LOCUS       NM_003924               3033 bp    mRNA    linear   PRI 02-JUN-2013
DEFINITION  Homo sapiens paired-like homeobox 2b (PHOX2B), mRNA.
ACCESSION   NM_003924
VERSION     NM_003924.3  GI:172072680
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3033)
  AUTHORS   Di Lascio,S., Bachetti,T., Saba,E., Ceccherini,I., Benfante,R. and
            Fornasari,D.
  TITLE     Transcriptional dysregulation and impairment of PHOX2B
            auto-regulatory mechanism induced by polyalanine expansion
            mutations associated with congenital central hypoventilation
            syndrome
  JOURNAL   Neurobiol. Dis. 50, 187-200 (2013)
   PUBMED   23103552
  REMARK    GeneRIF: The results of this study provide novel in vitro
            experimental evidence of a transcriptional dominant-negative effect
            of PHOX2B polyalanine mutant proteins on wild-type protein on two
            different PHOX2B target genes.
REFERENCE   2  (bases 1 to 3033)
  AUTHORS   Butin,M., Labbe,G., Vrielynck,S., Franco,P., Massenavette,B.,
            Bellon,G. and Reix,P.
  TITLE     [Late onset Ondine syndrome: literature review on a case report]
  JOURNAL   Arch Pediatr 19 (11), 1205-1207 (2012)
   PUBMED   23037578
  REMARK    GeneRIF: A new heterozygote mutation of exan 3 with duplication of
            15 base pairs due to expansion of 5 alanines (genotype 20/25).
            Review article
REFERENCE   3  (bases 1 to 3033)
  AUTHORS   Kaymakci,A., Narter,F., Yazar,A.S. and Yilmaz,M.S.
  TITLE     Congenital central hypoventilation syndrome with hirschsprung's
            disease due to PHOX2B gene mutation in a Turkish infant
  JOURNAL   Turk. J. Pediatr. 54 (5), 519-522 (2012)
   PUBMED   23427517
  REMARK    GeneRIF: testing for PHOX2B mutation can assist iq the diagnosis of
            congenital central hypoventilation syndrome and in the prediction
            of disease progression.
REFERENCE   4  (bases 1 to 3033)
  AUTHORS   Rand,C.M., Yu,M., Jennings,L.J., Panesar,K., Berry-Kravis,E.M.,
            Zhou,L. and Weese-Mayer,D.E.
  TITLE     Germline mosaicism of PHOX2B mutation accounts for familial
            recurrence of congenital central hypoventilation syndrome (CCHS)
  JOURNAL   Am. J. Med. Genet. A 158A (9), 2297-2301 (2012)
   PUBMED   22821709
  REMARK    GeneRIF: report describes a family with recurrence of PHOX2B
            mutation-confirmed congenital central hypoventilation syndrome due
            to germline mosaicism
REFERENCE   5  (bases 1 to 3033)
  AUTHORS   Ousdal,O.T., Anand Brown,A., Jensen,J., Nakstad,P.H., Melle,I.,
            Agartz,I., Djurovic,S., Bogdan,R., Hariri,A.R. and Andreassen,O.A.
  TITLE     Associations between variants near a monoaminergic pathways gene
            (PHOX2B) and amygdala reactivity: a genome-wide functional imaging
            study
  JOURNAL   Twin Res Hum Genet 15 (3), 273-285 (2012)
   PUBMED   22856363
  REMARK    GeneRIF: monoaminergic signaling pathways may play a central role
            in regulating amygdala activity.Candidate gene studies indicate
            that differences in amygdala activity may be caused by genetic
            variants within monoaminergic signaling pathways
REFERENCE   6  (bases 1 to 3033)
  AUTHORS   Adachi,M., Browne,D. and Lewis,E.J.
  TITLE     Paired-like homeodomain proteins Phox2a/Arix and Phox2b/NBPhox have
            similar genetic organization and independently regulate dopamine
            beta-hydroxylase gene transcription
  JOURNAL   DNA Cell Biol. 19 (9), 539-554 (2000)
   PUBMED   11034547
REFERENCE   7  (bases 1 to 3033)
  AUTHORS   Yokoyama,M., Watanabe,H. and Nakamura,M.
  TITLE     Genomic structure and functional characterization of NBPhox
            (PMX2B), a homeodomain protein specific to catecholaminergic cells
            that is involved in second messenger-mediated transcriptional
            activation
  JOURNAL   Genomics 59 (1), 40-50 (1999)
   PUBMED   10395798
REFERENCE   8  (bases 1 to 3033)
  AUTHORS   Pattyn,A., Morin,X., Cremer,H., Goridis,C. and Brunet,J.F.
  TITLE     The homeobox gene Phox2b is essential for the development of
            autonomic neural crest derivatives
  JOURNAL   Nature 399 (6734), 366-370 (1999)
   PUBMED   10360575
REFERENCE   9  (bases 1 to 3033)
  AUTHORS   Pattyn,A., Morin,X., Cremer,H., Goridis,C. and Brunet,J.F.
  TITLE     Expression and interactions of the two closely related homeobox
            genes Phox2a and Phox2b during neurogenesis
  JOURNAL   Development 124 (20), 4065-4075 (1997)
   PUBMED   9374403
REFERENCE   10 (bases 1 to 3033)
  AUTHORS   Yokoyama,M., Nishi,Y., Yoshii,J., Okubo,K. and Matsubara,K.
  TITLE     Identification and cloning of neuroblastoma-specific and nerve
            tissue-specific genes through compiled expression profiles
  JOURNAL   DNA Res. 3 (5), 311-320 (1996)
   PUBMED   9039501
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from D82344.1, BC017199.2,
            AC105389.3 and AI266171.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Apr 4, 2008 this sequence version replaced gi:12707579.
            
            Summary: The DNA-associated protein encoded by this gene is a
            member of the paired family of homeobox proteins localized to the
            nucleus. The protein functions as a transcription factor involved
            in the development of several major noradrenergic neuron
            populations and the determination of neurotransmitter phenotype.
            The gene product is linked to enhancement of second
            messenger-mediated activation of the dopamine beta-hydroylase,
            c-fos promoters and several enhancers, including cyclic
            amp-response element and serum-response element. [provided by
            RefSeq, Jul 2008].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript was available
            for the full length of the gene. The extent of this transcript is
            supported by transcript alignments and orthologous data.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: D82344.1, BC017199.2 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025094 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1234              D82344.1           1-1234
            1235-1751           BC017199.2         971-1487
            1752-2692           AC105389.3         101130-102070       c
            2693-3033           AI266171.1         1-341               c
FEATURES             Location/Qualifiers
     source          1..3033
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4p12"
     gene            1..3033
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /note="paired-like homeobox 2b"
                     /db_xref="GeneID:8929"
                     /db_xref="HGNC:9143"
                     /db_xref="HPRD:09157"
                     /db_xref="MIM:603851"
     exon            1..601
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    268..270
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /note="upstream in-frame stop codon"
     CDS             361..1305
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /note="neuroblastoma paired-type homeobox protein; paired
                     mesoderm homeobox 2b; PHOX2B homeodomain protein;
                     neuroblastoma Phox"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 2B"
                     /protein_id="NP_003915.2"
                     /db_xref="GI:12707580"
                     /db_xref="CCDS:CCDS3463.1"
                     /db_xref="GeneID:8929"
                     /db_xref="HGNC:9143"
                     /db_xref="HPRD:09157"
                     /db_xref="MIM:603851"
                     /translation="

MYKMEYSYLNSSAYESCMAGMDTSSLASAYADFSSCSQASGFQYNPIRTTFGATSGCPSLTPGSCSLGTLRDHQSSPYAAVPYKLFTDHGGLNEKRKQRRIRTTFTSAQLKELERVFAETHYPDIYTREELALKIDLTEARVQVWFQNRRAKFRKQERAAAAAAAAAKNGSSGKKSDSSRDDESKEAKSTDPDSTGGPGPNPNPTPSCGANGGGGGGPSPAGAPGAAGPGGPGGEPGKGGAAAAAAAAAAAAAAAAAAAAGGLAAAGGPGQGWAPGPGPITSIPDSLGGPFASVLSSLQRPNGAKAALVKSSMF

"
     misc_feature    655..804
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(655..669,673..675,724..726,742..744,781..783,
                     787..792,799..804)
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(661..663,670..672,790..792,799..804)
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            602..789
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /inference="alignment:Splign:1.39.8"
     exon            790..3030
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /inference="alignment:Splign:1.39.8"
     variation       810
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:17881486"
     variation       912
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17885216"
     variation       999
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:17879258"
     variation       1110
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17882335"
     variation       1116..1136
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace=""
                     /replace="ggcggcagcggcagcggcggc"
                     /db_xref="dbSNP:17879189"
     variation       1122
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:17884724"
     variation       1136..1137
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace=""
                     /replace="ggccgcggcagcggcggcggcggcagcggcagcggcggc"
                     /db_xref="dbSNP:17886470"
     variation       1230
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:17885864"
     STS             1913..2057
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /standard_name="SHGC-67926"
                     /db_xref="UniSTS:57636"
     variation       2967
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1063611"
     polyA_signal    3008..3013
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
     variation       3017
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1063612"
     polyA_site      3030
                     /gene="PHOX2B"
                     /gene_synonym="NBLST2; NBPhox; PMX2B"
ORIGIN      

ttaaattctaattagagatgcaggaatcaatgatagggaggttggacagctcagttccccagtgccagcccaatagacggatgagttattgtcatgtaaaaagcgccagcaataagaccaaccgctttgctattgtccaagtggaaagagccaagtttattatgaggactatatgctctagagacctcagacaaggcatctcataggaggctttttcataaaactaggctctgctggtagtaaggaggccagtttggaggcaggcgttgagctgtgcacatctccccactccagccaccttctccatatccatcttttatttcatttttccacttggctgagccatccagaaccttttcaatgtataaaatggaatattcttacctcaattcctctgcctacgagtcctgtatggctgggatggacacctcgagcctggcttcagcctatgctgacttcagttcctgcagccaggccagtggcttccagtataacccgataaggaccacttttggggccacgtccggctgcccttccctcacgccgggatcctgcagcctgggcaccctcagggaccaccagagcagtccgtacgccgcagttccttacaaactcttcacggaccacggcggcctcaacgagaagcgcaagcagcggcgcatccgcaccactttcaccagtgcccagctcaaagagctggaaagggtcttcgcggagactcactaccccgacatctacactcgggaggagctggccctgaagatcgacctcacagaggcgcgagtccaggtgtggttccagaaccgccgcgccaagtttcgcaagcaggagcgcgcagcggcagccgcagcggccgcggccaagaacggctcctcgggcaaaaagtctgactcttccagggacgacgagagcaaagaggccaagagcactgacccggacagcactgggggcccaggtcccaatcccaaccccacccccagctgcggggcgaatggaggcggcggcggcgggcccagcccggctggagctccgggggcggcggggcccgggggcccgggaggcgaacccggcaagggcggcgcagcagcagcggcggcggccgcggcagcggcggcggcggcagcggcagcggcggcagctggaggcctggctgcggctgggggccctggacaaggctgggctcccggccccggccccatcacctccatcccggattcgcttgggggtcccttcgccagcgtcctatcttcgctccaaagacccaacggtgccaaagccgccttagtgaagagcagtatgttctgatctggaatcctgcggcggcggcggcggcggcgacagcgggcgagccagggcccgggcgggcgagtgggcgagcgggtaggcccaaggctattgtcgtcgctgctgccatggctttttcattgagggcctaaagtaatcgcgctaagaataaagggaaaacggcgtcgccctcatttcaaccccactcctacccccttcctcaacccccaaacaaaacaaacaaacttccctggcttcgcacctgcctggggcctcgcagcggggccagggctccgcctgctgatcgggggttgtgagcagcgcggcctggacgcggggcactctcagggggctgtgtctgcgtgtcagtttgtgtctgtctcggggaatgtgtgtctgtggcccaagcaggtgacaggaagagatggggggcctcaaccaacttagtgacttgtttagaaaaaaaagacaaaaaagtaaaaataaaaacaaaaaagttggaaggcagaaaccattaaaaaacaaaaagccaacaacccagaaaggtttaaaaaacataaggaaaaaaaagacaaattaaaggaggggctaggggagaagctgcagctggagctgaaggctcgatcttgtgaacccctaaatccgctccctcctaacagcacggattctcttggggctcttcttcagggaagagtagggacgccgttccagccccccttcctatcgtgtccttgggttcgggtcactgcggcgacgacttgctcagactgtcccggcggccggagtgactttctcgcacccccttgcctgtcccacctcgctgaacaccatcccgccattagcgcatcggaaccccacacagttgcaactcccaaccccgaatctttgcagccgttcggccctgaaagatgccctatccatgagatgccttttcatctgcaaactctgcaaaatgtgtctcatgtttcgcaactctttttttccccctcgctcccgcctaccccgtcggcattttcttcttccaccagcttttactgaactttttggcactgctttggattggggtcaattgcagtccacgtaactggctgcagagaaatctaccgagcaaggaaaaggcacacacacacgtttgcaggggtgtctcggtttgcatttctgttggaatgatccgaactggactcacatcctgtatggtggatggactgtatattgagggttccattcttcgcgcagtttagacatctctgttttgattctttgttgttgtttttattttaaaaggcacaaactctagatattagttgaatgttgaggctttaactttttcggtgtctttctacaactgtgttctgtgactcaattgtatcgtgttaatatcagtgcagactgtctcctctacgtgaccgtataatgtttttctcttcttgtagtctctatggcgtgtctttatggtgtaataaggttctcacgggttcaatcttttgtgtttagagaggccacggttcagacaatggtatatatttttgttatcaggtgcatgtctgtctgatttctttttttttcctgttggactatgtttgtgaacataattgtcataagttatgtttcagatttttgaatttatttatatgtgttataatgaatgcttctatttaaaagggaaatatttctacatgtgcatatagttttccaagagtgtaccattaacttgattgttgataataaaaacaaaaagcaagtctaaaa

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:8929 -> Molecular function: GO:0000977 [RNA polymerase II regulatory region sequence-specific DNA binding] evidence: IDA
            GeneID:8929 -> Molecular function: GO:0000978 [RNA polymerase II core promoter proximal region sequence-specific DNA binding] evidence: IDA
            GeneID:8929 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:8929 -> Biological process: GO:0001764 [neuron migration] evidence: ISS
            GeneID:8929 -> Biological process: GO:0002087 [regulation of respiratory gaseous exchange by neurological system process] evidence: ISS
            GeneID:8929 -> Biological process: GO:0003357 [noradrenergic neuron differentiation] evidence: IC
            GeneID:8929 -> Biological process: GO:0003357 [noradrenergic neuron differentiation] evidence: ISS
            GeneID:8929 -> Biological process: GO:0003360 [brainstem development] evidence: IEP
            GeneID:8929 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:8929 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IEA
            GeneID:8929 -> Biological process: GO:0010001 [glial cell differentiation] evidence: ISS
            GeneID:8929 -> Biological process: GO:0021533 [cell differentiation in hindbrain] evidence: ISS
            GeneID:8929 -> Biological process: GO:0021723 [medullary reticular formation development] evidence: ISS
            GeneID:8929 -> Biological process: GO:0021934 [hindbrain tangential cell migration] evidence: ISS
            GeneID:8929 -> Biological process: GO:0035914 [skeletal muscle cell differentiation] evidence: IEA
            GeneID:8929 -> Biological process: GO:0045665 [negative regulation of neuron differentiation] evidence: IEA
            GeneID:8929 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IEA
            GeneID:8929 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:8929 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IMP
            GeneID:8929 -> Biological process: GO:0048483 [autonomic nervous system development] evidence: IMP
            GeneID:8929 -> Biological process: GO:0048484 [enteric nervous system development] evidence: IEP
            GeneID:8929 -> Biological process: GO:0048485 [sympathetic nervous system development] evidence: ISS
            GeneID:8929 -> Biological process: GO:0048486 [parasympathetic nervous system development] evidence: ISS
            GeneID:8929 -> Biological process: GO:0048839 [inner ear development] evidence: ISS
            GeneID:8929 -> Biological process: GO:0048894 [efferent axon development in a lateral line nerve] evidence: ISS
            GeneID:8929 -> Biological process: GO:0060541 [respiratory system development] evidence: ISS
            GeneID:8929 -> Biological process: GO:0061452 [retrotrapezoid nucleus neuron differentiation] evidence: ISS
            GeneID:8929 -> Biological process: GO:0071542 [dopaminergic neuron differentiation] evidence: IC
            GeneID:8929 -> Biological process: GO:0071542 [dopaminergic neuron differentiation] evidence: ISS
            GeneID:8929 -> Biological process: GO:0071773 [cellular response to BMP stimulus] evidence: ISS
            GeneID:8929 -> Biological process: GO:1901166 [neural crest cell migration involved in autonomic nervous system development] evidence: ISS
            GeneID:8929 -> Cellular component: GO:0000790 [nuclear chromatin] evidence: IDA