GGRNA Home | Help | Advanced search

2024-04-20 14:45:36, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_004685               5222 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens myotubularin related protein 6 (MTMR6), mRNA.
ACCESSION   NM_004685
VERSION     NM_004685.3  GI:134142347
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5222)
  AUTHORS   Mochizuki,Y., Ohashi,R., Kawamura,T., Iwanari,H., Kodama,T.,
            Naito,M. and Hamakubo,T.
  TITLE     Phosphatidylinositol 3-phosphatase myotubularin-related protein 6
            (MTMR6) is regulated by small GTPase Rab1B in the early secretory
            and autophagic pathways
  JOURNAL   J. Biol. Chem. 288 (2), 1009-1021 (2013)
   PUBMED   23188820
  REMARK    GeneRIF: results indicate that the cellular localization of MTMR6
            is regulated by Rab1B in the early secretory and autophagic
            pathways
REFERENCE   2  (bases 1 to 5222)
  AUTHORS   Zou,J., Chang,S.C., Marjanovic,J. and Majerus,P.W.
  TITLE     MTMR9 increases MTMR6 enzyme activity, stability, and role in
            apoptosis
  JOURNAL   J. Biol. Chem. 284 (4), 2064-2071 (2009)
   PUBMED   19038970
  REMARK    GeneRIF: MTMR9 greatly enhances the functions of MTMR6
REFERENCE   3  (bases 1 to 5222)
  AUTHORS   Srivastava,S., Ko,K., Choudhury,P., Li,Z., Johnson,A.K.,
            Nadkarni,V., Unutmaz,D., Coetzee,W.A. and Skolnik,E.Y.
  TITLE     Phosphatidylinositol-3 phosphatase myotubularin-related protein 6
            negatively regulates CD4 T cells
  JOURNAL   Mol. Cell. Biol. 26 (15), 5595-5602 (2006)
   PUBMED   16847315
  REMARK    GeneRIF: Data show that KCa3.1, which is critical for Ca2+ influx
            in reactivated naive T cells and central memory T cells, requires
            phosphatidylinositol-3 phosphatase for activation and is inhibited
            by PI(3)P phosphatase myotubularin-related protein 6 (MTMR6).
REFERENCE   4  (bases 1 to 5222)
  AUTHORS   Srivastava,S., Li,Z., Lin,L., Liu,G., Ko,K., Coetzee,W.A. and
            Skolnik,E.Y.
  TITLE     The phosphatidylinositol 3-phosphate phosphatase myotubularin-
            related protein 6 (MTMR6) is a negative regulator of the
            Ca2+-activated K+ channel KCa3.1
  JOURNAL   Mol. Cell. Biol. 25 (9), 3630-3638 (2005)
   PUBMED   15831468
REFERENCE   5  (bases 1 to 5222)
  AUTHORS   Dunham,A., Matthews,L.H., Burton,J., Ashurst,J.L., Howe,K.L.,
            Ashcroft,K.J., Beare,D.M., Burford,D.C., Hunt,S.E.,
            Griffiths-Jones,S., Jones,M.C., Keenan,S.J., Oliver,K., Scott,C.E.,
            Ainscough,R., Almeida,J.P., Ambrose,K.D., Andrews,D.T.,
            Ashwell,R.I., Babbage,A.K., Bagguley,C.L., Bailey,J., Bannerjee,R.,
            Barlow,K.F., Bates,K., Beasley,H., Bird,C.P., Bray-Allen,S.,
            Brown,A.J., Brown,J.Y., Burrill,W., Carder,C., Carter,N.P.,
            Chapman,J.C., Clamp,M.E., Clark,S.Y., Clarke,G., Clee,C.M.,
            Clegg,S.C., Cobley,V., Collins,J.E., Corby,N., Coville,G.J.,
            Deloukas,P., Dhami,P., Dunham,I., Dunn,M., Earthrowl,M.E.,
            Ellington,A.G., Faulkner,L., Frankish,A.G., Frankland,J.,
            French,L., Garner,P., Garnett,J., Gilbert,J.G., Gilson,C.J.,
            Ghori,J., Grafham,D.V., Gribble,S.M., Griffiths,C., Hall,R.E.,
            Hammond,S., Harley,J.L., Hart,E.A., Heath,P.D., Howden,P.J.,
            Huckle,E.J., Hunt,P.J., Hunt,A.R., Johnson,C., Johnson,D., Kay,M.,
            Kimberley,A.M., King,A., Laird,G.K., Langford,C.J., Lawlor,S.,
            Leongamornlert,D.A., Lloyd,D.M., Lloyd,C., Loveland,J.E.,
            Lovell,J., Martin,S., Mashreghi-Mohammadi,M., McLaren,S.J.,
            McMurray,A., Milne,S., Moore,M.J., Nickerson,T., Palmer,S.A.,
            Pearce,A.V., Peck,A.I., Pelan,S., Phillimore,B., Porter,K.M.,
            Rice,C.M., Searle,S., Sehra,H.K., Shownkeen,R., Skuce,C.D.,
            Smith,M., Steward,C.A., Sycamore,N., Tester,J., Thomas,D.W.,
            Tracey,A., Tromans,A., Tubby,B., Wall,M., Wallis,J.M., West,A.P.,
            Whitehead,S.L., Willey,D.L., Wilming,L., Wray,P.W., Wright,M.W.,
            Young,L., Coulson,A., Durbin,R., Hubbard,T., Sulston,J.E., Beck,S.,
            Bentley,D.R., Rogers,J. and Ross,M.T.
  TITLE     The DNA sequence and analysis of human chromosome 13
  JOURNAL   Nature 428 (6982), 522-528 (2004)
   PUBMED   15057823
REFERENCE   6  (bases 1 to 5222)
  AUTHORS   Mochizuki,Y. and Majerus,P.W.
  TITLE     Characterization of myotubularin-related protein 7 and its binding
            partner, myotubularin-related protein 9
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 100 (17), 9768-9773 (2003)
   PUBMED   12890864
REFERENCE   7  (bases 1 to 5222)
  AUTHORS   Nandurkar,H.H., Layton,M., Laporte,J., Selan,C., Corcoran,L.,
            Caldwell,K.K., Mochizuki,Y., Majerus,P.W. and Mitchell,C.A.
  TITLE     Identification of myotubularin as the lipid phosphatase catalytic
            subunit associated with the 3-phosphatase adapter protein, 3-PAP
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 100 (15), 8660-8665 (2003)
   PUBMED   12847286
  REMARK    GeneRIF: Identification of myotubularin as the lipid phosphatase
            catalytic subunit associated with the 3-phosphatase adapter
            protein, 3-PAP.
REFERENCE   8  (bases 1 to 5222)
  AUTHORS   Schaletzky,J., Dove,S.K., Short,B., Lorenzo,O., Clague,M.J. and
            Barr,F.A.
  TITLE     Phosphatidylinositol-5-phosphate activation and conserved substrate
            specificity of the myotubularin phosphatidylinositol 3-phosphatases
  JOURNAL   Curr. Biol. 13 (6), 504-509 (2003)
   PUBMED   12646134
  REMARK    GeneRIF: investigation of MTM1 and MTMR6 and finding that they use
            PtdIns(3,5)P2 in addition to PtdIns3P as a substrate in vitro
REFERENCE   9  (bases 1 to 5222)
  AUTHORS   Simpson,J.C., Wellenreuther,R., Poustka,A., Pepperkok,R. and
            Wiemann,S.
  TITLE     Systematic subcellular localization of novel proteins identified by
            large-scale cDNA sequencing
  JOURNAL   EMBO Rep. 1 (3), 287-292 (2000)
   PUBMED   11256614
REFERENCE   10 (bases 1 to 5222)
  AUTHORS   Laporte,J., Blondeau,F., Buj-Bello,A., Tentler,D., Kretz,C.,
            Dahl,N. and Mandel,J.L.
  TITLE     Characterization of the myotubularin dual specificity phosphatase
            gene family from yeast to human
  JOURNAL   Hum. Mol. Genet. 7 (11), 1703-1712 (1998)
   PUBMED   9736772
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL590787.24, BC040012.1 and AL044815.1.
            On Mar 27, 2007 this sequence version replaced gi:37537693.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript was available
            for the full length of the gene. The extent of this transcript is
            supported by transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AL832017.2, BC040012.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-128               AL590787.24        72714-72841         c
            129-1273            BC040012.1         1-1145
            1274-1274           AL590787.24        43025-43025         c
            1275-1821           BC040012.1         1147-1693
            1822-1822           AL590787.24        37026-37026         c
            1823-2347           BC040012.1         1695-2219
            2348-3952           AL590787.24        32740-34344         c
            3953-4185           BC040012.1         3825-4057
            4186-4999           AL590787.24        31693-32506         c
            5000-5222           AL044815.1         122-344
FEATURES             Location/Qualifiers
     source          1..5222
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="13"
                     /map="13q12"
     gene            1..5222
                     /gene="MTMR6"
                     /note="myotubularin related protein 6"
                     /db_xref="GeneID:9107"
                     /db_xref="HGNC:7453"
                     /db_xref="MIM:603561"
     exon            1..343
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     variation       49
                     /gene="MTMR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3809334"
     variation       128
                     /gene="MTMR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3809335"
     misc_feature    305..307
                     /gene="MTMR6"
                     /note="upstream in-frame stop codon"
     CDS             320..2185
                     /gene="MTMR6"
                     /codon_start=1
                     /product="myotubularin-related protein 6"
                     /protein_id="NP_004676.3"
                     /db_xref="GI:134142348"
                     /db_xref="CCDS:CCDS9313.1"
                     /db_xref="GeneID:9107"
                     /db_xref="HGNC:7453"
                     /db_xref="MIM:603561"
                     /translation="
MEHIRTTKVEQVKLLDRFSTSNKSLTGTLYLTATHLLFIDSHQKETWILHHHIASVEKLALTTSGCPLVIQCKNFRTVHFIVPRERDCHDIYNSLLQLSKQAKYEDLYAFSYNPKQNDSERLQGWQLIDLAEEYKRMGVPNSHWQLSDANRDYKICETYPRELYVPRIASKPIIVGSSKFRSKGRFPVLSYYHQDKEAAICRCSQPLSGFSARCLEDEHLLQAISKANPVNRYMYVMDTRPKLNAMANRAAGKGYENEDNYSNIRFQFVGIENIHVMRSSLQKLLEVNGTKGLSVNDFYSGLESSGWLRHIKAVMDAAIFLAKAITVENASVLVHCSDGWDRTSQVCSLGSLLLDSYYRTIKGFMVLIEKDWISFGHKFSERCGQLDGDPKEVSPVFTQFLECVWHLTEQFPQAFEFSEAFLLQIHEHIHSCQFGNFLGNCQKEREELKLKEKTYSLWPFLLEDQKKYLNPLYSSESHRFTVLEPNTVSFNFKFWRNMYHQFDRTLHPRQSVFNIIMNMNEQNKQLEKDIKDLESKIKQRKNKQTDGILTKELLHSVHPESPNLKTSLCFKEQTLLPVNDALRTIEGSSPADNRYSEYAEEFSKSEPAVVSLEYGVARMTC
"
     misc_feature    776..1126
                     /gene="MTMR6"
                     /note="Myotubularin-related; Region: Myotub-related;
                     pfam06602"
                     /db_xref="CDD:203483"
     misc_feature    1061..1072
                     /gene="MTMR6"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y217.3);
                     Region: Substrate binding (By similarity)"
     misc_feature    1136..1141
                     /gene="MTMR6"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y217.3);
                     Region: Substrate binding (By similarity)"
     misc_feature    1307..1471
                     /gene="MTMR6"
                     /note="Myotubularin Y_phosphatase-like; Region:
                     Y_phosphatase_m; pfam13849"
                     /db_xref="CDD:206020"
     misc_feature    1325..1345
                     /gene="MTMR6"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y217.3);
                     Region: Substrate binding (By similarity)"
     misc_feature    2000..2002
                     /gene="MTMR6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9Y217.3); phosphorylation site"
     misc_feature    2000..2002
                     /gene="MTMR6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2084..2086
                     /gene="MTMR6"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9Y217.3); phosphorylation site"
     exon            344..460
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            461..623
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            624..781
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            782..910
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            911..1045
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            1046..1178
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            1179..1288
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            1289..1414
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            1415..1464
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            1465..1665
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            1666..1797
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            1798..1924
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     exon            1925..5216
                     /gene="MTMR6"
                     /inference="alignment:Splign:1.39.8"
     STS             2126..2248
                     /gene="MTMR6"
                     /standard_name="D13S824E"
                     /db_xref="UniSTS:151501"
     STS             3904..4009
                     /gene="MTMR6"
                     /standard_name="A007G03"
                     /db_xref="UniSTS:56899"
     variation       3952
                     /gene="MTMR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:8262"
     polyA_signal    4127..4132
                     /gene="MTMR6"
     polyA_site      4145
                     /gene="MTMR6"
     polyA_site      4185
                     /gene="MTMR6"
     STS             4899..5173
                     /gene="MTMR6"
                     /standard_name="D13S1453"
                     /db_xref="UniSTS:20423"
     STS             4948..5088
                     /gene="MTMR6"
                     /standard_name="RH11246"
                     /db_xref="UniSTS:78255"
     polyA_signal    5171..5176
                     /gene="MTMR6"
     polyA_site      5216
                     /gene="MTMR6"
ORIGIN      
cagtaccggcctcctccagcagggggcgctgtgggatccgccgctgtccgggacgaaccagcaagccgctctcggtccacacacgctctgtctgcctgccccgagtcccccgggaggccgcggggtttggggaagtgtttctaggagacggcgctcaccggctgcacctgcgccgttgacgccaccggggccggcagacagacccgcggcgctggctggtggagggagttcccgcttgctctctgtcgctgtcaccgccctgtttctgtagccgtatggtacgcctgtgagaccggctgccggctgacgtctccttgcgatggagcatatccggacgaccaaggtcgaacaagtaaaattacttgaccgattcagtaccagcaacaagtcattaacaggaacactgtatcttacggctacacatctattatttatcgactctcatcaaaaagaaacctggatattacaccaccatattgcctcagtagagaaacttgctttgactacttctggatgcccccttgtgatacagtgcaagaacttcagaactgtgcatttcattgttcccagagaaagagattgccatgatatttacaactctttgctacaactgtcaaaacaagcaaaatatgaagatctctatgcattttcttataatcccaaacaaaatgattcagaacgactacaaggctggcagctcattgatctcgctgaggaatataagaggatgggagtgccaaactcacactggcagttgtctgatgccaaccgggactacaagatttgtgaaacttaccccagagaactttatgttccccggatagcaagcaaaccaataattgttggtagttccaagttccggagcaagggaagattcccagttctttcctactatcatcaagataaggaggctgccatttgtcgatgtagtcagccactctctggattcagtgccaggtgcctggaggatgaacatttgcttcaagccattagtaaagccaatccagtcaatcgctatatgtacgtcatggataccaggccaaaactgaatgcaatggccaacagagcagctggaaaaggttatgaaaatgaagacaactattccaatattagatttcagtttgttggaattgaaaatattcatgtcatgaggtccagccttcagaaattattggaagtcaatggcactaaagggctttctgtcaatgatttctactccggtttggagagctcgggatggcttcgccatatcaaagctgttatggatgctgcaatcttcttggccaaagcaataacagttgaaaatgcaagtgtgttggtgcattgttccgatggttgggataggacttcccaggtttgttccctgggttctcttttattggattcctactacaggacaatcaaaggattcatggttttaatagaaaaggattggatctcttttggacataaattttcagagaggtgtggccagttggatggtgacccaaaggaagtctcaccagtgtttactcagttcttggaatgtgtgtggcatttgaccgaacagtttccacaagcctttgaattcagtgaagcatttcttcttcagatccatgagcatattcattcatgccagtttggaaacttccttggaaattgtcagaaggaaagagaagagctcaagttgaaggagaagacttattccctgtggccatttcttttggaagaccaaaagaagtacttaaatcctctctacagttccgaatctcacagatttacagttttggagccaaatacagtatctttcaattttaagttttggaggaacatgtaccatcaatttgatcgaacactgcatcctaggcagtctgtatttaatataattatgaatatgaatgagcaaaataaacaattagagaaagatattaaagacctagaatctaaaattaaacaacgcaaaaataagcaaacagatggcatcctcaccaaggaattgttacattcagttcatcctgaatcacctaacctcaaaacttccctgtgttttaaagagcagactctgctacccgtaaatgatgctcttcgaactatagagggcagcagcccggcagataatcgttatagtgaatatgcagaagagttttctaaatcagaacctgctgtggtcagcttagagtatggtgtggcaagaatgacttgttagactcatagagttttttctgcaatgattgcagtacaagaaaaggattattgtgaggatggtctgtaagcataaccaaaaggaatttgtctaataacaattttagggtttaacagtaggctaatagttgaaggaaggataataactacccttgtgagagaaataagtcattttaattgcatttccagcaaggaatgacattcagttctgtaagaaatgagtggtatttgatgtatttactcaaaacacaatttgcactgtacactagtgaattgacgtttatgatttatgttaattcagccaaacataaataaccttccttaagtacaatttaacttcaagaaaacaaaatttgacaacatagtttcttaataaatgatatggcatgtactttcaattatgtagctttgtaactatgaatatttacatattttgccttttagtgatatttaatgttaaagtgccatgaaaaatatttctaagaaagccttaaattcccagtggattctttacccttaagttttacagcctacaacaagattttttgttttgtttttcttctggtcagccttgttttgtttgtaaagaattgtgctctcattactgctgggggtgcatgctacaatacttctatataaacacttgtagaagtacactgttcacgtttagcctgccccacttttgtattcaaaattaatgaaactgaaggtttattctgatcataatttgtttagtgctacatttgataatttattatttacagcttagaatattgatttcttgaatacgtataagcacatttgactgtcttttatatatggattactgcattccattgattcttattttgtggttggctttatttctttcacaactgtgtaagtttaaagagctaaagctctaaaactgttctgagaaacaatgaatagtacatgtatatgtatatttttaaactgccttattgctcaatgagttgctgttcctggagtatctaactttcagtttactcaaaaacttttgggtaaataaaaaagggaagtacagatagtttaggttgtgcatggttgcatgaattttgaagtcatttctatgtggagcattatttttcttcttgttaaatatagaaaaaaaaagagattctagtacaaagttactgtttaacaaaagcaacataaactctgggaaagatttcattttgccatgttatatttactgtttattctgtgtactagtacatatctttaaattaccaaaaaacaagaaacaaaacataaaaaccccaaaactatcacttggaattagcaatatcacccaactggctttaaaattgaaaatttaaataacatggtggcatgaagtacaattcgagtattaggcaatttgcatagtgttcctcatgctactttctgttacacctctattatattagttttgaatataaacatctttttcagaccaaaaaaaactttattgtatgagagcttatcttatcctgtttatttttccaatgcttttctgtaatacattatgtaatttaaaaaatattcctttttaaacagcaacagaaatgcactataaaatatagtatgtgattaaccaatcctgcttccatatttaagcactgggaatggaaacttaatctctgtgactacaaagggaagtttttgtgccttggtgttccagtcactgattgtggttttagaatcttctgtggctgacttcttgtattcaactctggtttattatcttaatcttcaacttcagacatatatttgtgtgtttatatgctcacaggtggactgagaaatcagttacatcttaagtgacctacagggtatatgttggcaaaagcagactgtgtatatgtcttataaagttgaatttatgttcagtgtgtttggaagtgtatagcatgtaaattatttcatatatgatttaaaggtaattaaatgttcacattttactttgaatgtttttcttctggataaaacaaatggaatcaagttgtagttgttttttttttcttctcacctaggcaagtagacttgcccattacattaacataacagcataaggtttgaggagtttattttccaaaagtttgttgataaataatacctgtttcatacaaaaataatttccagaatatttaaaataggtatagtgggctaaaaggcccatcagatgtaggtaataatgtcattaagttttcattttgttcctgtcacttgcttatattacaatcactatttttttgtgcccttgccaacttgatggaaggcagggtccattgagtacaaacattcgaggtgaaatgtctctccaaaggcagatctggatgtaaatatgaggaagaaaataactggctgacaagaggataattttattgagggtgttttgaaaaggtcagctaggctagaagtagctcagggaatcttgagtaaagatgaagggaactcttttaaaacaaattcaatttatttggtcgggtagcagagcagggaggtggtgtcagtcaagcctgttttgaaacattttttgcagaaggtcagctttaaaatattgaaaaatttccagttgacatgctaagttggattaaatgctgatcatttataaaactatatagttgctgcaaaagtaattggggcttttgccattgaaagtgatgacaaaaaccgcaattacttttgcaccaacctaatactacagttgcagacttttattagtgacgctgatcttcattagtcaagttttagttattttgttggcttttccatgtagaattccaagtgacattaacatactttgattaattaaagaaaatttggagactgtttaagatatatgtctagatatcaatgtaaactataagctttaggaacttacatctagaagaaagcctggaatctagaataattatctcaaaaaaaagtatatataccattgtacttgatataagaaaatgtaaacatgaaaccttgacattttaataaacagtatttgtgctactctagttatttctaggaaagtaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9107 -> Molecular function: GO:0004722 [protein serine/threonine phosphatase activity] evidence: NAS
            GeneID:9107 -> Molecular function: GO:0004725 [protein tyrosine phosphatase activity] evidence: NAS
            GeneID:9107 -> Molecular function: GO:0015269 [calcium-activated potassium channel activity] evidence: IDA
            GeneID:9107 -> Biological process: GO:0006470 [protein dephosphorylation] evidence: NAS
            GeneID:9107 -> Biological process: GO:0006644 [phospholipid metabolic process] evidence: TAS
            GeneID:9107 -> Biological process: GO:0006661 [phosphatidylinositol biosynthetic process] evidence: TAS
            GeneID:9107 -> Biological process: GO:0035335 [peptidyl-tyrosine dephosphorylation] evidence: NAS
            GeneID:9107 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
            GeneID:9107 -> Cellular component: GO:0005635 [nuclear envelope] evidence: IEA
            GeneID:9107 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:9107 -> Cellular component: GO:0005829 [cytosol] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.