GGRNA Home | Help | Advanced search

2024-04-26 16:19:24, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005246               2950 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens fer (fps/fes related) tyrosine kinase (FER), mRNA.
ACCESSION   NM_005246
VERSION     NM_005246.2  GI:119964720
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2950)
  AUTHORS   Yoneyama,T., Angata,K., Bao,X., Courtneidge,S., Chanda,S.K. and
            Fukuda,M.
  TITLE     Fer kinase regulates cell migration through alpha-dystroglycan
            glycosylation
  JOURNAL   Mol. Biol. Cell 23 (5), 771-780 (2012)
   PUBMED   22238358
  REMARK    GeneRIF: Fer, a non-receptor-type tyrosine kinase, plays a critical
            role in synthesis of the laminin-binding glycans on alpha-DG.
REFERENCE   2  (bases 1 to 2950)
  AUTHORS   Makovski,A., Yaffe,E., Shpungin,S. and Nir,U.
  TITLE     Intronic promoter drives the BORIS-regulated expression of FerT in
            colon carcinoma cells
  JOURNAL   J. Biol. Chem. 287 (9), 6100-6112 (2012)
   PUBMED   22223638
  REMARK    GeneRIF: Transcription of the ferT gene in CC cells was found to be
            driven by an intronic promoter residing in intron 10 of the fer
            gene and to be regulated by the Brother of the Regulator of
            Imprinted Sites (BORIS) transcription factor.
REFERENCE   3  (bases 1 to 2950)
  AUTHORS   Qi,L., Menzaghi,C., Salvemini,L., De Bonis,C., Trischitta,V. and
            Hu,F.B.
  TITLE     Novel locus FER is associated with serum HMW adiponectin levels
  JOURNAL   Diabetes 60 (8), 2197-2201 (2011)
   PUBMED   21700879
  REMARK    GeneRIF: The A allele of SNP rs10447248 in the FER locus was
            nominally associated with lower MMW (P = 0.016) but was not
            associated with LMW (P > 0.05) adiponectin levels
REFERENCE   4  (bases 1 to 2950)
  AUTHORS   Guo,C. and Stark,G.R.
  TITLE     FER tyrosine kinase (FER) overexpression mediates resistance to
            quinacrine through EGF-dependent activation of NF-kappaB
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 108 (19), 7968-7973 (2011)
   PUBMED   21518868
  REMARK    GeneRIF: Overexpression of FER from a cDNA confers quinacrine
            resistance to several different types of cancer cell lines.
REFERENCE   5  (bases 1 to 2950)
  AUTHORS   Fei,F., Kweon,S.M., Haataja,L., De Sepulveda,P., Groffen,J. and
            Heisterkamp,N.
  TITLE     The Fer tyrosine kinase regulates interactions of Rho
            GDP-Dissociation Inhibitor alpha with the small GTPase Rac
  JOURNAL   BMC Biochem. 11, 48 (2010)
   PUBMED   21122136
  REMARK    GeneRIF: tyrosine phosphorylation of RhoGDIalpha by Fer as a
            mechanism to regulate binding of RhoGDIalpha to Rac
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2950)
  AUTHORS   Warrington,J.A., Hall,L.V., Hinton,L.M., Miller,J.N., Wasmuth,J.J.
            and Lovett,M.
  TITLE     Radiation hybrid map of 13 loci on the long arm of chromosome 5
  JOURNAL   Genomics 11 (3), 701-708 (1991)
   PUBMED   1663488
  REMARK    Erratum:[Genomics 1992 Nov;14(3):832]
REFERENCE   7  (bases 1 to 2950)
  AUTHORS   Nishisho,I., Nakamura,Y., Miyoshi,Y., Miki,Y., Ando,H., Horii,A.,
            Koyama,K., Utsunomiya,J., Baba,S. and Hedge,P.
  TITLE     Mutations of chromosome 5q21 genes in FAP and colorectal cancer
            patients
  JOURNAL   Science 253 (5020), 665-669 (1991)
   PUBMED   1651563
REFERENCE   8  (bases 1 to 2950)
  AUTHORS   Hao,Q.L., Ferris,D.K., White,G., Heisterkamp,N. and Groffen,J.
  TITLE     Nuclear and cytoplasmic location of the FER tyrosine kinase
  JOURNAL   Mol. Cell. Biol. 11 (2), 1180-1183 (1991)
   PUBMED   1990274
REFERENCE   9  (bases 1 to 2950)
  AUTHORS   Krolewski,J.J., Lee,R., Eddy,R., Shows,T.B. and Dalla-Favera,R.
  TITLE     Identification and chromosomal mapping of new human tyrosine kinase
            genes
  JOURNAL   Oncogene 5 (3), 277-282 (1990)
   PUBMED   2156206
REFERENCE   10 (bases 1 to 2950)
  AUTHORS   Morris,C., Heisterkamp,N., Hao,Q.L., Testa,J.R. and Groffen,J.
  TITLE     The human tyrosine kinase gene (FER) maps to chromosome 5 and is
            deleted in myeloid leukemias with a del(5q)
  JOURNAL   Cytogenet. Cell Genet. 53 (4), 196-200 (1990)
   PUBMED   2209086
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from J03358.1 and BC017060.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Dec 27, 2006 this sequence version replaced gi:4885230.
            
            Summary:  Fer protein is a member of the FPS/FES family of
            nontransmembrane receptor tyrosine kinases. It regulates cell-cell
            adhesion and mediates signaling from the cell surface to the
            cytoskeleton via growth factor receptors. [provided by RefSeq, Jul
            2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: J03358.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025098 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1698              J03358.1           1-1698
            1699-1713           BC017060.1         1381-1395
            1714-2950           J03358.1           1714-2950
FEATURES             Location/Qualifiers
     source          1..2950
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q21"
     gene            1..2950
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="fer (fps/fes related) tyrosine kinase"
                     /db_xref="GeneID:2241"
                     /db_xref="HGNC:3655"
                     /db_xref="MIM:176942"
     exon            1..179
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       102
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192003318"
     exon            180..325
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       197
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369010776"
     variation       198
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182439411"
     variation       199
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187440009"
     variation       283
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191529165"
     variation       296
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184164646"
     variation       311
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188764630"
     exon            326..591
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       366
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141543178"
     misc_feature    367..369
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="upstream in-frame stop codon"
     CDS             385..2853
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /EC_number="2.7.10.2"
                     /note="phosphoprotein NCP94; p94-Fer; tyrosine kinase 3;
                     proto-oncogene c-Fer; feline encephalitis virus-related
                     kinase FER; fujinami poultry sarcoma/Feline
                     sarcoma-related protein Fer; protein phosphatase 1,
                     regulatory subunit 74"
                     /codon_start=1
                     /product="tyrosine-protein kinase Fer"
                     /protein_id="NP_005237.2"
                     /db_xref="GI:119964721"
                     /db_xref="CCDS:CCDS4098.1"
                     /db_xref="GeneID:2241"
                     /db_xref="HGNC:3655"
                     /db_xref="MIM:176942"
                     /translation="
MGFGSDLKNSHEAVLKLQDWELRLLETVKKFMALRIKSDKEYASTLQNLCNQVDKESTVQMNYVSNVSKSWLLMIQQTEQLSRIMKTHAEDLNSGPLHRLTMMIKDKQQVKKSYIGVHQQIEAEMIKVTKTELEKLKCSYRQLIKEMNSAKEKYKEALAKGKETEKAKERYDKATMKLHMLHNQYVLALKGAQLHQNQYYDITLPLLLDSLQKMQEEMIKALKGIFDEYSQITSLVTEEIVNVHKEIQMSVEQIDPSTEYNNFIDVHRTTAAKEQEIEFDTSLLEENENLQANEIMWNNLTAESLQVMLKTLAEELMQTQQMLLNKEEAVLELEKRIEESSETCEKKSDIVLLLSQKQALEELKQSVQQLRCTEAKFSAQKELLEQKVQENDGKEPPPVVNYEEDARSVTSMERKERLSKFESIRHSIAGIIRSPKSALGSSALSDMISISEKPLAEQDWYHGAIPRIEAQELLKKQGDFLVRESHGKPGEYVLSVYSDGQRRHFIIQYVDNMYRFEGTGFSNIPQLIDHHYTTKQVITKKSGVVLLNPIPKDKKWILSHEDVILGELLGKGNFGEVYKGTLKDKTSVAVKTCKEDLPQELKIKFLQEAKILKQYDHPNIVKLIGVCTQRQPVYIIMELVSGGDFLTFLRRKKDELKLKQLVKFSLDAAAGMLYLESKNCIHRDLAARNCLVGENNVLKISDFGMSRQEDGGVYSSSGLKQIPIKWTAPEALNYGRYSSESDVWSFGILLWETFSLGVCPYPGMTNQQAREQVERGYRMSAPQHCPEDISKIMMKCWDYKPENRPKFSELQKELTIIKRKLT
"
     misc_feature    385..1284
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P16591.2);
                     Region: Important for interaction with membranes
                     containing phosphoinositides"
     misc_feature    397..1098
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="The F-BAR (FES-CIP4 Homology and
                     Bin/Amphiphysin/Rvs) domain of Fer (Fes related) tyrosine
                     kinase; Region: F-BAR_Fer; cd07686"
                     /db_xref="CDD:153370"
     misc_feature    order(412..414,421..423,442..444,451..456,463..465,
                     472..477,484..489,496..498,508..510,517..519,529..531,
                     613..615,622..624,886..888,898..900,973..975,997..999,
                     1006..1008,1015..1020,1027..1029,1039..1041,1048..1050,
                     1060..1062,1072..1074,1081..1086,1093..1095)
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:153370"
     misc_feature    1588..1590
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine; propagated from
                     UniProtKB/Swiss-Prot (P16591.2); phosphorylation site"
     misc_feature    1588..1590
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01491"
     misc_feature    1588..1590
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1684..1686
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P16591.2); phosphorylation site"
     misc_feature    1684..1686
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01491"
     misc_feature    1741..1998
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="Src homology 2 (SH2) domain found in feline
                     sarcoma, Fujinami poultry sarcoma, and fes-related
                     (Fes/Fps/Fer) proteins; Region: SH2_Fps_family; cd10361"
                     /db_xref="CDD:198224"
     misc_feature    order(1783..1785,1831..1833,1894..1896,1900..1902)
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="phosphotyrosine binding pocket [polypeptide
                     binding]; other site"
                     /db_xref="CDD:198224"
     misc_feature    order(1897..1899,1975..1977)
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="hydrophobic binding pocket [polypeptide binding];
                     other site"
                     /db_xref="CDD:198224"
     misc_feature    2071..2826
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="Protein tyrosine kinase; Region: Pkinase_Tyr;
                     pfam07714"
                     /db_xref="CDD:203736"
     misc_feature    2083..2832
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="Catalytic domain of the Protein Tyrosine Kinase,
                     Fer; Region: PTKc_Fer; cd05085"
                     /db_xref="CDD:133216"
     misc_feature    order(2089..2097,2113..2115,2149..2151,2155..2157,
                     2206..2208,2293..2304,2311..2316,2434..2436,2446..2451,
                     2455..2457,2485..2490,2539..2556,2560..2562,2680..2682,
                     2692..2694)
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="active site"
                     /db_xref="CDD:133216"
     misc_feature    order(2089..2097,2113..2115,2149..2151,2155..2157,
                     2206..2208,2293..2304,2311..2316,2446..2451,2455..2457,
                     2485..2490)
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:133216"
     misc_feature    order(2434..2436,2446..2451,2539..2556,2560..2562,
                     2680..2682,2692..2694)
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:133216"
     misc_feature    2485..2559
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:133216"
     misc_feature    2524..2526
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine, by autocatalysis; propagated from
                     UniProtKB/Swiss-Prot (P16591.2); phosphorylation site"
     misc_feature    2524..2526
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01491"
     variation       441
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144530313"
     variation       445..446
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:35665762"
     variation       451
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147858956"
     variation       452
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199698325"
     variation       468
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2229085"
     variation       478
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142838306"
     variation       564
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146363767"
     variation       573
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56199104"
     variation       579
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374282780"
     variation       581
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371972203"
     variation       582
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190188307"
     variation       583
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376919194"
     exon            592..765
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       618
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150212580"
     variation       676
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377413281"
     variation       700
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200116493"
     variation       713
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113090262"
     variation       750
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376506569"
     exon            766..865
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       766
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35150210"
     variation       801
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56244110"
     variation       828
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375647419"
     variation       840
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55954478"
     exon            866..1049
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       910
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138502993"
     variation       935
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376155654"
     variation       949
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149637747"
     variation       986
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369584454"
     variation       1005
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372794297"
     variation       1032
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370663101"
     exon            1050..1187
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       1059
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143449963"
     variation       1108
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147265497"
     variation       1117
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141693705"
     variation       1123
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370199096"
     variation       1133
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147156724"
     variation       1156
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140381149"
     variation       1166
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182613310"
     variation       1180
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201582060"
     exon            1188..1307
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       1218
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371373758"
     variation       1233
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142818071"
     variation       1234
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199857892"
     variation       1271
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78300586"
     variation       1280
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147403485"
     variation       1282
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139205864"
     variation       1306
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149945605"
     exon            1308..1430
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       1312
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371991026"
     variation       1317
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374674458"
     variation       1323
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368242135"
     variation       1324
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372482792"
     variation       1350
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145208291"
     variation       1351
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200461855"
     variation       1424
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148708882"
     exon            1431..1620
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       1433
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115520719"
     variation       1434
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202195528"
     variation       1460
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376917767"
     variation       1463
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75191436"
     variation       1467
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146825031"
     variation       1488
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370261354"
     variation       1506
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140609551"
     variation       1533
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35990968"
     variation       1558
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146594490"
     variation       1618
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33940843"
     exon            1621..1713
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       1627
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:150263624"
     variation       1641
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56341714"
     variation       1653
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137918625"
     variation       1657
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149466013"
     variation       1680
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145742969"
     variation       1699
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2229086"
     variation       1701
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375067286"
     variation       1711
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34259824"
     exon            1714..1917
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       1743
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34940896"
     variation       1830
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142731169"
     variation       1853
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375338865"
     variation       1904
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34204308"
     variation       1913
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147406165"
     exon            1918..2040
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       1924
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200996798"
     variation       1928
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373617030"
     variation       1941
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34320303"
     variation       1951
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200527034"
     variation       1956
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372148186"
     variation       1961
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:34269985"
     variation       1971
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34869483"
     variation       2036
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191621957"
     exon            2041..2097
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       2076
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150352843"
     variation       2093
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373771239"
     exon            2098..2213
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       2124
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150935294"
     variation       2136
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919771"
     variation       2138
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139628994"
     variation       2185
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183440274"
     exon            2214..2308
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       2217
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144241765"
     variation       2223
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145364639"
     variation       2235
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149182269"
     variation       2251
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377353306"
     variation       2269
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74618133"
     exon            2309..2432
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       2360
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142394379"
     variation       2408
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112575947"
     exon            2433..2587
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       2461
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375506762"
     variation       2472
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368804605"
     variation       2504
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151332661"
     exon            2588..2710
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       2595
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141853188"
     variation       2597
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145807358"
     variation       2611
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202063368"
     variation       2619
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55876507"
     variation       2626
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201346702"
     variation       2658
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200387943"
     variation       2664
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141252882"
     variation       2708
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146949083"
     exon            2711..2950
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /inference="alignment:Splign:1.39.8"
     variation       2713
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137975508"
     STS             2733..2893
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /standard_name="RH71338"
                     /db_xref="UniSTS:47265"
     variation       2739..2740
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:36084170"
     variation       2739
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190232603"
     variation       2767
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149517787"
     STS             2788..2912
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /standard_name="RH68965"
                     /db_xref="UniSTS:41338"
     variation       2800
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144036103"
     variation       2820
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148283941"
     variation       2821
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56097357"
     variation       2824
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201713568"
     variation       2827
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141808872"
     variation       2828
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200830629"
     variation       2836
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201191333"
     variation       2853
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201854726"
     variation       2865
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369778570"
     variation       2870
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1133392"
     polyA_site      2945
                     /gene="FER"
                     /gene_synonym="FerT; PPP1R74; TYK3"
ORIGIN      
gtcacaccctcgaataatgacgcatacctatcctactgttactgatcacctagtaataatcttgtagttcacattactcatttttcaccaaattcttttggtgaaggacgcttcagaaacggccatcactgaagagcagacccgtttgggttctccacgcattctagactcccgaagagctcatgttttttggctagacctatgaccattttcgctagacttcactgcacgttttctcaagtatcttctttgtccctaatgtgtgacacctcatcatggacacgctactttagctaaggcatgaccagcaatgaacagtagtaagatatgtgctgattagaaggctcacttgtgcagtgtggaggataaccagtgccttacaaaatggggtttgggagtgacctgaagaattcacatgaagcagtgttaaaattgcaagactgggaattacggttactggaaacagtaaagaaatttatggccctgagaataaaaagtgataaagaatatgcatctactttacagaacctttgtaatcaagttgataaggaaagtactgtccaaatgaattatgtcagcaacgtatccaagtcttggctacttatgattcagcagacagaacaacttagtaggataatgaagacacatgcagaggacttgaactctggacctttacacaggctcaccatgatgattaaggacaagcagcaggtgaagaaaagttacataggtgttcatcagcagatagaggcagagatgatcaaggttaccaaaacagaattggagaagttaaaatgcagctatagacaattaataaaagaaatgaattctgccaaagagaaatataaagaagctttagctaaagggaaggaaactgaaaaggccaaggaacgatacgacaaagccacaatgaaacttcatatgttgcacaatcagtatgtattggcgttgaaaggggcacagctccatcagaatcagtattatgatatcacacttcccctgcttctggactccttacaaaagatgcaagaagaaatgataaaagcactcaaaggtatatttgatgaatacagccagataaccagtcttgtcacagaggaaatagtgaatgtccataaagagattcaaatgtcggttgaacagatagatcctagtacagaatacaataatttcatagatgttcacagaacaacggctgctaaagaacaagaaatagagtttgatacttccttactggaagaaaatgaaaatcttcaggcaaatgagatcatgtggaataacttaacagcagaaagtttgcaagtaatgttgaaaacgttagcggaagaacttatgcaaacacagcagatgcttttaaacaaggaggaggctgttttggagttagagaagagaattgaagaatcttctgaaacttgtgagaagaagtctgatattgtgcttctgctaagccaaaaacaggcacttgaagaactgaaacagtcagtccagcagctgagatgcactgaagcaaagttttcagcacagaaggaattactagagcaaaaagtgcaagaaaatgatgggaaagagccacctccagtagtaaattatgaagaagatgcacgatcagttacatctatggaaagaaaggagaggctatccaaatttgaatctattcgtcattcaattgctggaataattaggtctccaaaatctgcactgggctcttcagcactttctgatatgatctccatcagtgagaagcctttggcagaacaggactggtaccatggtgcaattcccagaatagaagctcaagaactgttaaaaaaacaaggagactttttggtgcgagagagtcatgggaaacctggtgaatatgtcctttctgtatattctgatggacagaggagacattttatcatacaatatgttgataacatgtatcgattcgagggcactgggttttcaaacattcctcaacttatagatcatcactatacaacaaaacaggtcatcactaagaaatcaggtgtagttctgctgaatcctattcctaaggacaagaaatggattctcagtcatgaagatgtcatattgggagaattactgggcaagggaaattttggtgaagtatataagggcacattaaaggataaaacttctgttgctgttaaaacatgtaaagaagatcttcctcaggaattgaaaataaaatttttacaagaagccaaaattctcaagcaatatgatcatcccaatattgtcaaacttataggagtttgcacacaaagacagcctgtctacatcattatggaactggtttcaggaggtgatttcctcacctttctgagaaggaagaaggatgaactaaaactcaaacagttagtgaaattttcattagacgctgctgctggtatgttgtatctcgagagtaaaaactgtatacacagggaccttgctgcaagaaactgcctggtaggtgaaaataatgttctgaaaatcagtgactttggaatgtctcgtcaagaggatggtggagtgtattcatcttctggcttaaagcagattcccattaaatggacagcaccggaagctcttaattatgggagatacagttcagagagtgacgtgtggagctttggcatccttctctgggagaccttcagcttaggggtttgtccgtaccctggaatgacaaatcagcaagcaagagagcaagtagaaagaggataccggatgtcagctccccagcactgtccagaggatatttccaaaatcatgatgaagtgttgggattataaacctgaaaatcgccctaagttcagtgaacttcagaaagagctcactatcatcaagagaaaactcacatagtgacaggatggcgccaaactcagccttcaggactctgtcctccagcagagtaacattattgttctcattaacaatgaatttataccacattaccttc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:2241 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
            GeneID:2241 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: TAS
            GeneID:2241 -> Molecular function: GO:0004715 [non-membrane spanning protein tyrosine kinase activity] evidence: IDA
            GeneID:2241 -> Molecular function: GO:0005154 [epidermal growth factor receptor binding] evidence: IDA
            GeneID:2241 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:2241 -> Molecular function: GO:0008157 [protein phosphatase 1 binding] evidence: IEA
            GeneID:2241 -> Molecular function: GO:0008289 [lipid binding] evidence: IDA
            GeneID:2241 -> Molecular function: GO:0017137 [Rab GTPase binding] evidence: IEA
            GeneID:2241 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IEA
            GeneID:2241 -> Molecular function: GO:0045295 [gamma-catenin binding] evidence: IEA
            GeneID:2241 -> Molecular function: GO:0045296 [cadherin binding] evidence: IEA
            GeneID:2241 -> Biological process: GO:0000226 [microtubule cytoskeleton organization] evidence: IMP
            GeneID:2241 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: IMP
            GeneID:2241 -> Biological process: GO:0001932 [regulation of protein phosphorylation] evidence: ISS
            GeneID:2241 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
            GeneID:2241 -> Biological process: GO:0006935 [chemotaxis] evidence: IEA
            GeneID:2241 -> Biological process: GO:0008283 [cell proliferation] evidence: IMP
            GeneID:2241 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: TAS
            GeneID:2241 -> Biological process: GO:0010591 [regulation of lamellipodium assembly] evidence: IDA
            GeneID:2241 -> Biological process: GO:0010762 [regulation of fibroblast migration] evidence: IEA
            GeneID:2241 -> Biological process: GO:0018108 [peptidyl-tyrosine phosphorylation] evidence: IDA
            GeneID:2241 -> Biological process: GO:0019221 [cytokine-mediated signaling pathway] evidence: IMP
            GeneID:2241 -> Biological process: GO:0030335 [positive regulation of cell migration] evidence: IMP
            GeneID:2241 -> Biological process: GO:0030838 [positive regulation of actin filament polymerization] evidence: IMP
            GeneID:2241 -> Biological process: GO:0031532 [actin cytoskeleton reorganization] evidence: ISS
            GeneID:2241 -> Biological process: GO:0032496 [response to lipopolysaccharide] evidence: ISS
            GeneID:2241 -> Biological process: GO:0032869 [cellular response to insulin stimulus] evidence: ISS
            GeneID:2241 -> Biological process: GO:0033007 [negative regulation of mast cell activation involved in immune response] evidence: ISS
            GeneID:2241 -> Biological process: GO:0034446 [substrate adhesion-dependent cell spreading] evidence: ISS
            GeneID:2241 -> Biological process: GO:0034614 [cellular response to reactive oxygen species] evidence: ISS
            GeneID:2241 -> Biological process: GO:0035426 [extracellular matrix-cell signaling] evidence: ISS
            GeneID:2241 -> Biological process: GO:0035556 [intracellular signal transduction] evidence: TAS
            GeneID:2241 -> Biological process: GO:0036006 [cellular response to macrophage colony-stimulating factor stimulus] evidence: IMP
            GeneID:2241 -> Biological process: GO:0036119 [response to platelet-derived growth factor stimulus] evidence: ISS
            GeneID:2241 -> Biological process: GO:0038028 [insulin receptor signaling pathway via phosphatidylinositol 3-kinase cascade] evidence: ISS
            GeneID:2241 -> Biological process: GO:0038095 [Fc-epsilon receptor signaling pathway] evidence: ISS
            GeneID:2241 -> Biological process: GO:0038109 [Kit signaling pathway] evidence: ISS
            GeneID:2241 -> Biological process: GO:0042058 [regulation of epidermal growth factor receptor signaling pathway] evidence: IMP
            GeneID:2241 -> Biological process: GO:0042503 [tyrosine phosphorylation of Stat3 protein] evidence: IDA
            GeneID:2241 -> Biological process: GO:0044331 [cell-cell adhesion mediated by cadherin] evidence: ISS
            GeneID:2241 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA
            GeneID:2241 -> Biological process: GO:0048008 [platelet-derived growth factor receptor signaling pathway] evidence: ISS
            GeneID:2241 -> Biological process: GO:0048008 [platelet-derived growth factor receptor signaling pathway] evidence: TAS
            GeneID:2241 -> Biological process: GO:0050904 [diapedesis] evidence: ISS
            GeneID:2241 -> Biological process: GO:0051092 [positive regulation of NF-kappaB transcription factor activity] evidence: IMP
            GeneID:2241 -> Biological process: GO:0070102 [interleukin-6-mediated signaling pathway] evidence: IMP
            GeneID:2241 -> Cellular component: GO:0000790 [nuclear chromatin] evidence: IDA
            GeneID:2241 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:2241 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:2241 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:2241 -> Cellular component: GO:0005938 [cell cortex] evidence: IEA
            GeneID:2241 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IDA
            GeneID:2241 -> Cellular component: GO:0015630 [microtubule cytoskeleton] evidence: IDA
            GeneID:2241 -> Cellular component: GO:0030027 [lamellipodium] evidence: IDA
            GeneID:2241 -> Cellular component: GO:0030054 [cell junction] evidence: IDA
            GeneID:2241 -> Cellular component: GO:0031234 [extrinsic to internal side of plasma membrane] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_005237 -> EC 2.7.10.2

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.