcgcacgaggcgccaccgcaccatcttcagcgaagagcagctgcaggcgctcgaggcgcttttcgtgcagaaccagtatcctgacgtgagtacgcgcgagcgcctggccggccgcatccgccttcgcgaggagcgcgtggaggtctggttcaagaaccgccgggccaaatggcgacaccagaagcgcgcgtcggcttccgcgaggctcctgcccggcgtcaagaagtccccgaaggggagctgctga

//

Annotations: