GGRNA Home | Help | Advanced search

2024-04-19 20:09:12, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005032               3612 bp    mRNA    linear   PRI 01-JUL-2013
DEFINITION  Homo sapiens plastin 3 (PLS3), transcript variant 1, mRNA.
ACCESSION   NM_005032
VERSION     NM_005032.5  GI:288915537
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3612)
  AUTHORS   Yokobori,T., Iinuma,H., Shimamura,T., Imoto,S., Sugimachi,K.,
            Ishii,H., Iwatsuki,M., Ota,D., Ohkuma,M., Iwaya,T., Nishida,N.,
            Kogo,R., Sudo,T., Tanaka,F., Shibata,K., Toh,H., Sato,T.,
            Barnard,G.F., Fukagawa,T., Yamamoto,S., Nakanishi,H., Sasaki,S.,
            Miyano,S., Watanabe,T., Kuwano,H., Mimori,K., Pantel,K. and Mori,M.
  TITLE     Plastin3 is a novel marker for circulating tumor cells undergoing
            the epithelial-mesenchymal transition and is associated with
            colorectal cancer prognosis
  JOURNAL   Cancer Res. 73 (7), 2059-2069 (2013)
   PUBMED   23378342
  REMARK    GeneRIF: Overexpression of PLS3 is associated with
            epithelial-mesenchymal transition and is associated with metastasis
            in colorectal cancer
REFERENCE   2  (bases 1 to 3612)
  AUTHORS   Michel,L., Jean-Louis,F., Begue,E., Bensussan,A. and Bagot,M.
  TITLE     Use of PLS3, Twist, CD158k/KIR3DL2, and NKp46 gene expression
            combination for reliable Sezary syndrome diagnosis
  JOURNAL   Blood 121 (8), 1477-1478 (2013)
   PUBMED   23429988
  REMARK    GeneRIF: PLS3, Twist, KIR3DL2 and NKp46 gene expression can model
            efficient molecular Sezary syndrome diagnosis.
REFERENCE   3  (bases 1 to 3612)
  AUTHORS   Su,H., Zhu,J., Cai,C., Pei,W., Wang,J., Dong,H. and Ren,H.
  TITLE     FIMBRIN1 is involved in lily pollen tube growth by stabilizing the
            actin fringe
  JOURNAL   Plant Cell 24 (11), 4539-4554 (2012)
   PUBMED   23150633
REFERENCE   4  (bases 1 to 3612)
  AUTHORS   Jones,C.L., Ferreira,S., McKenzie,R.C., Tosi,I., Caesar,J.A.,
            Bagot,M., Whittaker,S.J. and Mitchell,T.J.
  TITLE     Regulation of T-plastin expression by promoter hypomethylation in
            primary cutaneous T-cell lymphoma
  JOURNAL   J. Invest. Dermatol. 132 (8), 2042-2049 (2012)
   PUBMED   22495182
  REMARK    GeneRIF: PLS3 is expressed in the majority of SS patients and
            provide insight into the molecular regulation of PLS3 expression in
            CTCL
REFERENCE   5  (bases 1 to 3612)
  AUTHORS   Begue,E., Jean-Louis,F., Bagot,M., Jauliac,S., Cayuela,J.M.,
            Laroche,L., Parquet,N., Bachelez,H., Bensussan,A., Courtois,G. and
            Michel,L.
  TITLE     Inducible expression and pathophysiologic functions of T-plastin in
            cutaneous T-cell lymphoma
  JOURNAL   Blood 120 (1), 143-154 (2012)
   PUBMED   22627769
  REMARK    GeneRIF: T-plastin is a marker restricted to malignant lymphocytes
            from Sezary syndrome patients and plays a role for cell survival
            and migration.
REFERENCE   6  (bases 1 to 3612)
  AUTHORS   Arpin,M., Friederich,E., Algrain,M., Vernel,F. and Louvard,D.
  TITLE     Functional differences between L- and T-plastin isoforms
  JOURNAL   J. Cell Biol. 127 (6 PT 2), 1995-2008 (1994)
   PUBMED   7806577
REFERENCE   7  (bases 1 to 3612)
  AUTHORS   Lin,C.S., Park,T., Chen,Z.P. and Leavitt,J.
  TITLE     Human plastin genes. Comparative gene structure, chromosome
            location, and differential expression in normal and neoplastic
            cells
  JOURNAL   J. Biol. Chem. 268 (4), 2781-2792 (1993)
   PUBMED   8428952
REFERENCE   8  (bases 1 to 3612)
  AUTHORS   Lin,C.S., Aebersold,R.H. and Leavitt,J.
  TITLE     Correction of the N-terminal sequences of the human plastin
            isoforms by using anchored polymerase chain reaction:
            identification of a potential calcium-binding domain
  JOURNAL   Mol. Cell. Biol. 10 (4), 1818-1821 (1990)
   PUBMED   2378651
REFERENCE   9  (bases 1 to 3612)
  AUTHORS   Lin,C.S., Aebersold,R.H., Kent,S.B., Varma,M. and Leavitt,J.
  TITLE     Molecular cloning and characterization of plastin, a human
            leukocyte protein expressed in transformed human fibroblasts
  JOURNAL   Mol. Cell. Biol. 8 (11), 4659-4668 (1988)
   PUBMED   3211125
REFERENCE   10 (bases 1 to 3612)
  AUTHORS   Goldstein,D., Djeu,J., Latter,G., Burbeck,S. and Leavitt,J.
  TITLE     Abundant synthesis of the transformation-induced protein of
            neoplastic human fibroblasts, plastin, in normal lymphocytes
  JOURNAL   Cancer Res. 45 (11 PT 2), 5643-5647 (1985)
   PUBMED   4053036
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DC320695.1, AK312391.1 and
            AC005000.2.
            This sequence is a reference standard in the RefSeqGene project.
            On Feb 17, 2010 this sequence version replaced gi:226053440.
            
            Summary: Plastins are a family of actin-binding proteins that are
            conserved throughout eukaryote evolution and expressed in most
            tissues of higher eukaryotes. In humans, two ubiquitous plastin
            isoforms (L and T) have been identified. Plastin 1 (otherwise known
            as Fimbrin) is a third distinct plastin isoform which is
            specifically expressed at high levels in the small intestine. The L
            isoform is expressed only in hemopoietic cell lineages, while the T
            isoform has been found in all other normal cells of solid tissues
            that have replicative potential (fibroblasts, endothelial cells,
            epithelial cells, melanocytes, etc.). The C-terminal 570 amino
            acids of the T-plastin and L-plastin proteins are 83% identical. It
            contains a potential calcium-binding site near the N terminus.
            Alternate splicing results in multiple transcript
            variants.[provided by RefSeq, Feb 2010].
            
            Transcript Variant: This variant (1) represents the longest
            transcript and encodes the longer isoform (1). Variants 1 and 2
            encode the same isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC056898.1, AK222801.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025082 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-326               DC320695.1         1-326
            327-2002            AK312391.1         1-1676
            2003-2003           AC005000.2         15987-15987
            2004-2312           AK312391.1         1678-1986
            2313-3612           AC005000.2         17927-19226
FEATURES             Location/Qualifiers
     source          1..3612
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq23"
     gene            1..3612
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="plastin 3"
                     /db_xref="GeneID:5358"
                     /db_xref="HGNC:9091"
                     /db_xref="HPRD:02133"
                     /db_xref="MIM:300131"
     exon            1..411
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       69
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140832180"
     variation       306
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373494371"
     variation       365
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757124"
     exon            412..492
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    417..419
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="upstream in-frame stop codon"
     CDS             420..2312
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="isoform 1 is encoded by transcript variant 1; T
                     fimbrin; plastin-3; T plastin"
                     /codon_start=1
                     /product="plastin-3 isoform 1"
                     /protein_id="NP_005023.2"
                     /db_xref="GI:7549809"
                     /db_xref="CCDS:CCDS14568.1"
                     /db_xref="GeneID:5358"
                     /db_xref="HGNC:9091"
                     /db_xref="HPRD:02133"
                     /db_xref="MIM:300131"
                     /translation="
MDEMATTQISKDELDELKEAFAKVDLNSNGFICDYELHELFKEANMPLPGYKVREIIQKLMLDGDRNKDGKISFDEFVYIFQEVKSSDIAKTFRKAINRKEGICALGGTSELSSEGTQHSYSEEEKYAFVNWINKALENDPDCRHVIPMNPNTDDLFKAVGDGIVLCKMINLSVPDTIDERAINKKKLTPFIIQENLNLALNSASAIGCHVVNIGAEDLRAGKPHLVLGLLWQIIKIGLFADIELSRNEALAALLRDGETLEELMKLSPEELLLRWANFHLENSGWQKINNFSADIKDSKAYFHLLNQIAPKGQKEGEPRIDINMSGFNETDDLKRAESMLQQADKLGCRQFVTPADVVSGNPKLNLAFVANLFNKYPALTKPENQDIDWTLLEGETREERTFRNWMNSLGVNPHVNHLYADLQDALVILQLYERIKVPVDWSKVNKPPYPKLGANMKKLENCNYAVELGKHPAKFSLVGIGGQDLNDGNQTLTLALVWQLMRRYTLNVLEDLGDGQKANDDIIVNWVNRTLSEAGKSTSIQSFKDKTISSSLAVVDLIDAIQPGCINYDLVKSGNLTEDDKHNNAKYAVSMARRIGARVYALPEDLVEVKPKMVMTVFACLMGRGMKRV
"
     misc_feature    465..665
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="EF-hand, calcium binding motif; A diverse
                     superfamily of calcium sensors and calcium signal
                     modulators; most examples in this alignment model have 2
                     active canonical EF hands. Ca2+ binding induces a
                     conformational change in the EF-hand motif, leading to...;
                     Region: EFh; cd00051"
                     /db_xref="CDD:28933"
     misc_feature    474..2288
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Ca2+-binding actin-bundling protein fimbrin/plastin
                     (EF-Hand superfamily) [Cytoskeleton]; Region: SAC6;
                     COG5069"
                     /db_xref="CDD:34673"
     misc_feature    order(492..494,498..500,504..506,525..527,612..614,
                     618..620,624..626,645..647)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28933"
     misc_feature    768..770
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    789..1136
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(789..794,798..806,813..815,822..824,1020..1025,
                     1032..1034,1041..1043,1047..1049,1092..1097,1104..1109,
                     1113..1118,1125..1130)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1221..1553
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(1221..1226,1230..1238,1245..1247,1254..1256,
                     1440..1445,1452..1454,1461..1463,1467..1469,1509..1514,
                     1521..1526,1530..1535,1542..1547)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1296..1298
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P13797.4); phosphorylation site"
     misc_feature    1395..1397
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P13797.4); phosphorylation site"
     misc_feature    1590..1592
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P13797.4); phosphorylation site"
     misc_feature    1626..1934
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(1626..1628,1635..1637,1644..1646,1818..1823,
                     1830..1832,1842..1844,1848..1850,1893..1898,1905..1910,
                     1914..1919,1926..1931)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1980..2297
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(1983..1991,1998..2000,2007..2009,2187..2192,
                     2199..2201,2208..2210,2214..2216,2256..2261,2268..2273,
                     2277..2282,2289..2294)
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     exon            493..656
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       494
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150018375"
     variation       505
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145235506"
     variation       613
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373153000"
     variation       628
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377475836"
     variation       644
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113492800"
     variation       645
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186923237"
     exon            657..786
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       740
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140121121"
     variation       743
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144784703"
     variation       782
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147957783"
     exon            787..919
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       855
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141907957"
     variation       887
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143815252"
     variation       890
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151153004"
     exon            920..1001
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     exon            1002..1167
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1059
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367830488"
     variation       1070
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112589137"
     variation       1107
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371332791"
     variation       1141
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375187925"
     exon            1168..1310
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1169
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376568367"
     variation       1295
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373249162"
     variation       1296
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369914417"
     exon            1311..1406
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1311
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202076515"
     variation       1344
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140968059"
     variation       1377
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137917062"
     variation       1393
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142569974"
     exon            1407..1602
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1469
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113204501"
     variation       1520
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1859671"
     exon            1603..1681
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1611
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377411857"
     variation       1613
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138662773"
     variation       1629
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201842598"
     variation       1661
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2108099"
     variation       1664
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144592792"
     variation       1681
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370999829"
     exon            1682..1796
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1694
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148514983"
     variation       1713
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:871774"
     exon            1797..1930
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1799
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75219193"
     variation       1838
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140768895"
     variation       1895
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35211005"
     exon            1931..2054
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       1937
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35525703"
     variation       1964
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140069545"
     variation       1965
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199893556"
     variation       2015
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372389185"
     variation       2017
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377191528"
     variation       2034
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150069454"
     variation       2047
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191246889"
     exon            2055..2179
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       2080
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181782110"
     variation       2151
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149142111"
     variation       2159
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145393426"
     exon            2180..3612
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /inference="alignment:Splign:1.39.8"
     variation       2311
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369448909"
     variation       2352
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373177061"
     variation       2363
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376407795"
     variation       2528
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184318952"
     variation       2696
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144589761"
     variation       2956
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11551495"
     variation       3028
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370865892"
     variation       3204
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373978498"
     polyA_signal    3402..3407
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
     polyA_site      3423
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
     variation       3454
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376902216"
     variation       3534
                     /gene="PLS3"
                     /gene_synonym="T-plastin"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148073444"
ORIGIN      
ttattaatcccacaagattgtgtgaatgtgtactccgagccaggcacgttggacttctaacttcctcttagcccaagtaggaaggggagactcaggcgctggggaccattctcctctccctgcagcagagttgcagtccctatccctcctgggtgcccatccccgtgcctattttcctggatccccacccagttgatgtgacaggctcgtggcccaatccccttcctggttcccaggccgactgctagcaccacccgagccaatggcggcggccgaggggcggagggggctggcaggaggggagggagcgctggctttagagccacagctgcaaagattccgaggtgcagaagttgtctgagtgcgttggtcggcggcagtcgggccagacccaggactctgcgactttacatctttaaatggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaagtgagagaaattattcagaaactcatgctggatggtgacaggaataaagatgggaaaataagttttgacgaatttgtttatatttttcaagaggtaaaaagtagtgatattgccaagaccttccgcaaagcaatcaacaggaaagaaggtatttgtgctctgggtggaacttcagagttgtccagcgaaggaacacagcattcttactcagaggaagaaaaatatgcttttgttaactggataaacaaagctttggaaaatgatcctgattgtagacatgttataccaatgaaccctaacaccgatgacctgttcaaagctgttggtgatggaattgtgctttgtaaaatgattaacctttcagttcctgataccattgatgaaagagcaatcaacaagaagaaacttacacccttcatcattcaggaaaacttgaacttggcactgaactctgcttctgccattgggtgtcatgttgtgaacattggtgcagaagatttgagggctgggaaacctcatctggttttgggactgctttggcagatcattaagatcggtttgttcgctgacattgaattaagcaggaatgaagccttggctgctttactccgagatggtgagactttggaggaacttatgaaattgtctccagaagagcttctgcttagatgggcaaactttcatttggaaaactcgggctggcaaaaaattaacaactttagtgctgacatcaaggattccaaagcctatttccatcttctcaatcaaatcgcaccaaaaggacaaaaggaaggtgaaccacggatagatattaacatgtcaggtttcaatgaaacagatgatttgaagagagctgagagtatgcttcaacaagcagataaattaggttgcagacagtttgttacccctgctgatgttgtcagtggaaaccccaaactcaacttagctttcgtggctaacctgtttaataaatacccagcactaactaagccagagaaccaggatattgactggactctattagaaggagaaactcgtgaagaaagaaccttccgtaactggatgaactctcttggtgtcaatcctcacgtaaaccatctctatgctgacctgcaagatgccctggtaatcttacagttatatgaacgaattaaagttcctgttgactggagtaaggttaataaacctccatacccgaaactgggagccaacatgaaaaagctagaaaactgcaactatgctgttgaattagggaagcatcctgctaaattctccctggttggcattggagggcaagacctgaatgatgggaaccaaaccctgactttagctttagtctggcagctgatgagaagatataccctcaatgtcctggaagatcttggagatggtcagaaagccaatgacgacatcattgtgaactgggtgaacagaacgttgagtgaagctggaaaatcaacttccattcagagttttaaggacaagacgatcagctccagtttggcagttgtggatttaattgatgccatccagccaggctgtataaactatgaccttgtgaagagtggcaatctaacagaagatgacaagcacaataatgccaagtatgcagtgtcaatggctagaagaatcggagccagagtgtatgctctccctgaagaccttgtggaagtaaagcccaagatggtcatgactgtgtttgcatgtttgatgggcaggggaatgaagagagtgtaaaataaccaatctgaataaaacagccatgctcccaggtgcatgattcgcaggtcagctatttccaggtgaagtgcttatggcttaaggaactcttggccattcaaaggacttttcattttgattaacaggactagcttatcatgagagccctcaggggaaagggtttaagaaaaacaactcctctttcccatagtcagagttgaatttgtcaggcacgcctgaaatgtgctcatagccaaaacattttactctctcctcctagaatgctgcccttgacatttcccattgctgtatgttatttcttgctctgttatcttttgccctcttagaatgtccctctcttgggacttgcttagatgatgggatatgaatattattagacagtaattttgctttccatccagtatgctagttcttattcgagaactatggtcagagcgtatttggatatgagtatcctttgcttatctttgtagtactgaaaatttgccgaagtaactggctgtgcagaatgtaatagaagcttttcttattcttttattcttaagatcagtatctttttacagtattctttctacatgatccttttttgtacatttaagaatattttgattatattaaacaagactgctgattttgctactttttttaaggggtcttcaagtaagtaaaacatacatcgtagctagaagaaaaatgtaccttaaatttgcatcttccctctcatacccaagctgtaaacaattgaaatattttgtcttaaatcacttggttcaatacatgcttatttgttttaaaacctgtatcatcaaactctctctctaaatttaaaatgctgttgaatatgatacttttgaggagagagtgtgctcagaacttagacgggatttggtaggccaagtatgctaagtgtacaatatattttttaattttacacctgaaacaaagaaatgtggtcactaaaaataaaagtatatatgtaggaattaatgtactcttgctttgtcaagctgtttgctatagtttccaaggtattatgttactctaactctgaaaagtgatgtaatctggtagcaatgtagtagttcaaataaaggcatttacataataattagtctgttcttcatgcttttgtctcttaggaagtatgccaatgtttgtcaggatttttttctttttgtttttctgatgtattctgtaaaatggtgtttgttaaatttgagttttgggagctgaattagaggtactgaattaaggacagtacaaatgaagtaaaaaggttttctccaatttaccaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5358 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
            GeneID:5358 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:5358 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.