GGRNA | NM_004498.2

LOCUS       NM_004498               2118 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens one cut homeobox 1 (ONECUT1), transcript variant 1,
            mRNA.
ACCESSION   NM_004498
VERSION     NM_004498.2  GI:428977302
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2118)
  AUTHORS   Prevot,P.P., Simion,A., Grimont,A., Colletti,M., Khalaileh,A., Van
            den Steen,G., Sempoux,C., Xu,X., Roelants,V., Hald,J., Bertrand,L.,
            Heimberg,H., Konieczny,S.F., Dor,Y., Lemaigre,F.P. and Jacquemin,P.
  TITLE     Role of the ductal transcription factors HNF6 and Sox9 in
            pancreatic acinar-to-ductal metaplasia
  JOURNAL   Gut 61 (12), 1723-1732 (2012)
   PUBMED   22271799
  REMARK    GeneRIF: HNF6 and Sox9 are new biomarkers of pancreatic
            acinar-to-ductal metaplasia and constitute candidate targets for
            preventive treatment in cases when acinar-to-ductal metaplasia may
            lead to cancer.
REFERENCE   2  (bases 1 to 2118)
  AUTHORS   Laudadio,I., Manfroid,I., Achouri,Y., Schmidt,D., Wilson,M.D.,
            Cordi,S., Thorrez,L., Knoops,L., Jacquemin,P., Schuit,F.,
            Pierreux,C.E., Odom,D.T., Peers,B. and Lemaigre,F.P.
  TITLE     A feedback loop between the liver-enriched transcription factor
            network and miR-122 controls hepatocyte differentiation
  JOURNAL   Gastroenterology 142 (1), 119-129 (2012)
   PUBMED   21920465
REFERENCE   3  (bases 1 to 2118)
  AUTHORS   Wang,K. and Holterman,A.X.
  TITLE     Pathophysiologic role of hepatocyte nuclear factor 6
  JOURNAL   Cell. Signal. 24 (1), 9-16 (2012)
   PUBMED   21893194
  REMARK    GeneRIF: Hepatocyte nuclear factor 6 is one of the liver-enriched
            transcription factors, it utilizes the bipartite onecut-homeodomain
            sequence to localize to the nuclear compartment and bind specific
            DNA sequences of numerous target gene promoters
            Review article
REFERENCE   4  (bases 1 to 2118)
  AUTHORS   Lehner,F., Kulik,U., Klempnauer,J. and Borlak,J.
  TITLE     Inhibition of the liver enriched protein FOXA2 recovers HNF6
            activity in human colon carcinoma and liver hepatoma cells
  JOURNAL   PLoS ONE 5 (10), E13344 (2010)
   PUBMED   20967225
  REMARK    GeneRIF: functional knockdown of FOXA2 recovered HNF6 activity and
            inhibited growth of tumor-cells and may possibly represent a novel
            therapeutic target in primary and secondary liver malignancies
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2118)
  AUTHORS   Lee,Y.S., Kim,D.K., Kim,Y.D., Park,K.C., Shong,M., Seong,H.A.,
            Ha,H.J. and Choi,H.S.
  TITLE     Orphan nuclear receptor SHP interacts with and represses hepatocyte
            nuclear factor-6 (HNF-6) transactivation
  JOURNAL   Biochem. J. 413 (3), 559-569 (2008)
   PUBMED   18459945
  REMARK    GeneRIF: Results suggest that HNF-6 is a novel target of small
            heterodimer partner in the regulation of gluconeogenesis.
REFERENCE   6  (bases 1 to 2118)
  AUTHORS   Streeper,R.S., Hornbuckle,L.A., Svitek,C.A., Goldman,J.K.,
            Oeser,J.K. and O'Brien,R.M.
  TITLE     Protein kinase A phosphorylates hepatocyte nuclear factor-6 and
            stimulates glucose-6-phosphatase catalytic subunit gene
            transcription
  JOURNAL   J. Biol. Chem. 276 (22), 19111-19118 (2001)
   PUBMED   11279202
REFERENCE   7  (bases 1 to 2118)
  AUTHORS   Pierreux,C.E., Stafford,J., Demonte,D., Scott,D.K., Vandenhaute,J.,
            O'Brien,R.M., Granner,D.K., Rousseau,G.G. and Lemaigre,F.P.
  TITLE     Antiglucocorticoid activity of hepatocyte nuclear factor-6
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 96 (16), 8961-8966 (1999)
   PUBMED   10430878
REFERENCE   8  (bases 1 to 2118)
  AUTHORS   Moller,A.M., Ek,J., Durviaux,S.M., Urhammer,S.A., Clausen,J.O.,
            Eiberg,H., Hansen,T., Rousseau,G.G., Lemaigre,F.P. and Pedersen,O.
  TITLE     Hepatocyte nuclear factor-6: associations between genetic
            variability and type II diabetes and between genetic variability
            and estimates of insulin secretion
  JOURNAL   Diabetologia 42 (8), 1011-1016 (1999)
   PUBMED   10491763
REFERENCE   9  (bases 1 to 2118)
  AUTHORS   Jacquemin,P., Lannoy,V.J., Rousseau,G.G. and Lemaigre,F.P.
  TITLE     OC-2, a novel mammalian member of the ONECUT class of homeodomain
            transcription factors whose function in liver partially overlaps
            with that of hepatocyte nuclear factor-6
  JOURNAL   J. Biol. Chem. 274 (5), 2665-2671 (1999)
   PUBMED   9915796
REFERENCE   10 (bases 1 to 2118)
  AUTHORS   Vaisse,C., Kim,J., Espinosa,R. III, Le Beau,M.M. and Stoffel,M.
  TITLE     Pancreatic islet expression studies and polymorphic DNA markers in
            the genes encoding hepatocyte nuclear factor-3alpha, -3beta,
            -3gamma, -4gamma, and -6
  JOURNAL   Diabetes 46 (8), 1364-1367 (1997)
   PUBMED   9231664
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from U96173.1 and AA699732.1.
            On Dec 8, 2012 this sequence version replaced gi:24307886.
            
            Summary: This gene encodes a member of the Cut homeobox family of
            transcription factors. Expression of the encoded protein is
            enriched in the liver, where it stimulates transcription of
            liver-expressed genes, and antagonizes glucocorticoid-stimulated
            gene transcription. This gene may influence a variety of cellular
            processes including glucose metabolism, cell cycle regulation, and
            it may also be associated with cancer. Alternative splicing results
            in multiple transcript variants. [provided by RefSeq, Dec 2012].
            
            Transcript Variant: This variant (1) represents the longer
            transcript and encodes the functional protein.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U96173.1, BC140830.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1925              U96173.1           1-1925
            1926-2118           AA699732.1         1-193               c
FEATURES             Location/Qualifiers
     source          1..2118
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q21.3"
     gene            1..2118
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /note="one cut homeobox 1"
                     /db_xref="GeneID:3175"
                     /db_xref="HGNC:8138"
                     /db_xref="HPRD:05002"
                     /db_xref="MIM:604164"
     exon            1..1233
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    9..11
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /note="upstream in-frame stop codon"
     STS             48..1693
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /db_xref="UniSTS:480447"
     STS             95..1723
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /db_xref="UniSTS:483886"
     CDS             129..1526
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /note="hepatocyte nuclear factor 6, alpha; one cut domain
                     family member 1"
                     /codon_start=1
                     /product="hepatocyte nuclear factor 6"
                     /protein_id="NP_004489.1"
                     /db_xref="GI:24307887"
                     /db_xref="CCDS:CCDS10150.1"
                     /db_xref="GeneID:3175"
                     /db_xref="HGNC:8138"
                     /db_xref="HPRD:05002"
                     /db_xref="MIM:604164"
                     /translation="

MNAQLTMEAIGELHGVSHEPVPAPADLLGGSPHARSSVAHRGSHLPPAHPRSMGMASLLDGGSGGGDYHHHHRAPEHSLAGPLHPTMTMACETPPGMSMPTTYTTLTPLQPLPPISTVSDKFPHHHHHHHHHHHPHHHQRLAGNVSGSFTLMRDERGLASMNNLYTPYHKDVAGMGQSLSPLSSSGLGSIHNSQQGLPHYAHPGAAMPTDKMLTPNGFEAHHPAMLGRHGEQHLTPTSAGMVPINGLPPHHPHAHLNAQGHGQLLGTAREPNPSVTGAQVSNGSNSGQMEEINTKEVAQRITTELKRYSIPQAIFAQRVLCRSQGTLSDLLRNPKPWSKLKSGRETFRRMWKWLQEPEFQRMSALRLAACKRKEQEHGKDRGNTPKKPRLVFTDVQRRTLHAIFKENKRPSKELQITISQQLGLELSTVSNFFMNARRRSLDKWQDEGSSNSGNSSSSSSTCTKA

"
     misc_feature    978..1235
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /note="CUT domain; Region: CUT; pfam02376"
                     /db_xref="CDD:202226"
     misc_feature    1284..1448
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(1284..1298,1302..1304,1353..1355,1371..1373,
                     1410..1412,1416..1421,1428..1433,1437..1445)
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(1290..1292,1299..1301,1419..1421,1428..1433,
                     1440..1442)
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     STS             822..1190
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /standard_name="PMC85812P3"
                     /db_xref="UniSTS:273496"
     variation       959
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35138937"
     variation       989
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2075613"
     exon            1234..2118
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /inference="alignment:Splign:1.39.8"
     STS             1240..1923
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /standard_name="ONECUT1__6113"
                     /db_xref="UniSTS:464518"
     variation       1760
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048965"
     variation       1761
                     /gene="ONECUT1"
                     /gene_synonym="HNF-6; HNF6; HNF6A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048966"
ORIGIN

ccccacagtgagaggaaggaaggcaacagtcgccagcagccgatgtgaagaccggactccgtgcgcccctcgccgcctctgcctggccacatcgatgttgtgtccgccgcctgctcgcccggatcacgatgaacgcgcagctgaccatggaagcgatcggcgagctgcacggggtgagccatgagccggtgcccgcccctgccgacctgctgggcggcagcccccacgcgcgcagctccgtggcgcaccgcggcagccacctgccccccgcgcacccgcgctccatgggcatggcgtccctgctggacggcggcagcggcggcggagattaccaccaccaccaccgggcccctgagcacagcctggccggccccctgcatcccaccatgaccatggcctgcgagactcccccaggtatgagcatgcccaccacctacaccaccttgacccctctgcagccgctgcctcccatctccacagtctcggacaagttcccccaccatcaccaccaccaccatcaccaccaccacccgcaccaccaccagcgcctggcgggcaacgtgagcggtagcttcacgctcatgcgggatgagcgcgggctggcctccatgaataacctctataccccctaccacaaggacgtggccggcatgggccagagcctctcgcccctctccagctccggtctgggcagcatccacaactcccagcaagggctcccccactatgcccacccgggggccgccatgcccaccgacaagatgctcacccccaacggcttcgaagcccaccacccggccatgctcggccgccacggggagcagcacctcacgcccacctcggccggcatggtgcccatcaacggccttcctccgcaccatccccacgcccacctgaacgcccagggccacgggcaactcctgggcacagcccgggagcccaacccttcggtgaccggcgcgcaggtcagcaatggaagtaattcagggcagatggaagagatcaataccaaagaggtggcgcagcgtatcaccaccgagctcaagcgctacagcatcccacaggccatcttcgcgcagagggtgctctgccgctcccaggggaccctctcggacctgctgcgcaaccccaaaccctggagcaaactcaaatccggccgggagaccttccggaggatgtggaagtggctgcaggagccggagttccagcgcatgtccgcgctccgcttagcagcatgcaaaaggaaagaacaagaacatgggaaggatagaggcaacacacccaaaaagcccaggttggtcttcacagatgtccagcgtcgaactctacatgcaatattcaaggaaaataagcgtccatccaaagaattgcaaatcaccatttcccagcagctggggttggagctgagcactgtcagcaacttcttcatgaacgcaagaaggaggagtctggacaagtggcaggacgagggcagctccaattcaggcaactcatcttcttcatcaagcacttgtaccaaagcatgaaggaagaaccacaaactaaaacctcggtggaaaagctttaaattaaaaaaaatttttaaaagaccaggacctcaagatagcaggtttatacttagaaatatttgaagaaaaaaaagcgttatttatagtccaaagaaaccaaagacttagctcacctgcattctgactttgtttggagacacacacttcagcagggcggcgacttggcaagacaaatgatgagcaggaaaacaccactggatctcacaccttcaatccatgaccatcctcgctgtgcttggctgtttagtggtttggagcatagtgattttgagccattgagcggacatcttttaagatcgaactttctcatctgttctaccatgccacgaaggtgtatggtgtctcagtactaccaccaccagtggttacagacttaggcagagctggtcttcagaaatggttgttctataggagtgcaaccaacatggtatggggttgtctgagttcattggattaggagtgtgattttgctcgtctagcctaacgtttgaacctgccaggcccgcaacctaaatgcagattcaaacccagcaaagaaaatttgaatgac

//

Annotations: