GGRNA Home | Help | Advanced search

2024-04-20 04:01:35, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_003747               9599 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens tankyrase, TRF1-interacting ankyrin-related ADP-ribose
            polymerase (TNKS), mRNA.
ACCESSION   NM_003747
VERSION     NM_003747.2  GI:87239980
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 9599)
  AUTHORS   Ozaki,Y., Matsui,H., Asou,H., Nagamachi,A., Aki,D., Honda,H.,
            Yasunaga,S., Takihara,Y., Yamamoto,T., Izumi,S., Ohsugi,M. and
            Inaba,T.
  TITLE     Poly-ADP ribosylation of Miki by tankyrase-1 promotes centrosome
            maturation
  JOURNAL   Mol. Cell 47 (5), 694-706 (2012)
   PUBMED   22864114
  REMARK    GeneRIF: The data suggest that PARsylation of Miki by tankyrase-1
            is a key initial event promoting prometaphase.
REFERENCE   2  (bases 1 to 9599)
  AUTHORS   Kim,M.K., Dudognon,C. and Smith,S.
  TITLE     Tankyrase 1 regulates centrosome function by controlling CPAP
            stability
  JOURNAL   EMBO Rep. 13 (8), 724-732 (2012)
   PUBMED   22699936
  REMARK    GeneRIF: CPAP degradation and function is controlled by the
            poly(ADP-ribose) polymerase tankyrase 1.
REFERENCE   3  (bases 1 to 9599)
  AUTHORS   Bisht,K.K., Dudognon,C., Chang,W.G., Sokol,E.S., Ramirez,A. and
            Smith,S.
  TITLE     GDP-mannose-4,6-dehydratase is a cytosolic partner of tankyrase 1
            that inhibits its poly(ADP-ribose) polymerase activity
  JOURNAL   Mol. Cell. Biol. 32 (15), 3044-3053 (2012)
   PUBMED   22645305
  REMARK    GeneRIF: GMD inhibits tankyrase 1 poly(ADP-ribose) polymerase
            activity in vitro, dependent on the GMD tankyrase 1 binding motif.
            In vivo, depletion of GMD led to degradation of tankyrase 1,
            dependent on the catalytic PARP activity of tankyrase 1.
REFERENCE   4  (bases 1 to 9599)
  AUTHORS   Inouye,M., Ripatti,S., Kettunen,J., Lyytikainen,L.P., Oksala,N.,
            Laurila,P.P., Kangas,A.J., Soininen,P., Savolainen,M.J.,
            Viikari,J., Kahonen,M., Perola,M., Salomaa,V., Raitakari,O.,
            Lehtimaki,T., Taskinen,M.R., Jarvelin,M.R., Ala-Korpela,M.,
            Palotie,A. and de Bakker,P.I.
  TITLE     Novel Loci for metabolic networks and multi-tissue expression
            studies reveal genes for atherosclerosis
  JOURNAL   PLoS Genet. 8 (8), E1002907 (2012)
   PUBMED   22916037
REFERENCE   5  (bases 1 to 9599)
  AUTHORS   Gunaydin,H., Gu,Y. and Huang,X.
  TITLE     Novel binding mode of a potent and selective tankyrase inhibitor
  JOURNAL   PLoS ONE 7 (3), E33740 (2012)
   PUBMED   22438990
  REMARK    GeneRIF: crystal structure of the catalytic domain of TNKS1 in
            complex with IWR2, which reveals a novel binding site for tankyrase
            inhibitors
REFERENCE   6  (bases 1 to 9599)
  AUTHORS   Lyons,R.J., Deane,R., Lynch,D.K., Ye,Z.S., Sanderson,G.M.,
            Eyre,H.J., Sutherland,G.R. and Daly,R.J.
  TITLE     Identification of a novel human tankyrase through its interaction
            with the adaptor protein Grb14
  JOURNAL   J. Biol. Chem. 276 (20), 17172-17180 (2001)
   PUBMED   11278563
REFERENCE   7  (bases 1 to 9599)
  AUTHORS   Chi,N.W. and Lodish,H.F.
  TITLE     Tankyrase is a golgi-associated mitogen-activated protein kinase
            substrate that interacts with IRAP in GLUT4 vesicles
  JOURNAL   J. Biol. Chem. 275 (49), 38437-38444 (2000)
   PUBMED   10988299
REFERENCE   8  (bases 1 to 9599)
  AUTHORS   Smith,S. and de Lange,T.
  TITLE     Cell cycle dependent localization of the telomeric PARP, tankyrase,
            to nuclear pore complexes and centrosomes
  JOURNAL   J. Cell. Sci. 112 (PT 21), 3649-3656 (1999)
   PUBMED   10523501
REFERENCE   9  (bases 1 to 9599)
  AUTHORS   Zhu,L., Smith,S., de Lange,T. and Seldin,M.F.
  TITLE     Chromosomal mapping of the tankyrase gene in human and mouse
  JOURNAL   Genomics 57 (2), 320-321 (1999)
   PUBMED   10198177
REFERENCE   10 (bases 1 to 9599)
  AUTHORS   Smith,S., Giriat,I., Schmitt,A. and de Lange,T.
  TITLE     Tankyrase, a poly(ADP-ribose) polymerase at human telomeres
  JOURNAL   Science 282 (5393), 1484-1487 (1998)
   PUBMED   9822378
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AF082556.1, AL706619.1, BC098394.1 and AC104052.9.
            On Feb 14, 2006 this sequence version replaced gi:4507612.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF082556.1, BC098394.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1390              AF082556.1         1-1390
            1391-1446           AL706619.1         475-530
            1447-2409           AF082556.1         1447-2409
            2410-3006           BC098394.1         2433-3029
            3007-4134           AF082556.1         3007-4134
            4135-9599           AC104052.9         10710-16174         c
FEATURES             Location/Qualifiers
     source          1..9599
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8p23.1"
     gene            1..9599
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="tankyrase, TRF1-interacting ankyrin-related
                     ADP-ribose polymerase"
                     /db_xref="GeneID:8658"
                     /db_xref="HGNC:11941"
                     /db_xref="MIM:603303"
     exon            1..678
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       2
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375949097"
     CDS             6..3989
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /EC_number="2.4.2.30"
                     /note="TANK1; TNKS-1; tankyrase I; poly [ADP-ribose]
                     polymerase 5A; TRF1-interacting ankyrin-related ADP-ribose
                     polymerase; ADP-ribosyltransferase diphtheria toxin-like
                     5"
                     /codon_start=1
                     /product="tankyrase-1"
                     /protein_id="NP_003738.2"
                     /db_xref="GI:87239981"
                     /db_xref="CCDS:CCDS5974.1"
                     /db_xref="GeneID:8658"
                     /db_xref="HGNC:11941"
                     /db_xref="MIM:603303"
                     /translation="
MAASRRSQHHHHHHQQQLQPAPGASAPPPPPPPPLSPGLAPGTTPASPTASGLAPFASPRHGLALPEGDGSRDPPDRPRSPDPVDGTSCCSTTSTICTVAAAPVVPAVSTSSAAGVAPNPAGSGSNNSPSSSSSPTSSSSSSPSSPGSSLAESPEAAGVSSTAPLGPGAAGPGTGVPAVSGALRELLEACRNGDVSRVKRLVDAANVNAKDMAGRKSSPLHFAAGFGRKDVVEHLLQMGANVHARDDGGLIPLHNACSFGHAEVVSLLLCQGADPNARDNWNYTPLHEAAIKGKIDVCIVLLQHGADPNIRNTDGKSALDLADPSAKAVLTGEYKKDELLEAARSGNEEKLMALLTPLNVNCHASDGRKSTPLHLAAGYNRVRIVQLLLQHGADVHAKDKGGLVPLHNACSYGHYEVTELLLKHGACVNAMDLWQFTPLHEAASKNRVEVCSLLLSHGADPTLVNCHGKSAVDMAPTPELRERLTYEFKGHSLLQAAREADLAKVKKTLALEIINFKQPQSHETALHCAVASLHPKRKQVTELLLRKGANVNEKNKDFMTPLHVAAERAHNDVMEVLHKHGAKMNALDTLGQTALHRAALAGHLQTCRLLLSYGSDPSIISLQGFTAAQMGNEAVQQILSESTPIRTSDVDYRLLEASKAGDLETVKQLCSSQNVNCRDLEGRHSTPLHFAAGYNRVSVVEYLLHHGADVHAKDKGGLVPLHNACSYGHYEVAELLVRHGASVNVADLWKFTPLHEAAAKGKYEICKLLLKHGADPTKKNRDGNTPLDLVKEGDTDIQDLLRGDAALLDAAKKGCLARVQKLCTPENINCRDTQGRNSTPLHLAAGYNNLEVAEYLLEHGADVNAQDKGGLIPLHNAASYGHVDIAALLIKYNTCVNATDKWAFTPLHEAAQKGRTQLCALLLAHGADPTMKNQEGQTPLDLATADDIRALLIDAMPPEALPTCFKPQATVVSASLISPASTPSCLSAASSIDNLTGPLAELAVGGASNAGDGAAGTERKEGEVAGLDMNISQFLKSLGLEHLRDIFETEQITLDVLADMGHEELKEIGINAYGHRHKLIKGVERLLGGQQGTNPYLTFHCVNQGTILLDLAPEDKEYQSVEEEMQSTIREHRDGGNAGGIFNRYNVIRIQKVVNKKLRERFCHRQKEVSEENHNHHNERMLFHGSPFINAIIHKGFDERHAYIGGMFGAGIYFAENSSKSNQYVYGIGGGTGCPTHKDRSCYICHRQMLFCRVTLGKSFLQFSTMKMAHAPPGHHSVIGRPSVNGLAYAEYVIYRGEQAYPEYLITYQIMKPEAPSQTATAAEQKT
"
     misc_feature    627..971
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    648..746
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 1"
     misc_feature    663..941
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    747..845
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 2"
     misc_feature    846..944
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 3"
     misc_feature    1020..1172
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="Ankyrin repeats (many copies); Region: Ank_4;
                     pfam13637"
                     /db_xref="CDD:205814"
     misc_feature    1095..1430
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1098..1100
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95271.2); phosphorylation site"
     misc_feature    1107..1205
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 4"
     misc_feature    1122..1400
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1206..1304
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 5"
     misc_feature    1305..1403
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 6"
     misc_feature    1566..1673
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 7"
     misc_feature    1572..1922
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    1581..1862
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    1674..1772
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 8"
     misc_feature    1773..1871
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 9"
     misc_feature    2031..2396
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2052..2150
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 10"
     misc_feature    2067..2345
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2151..2249
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 11"
     misc_feature    2250..2348
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 12"
     misc_feature    2490..2840
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="ankyrin repeats;  ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:29261"
     misc_feature    2511..2609
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 13"
     misc_feature    2526..2804
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:205076"
     misc_feature    2610..2708
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 14"
     misc_feature    2709..2807
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95271.2);
                     Region: ANK 15"
     misc_feature    3075..3272
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="SAM domain of tankyrase1,2 subfamily; Region:
                     SAM_tankyrase1,2; cd09524"
                     /db_xref="CDD:188923"
     misc_feature    3093..3266
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="SAM domain (Sterile alpha motif); Region: SAM_2;
                     pfam07647"
                     /db_xref="CDD:203706"
     misc_feature    3276..3944
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /note="Tankyrases interact with the telomere reverse
                     transcriptase complex (TERT). Tankyrase 1
                     poly-ADP-ribosylates Telomere Repeat Binding Factor 1
                     (TRF1) while Tankyrase 2 can poly-ADP-ribosylate itself or
                     TRF1. The tankyrases also contain multiple ankyrin...;
                     Region: tankyrase_like; cd01438"
                     /db_xref="CDD:30069"
     variation       32
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200583768"
     variation       39
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367708021"
     variation       50
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112547145"
     variation       106
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371322654"
     variation       135
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201138981"
     variation       150
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201993870"
     variation       159
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368167994"
     variation       177
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199903761"
     variation       220
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372032670"
     variation       236
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202025565"
     variation       244
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146118607"
     variation       248
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369426205"
     variation       279
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373323688"
     variation       290
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139926450"
     variation       295
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149797804"
     variation       301
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376761478"
     variation       304
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200323172"
     variation       314
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145737152"
     variation       338
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148957874"
     variation       352
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370818016"
     variation       379
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374540073"
     variation       398
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200824093"
     variation       407
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377697995"
     variation       431
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:33985989"
     variation       432
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147674490"
     variation       438
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200230198"
     variation       439
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199699778"
     variation       447
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201402361"
     variation       449
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35433754"
     variation       463
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370539656"
     variation       464
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147020772"
     variation       499
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373923504"
     variation       525
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34534956"
     variation       527
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34464799"
     variation       549
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374560573"
     variation       563
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201469839"
     variation       566
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140803272"
     variation       569
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376233355"
     variation       584
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371825172"
     variation       594..595
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35934562"
     variation       605
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:33945943"
     variation       610
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138423475"
     variation       626
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373769442"
     variation       644
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367692888"
     variation       647
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149276600"
     exon            679..903
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       695
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372777869"
     variation       707
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375073918"
     variation       711
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201885608"
     variation       715
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146176881"
     variation       726
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200260123"
     variation       734
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369007371"
     variation       776
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137902255"
     variation       863
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79117686"
     variation       890
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34046308"
     variation       903
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146167904"
     exon            904..999
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       918
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201384024"
     variation       923
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376192042"
     variation       943
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199953003"
     variation       957
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370316105"
     variation       959
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373207143"
     exon            1000..1036
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1029
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201842298"
     exon            1037..1112
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1039
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201078116"
     variation       1052
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61756245"
     variation       1077
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373714842"
     variation       1099
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142382274"
     exon            1113..1207
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1135
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373493403"
     variation       1177
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377442646"
     exon            1208..1274
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1268
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374691135"
     exon            1275..1461
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1276
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376222441"
     variation       1297
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139294552"
     variation       1325
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374645879"
     variation       1373
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34433162"
     variation       1391
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7006985"
     variation       1394
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368930379"
     variation       1395
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201741994"
     variation       1438
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140760765"
     variation       1439
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:33944167"
     variation       1455
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147630037"
     exon            1462..1583
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1476
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372566002"
     variation       1480
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79587922"
     variation       1520
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56411177"
     variation       1536
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375493489"
     variation       1559..1560
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34305756"
     variation       1561
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188830245"
     variation       1562
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370231803"
     variation       1566
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373414511"
     variation       1581
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375713264"
     exon            1584..1675
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1590
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370457489"
     variation       1592
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368779508"
     variation       1663
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:200458028"
     exon            1676..1754
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1722
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201355239"
     variation       1724
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35052906"
     variation       1726
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371506761"
     variation       1734
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145392682"
     variation       1753
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374807144"
     exon            1755..1926
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1755
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201404312"
     variation       1766
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137883371"
     variation       1771
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371434338"
     variation       1811
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6601360"
     variation       1861
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112075502"
     variation       1877
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201559821"
     variation       1884
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201334888"
     variation       1920
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372624223"
     exon            1927..2006
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1941
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144610024"
     variation       1949
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138926774"
     variation       1961
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184946820"
     variation       1971
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13280377"
     variation       1978
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149437110"
     variation       1988
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374285604"
     variation       2006
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368780658"
     exon            2007..2152
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       2034
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144777175"
     variation       2066
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372527063"
     variation       2093
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376984415"
     variation       2132
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202202187"
     exon            2153..2318
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       2159
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77413407"
     variation       2225
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375885858"
     variation       2249
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75390657"
     variation       2261
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373431532"
     variation       2307
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34016764"
     exon            2319..2538
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       2330
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148570227"
     variation       2336
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61752022"
     variation       2359
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371535394"
     variation       2360
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61995863"
     variation       2366
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374665141"
     variation       2479
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147259455"
     variation       2526
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374523549"
     exon            2539..2648
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       2552
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192449459"
     variation       2559
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34915856"
     variation       2590
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140823807"
     variation       2627
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144582410"
     exon            2649..2837
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       2664
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372645546"
     variation       2687
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377210789"
     variation       2714
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35491087"
     variation       2772
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199759393"
     variation       2776
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369068511"
     variation       2787
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61756339"
     variation       2795
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141384914"
     variation       2817
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373055237"
     variation       2819
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376610791"
     exon            2838..3075
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       2843
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139610385"
     variation       2879
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200640807"
     variation       2892
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201930134"
     variation       2915
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201271096"
     variation       2931
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200533930"
     variation       2940
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199621641"
     variation       2952
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200672279"
     variation       2953
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149754939"
     variation       2954
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114570088"
     variation       2956
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374610047"
     variation       2957
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377463447"
     variation       2966
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140368048"
     variation       2984
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145459826"
     variation       3001
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201811206"
     variation       3014
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201607807"
     variation       3015
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370349163"
     variation       3033
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377231324"
     variation       3047
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146441688"
     variation       3050
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13265931"
     exon            3076..3158
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       3082
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199978883"
     variation       3128
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144586907"
     variation       3144
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375751229"
     exon            3159..3279
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       3209
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370745031"
     exon            3280..3377
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       3288
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200255841"
     variation       3293
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148202494"
     variation       3300
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377707958"
     variation       3314
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141570530"
     variation       3322
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150495385"
     variation       3323
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138329640"
     variation       3336
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143946846"
     exon            3378..3452
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       3420
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370453521"
     variation       3442
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147302623"
     variation       3451
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139110221"
     exon            3453..3558
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       3475
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143138820"
     variation       3490
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144670622"
     variation       3529
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113046137"
     variation       3539
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142219846"
     exon            3559..3745
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       3587
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202149533"
     variation       3635
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373127636"
     variation       3689
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377301270"
     variation       3716
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149009997"
     exon            3746..3902
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       3755
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373913930"
     variation       3788
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150786363"
     variation       3811
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371350983"
     variation       3815
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370028506"
     variation       3845
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139420287"
     variation       3851
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144079466"
     variation       3854
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146492803"
     variation       3869
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200026893"
     exon            3903..9599
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /inference="alignment:Splign:1.39.8"
     variation       3960..3961
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:372693113"
     variation       3963
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376965971"
     variation       3966
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149703298"
     variation       3971
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370002383"
     variation       3972
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145459182"
     variation       3983
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372614885"
     variation       3997
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377213900"
     variation       4007
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189437709"
     variation       4025
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369239352"
     variation       4026
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202229629"
     variation       4033
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142076288"
     variation       4044
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151161822"
     variation       4059..4061
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="aac"
                     /db_xref="dbSNP:373486675"
     variation       4159
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192033466"
     variation       4170
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375292112"
     variation       4203
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140211601"
     variation       4218
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79488099"
     variation       4310
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185036568"
     variation       4336
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145188514"
     variation       4382
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147614367"
     variation       4425
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142210048"
     variation       4438
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200707417"
     variation       4449
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201771712"
     variation       4451
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190327205"
     variation       4516
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181099465"
     variation       4520
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186591383"
     variation       4523
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146119290"
     variation       4526
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188245939"
     variation       4561
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367669222"
     variation       4613
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138665265"
     variation       4617
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7010154"
     variation       4629
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376181083"
     variation       4645
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181059216"
     variation       4687
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74384847"
     variation       4702
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148922406"
     variation       4729
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143665670"
     variation       4740
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372531683"
     variation       4747..4748
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="caaagc"
                     /db_xref="dbSNP:376591741"
     variation       4754
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148103295"
     variation       4790
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73533242"
     variation       4804
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375522885"
     variation       4826
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369449584"
     variation       4833
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1567834"
     variation       4912
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112157776"
     variation       4932
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115349468"
     variation       4969
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377704913"
     variation       4985
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191159802"
     variation       5068
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184102996"
     variation       5089
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114345287"
     STS             5168..5297
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /standard_name="RH11883"
                     /db_xref="UniSTS:25352"
     variation       5169
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:114598301"
     variation       5177
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186560907"
     variation       5340
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142854171"
     variation       5342
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375054902"
     variation       5396
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147639006"
     variation       5397
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149707211"
     variation       5398
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:10707070"
     variation       5398
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200532914"
     variation       5406..5407
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:199585800"
     variation       5437
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:114567832"
     variation       5457
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191925720"
     variation       5465
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145079359"
     variation       5512
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182967083"
     variation       5513
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17734024"
     variation       5536
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187190402"
     variation       5552
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116112276"
     variation       5634
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370500949"
     variation       5655
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191197688"
     variation       5665
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182316977"
     variation       5780
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138956270"
     variation       5840..5841
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35365922"
     variation       5868
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142177304"
     STS             5880..6045
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /standard_name="RH103385"
                     /db_xref="UniSTS:97711"
     variation       5916
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186711208"
     variation       5929..5930
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:146236868"
     STS             5936..6129
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /standard_name="SHGC-132382"
                     /db_xref="UniSTS:184694"
     STS             5949..6057
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /standard_name="SHGC-24414"
                     /db_xref="UniSTS:81158"
     variation       5970
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116235840"
     variation       6028
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:150898783"
     variation       6095
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376757023"
     variation       6108
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79605882"
     variation       6127
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:28522162"
     variation       6269
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139421787"
     variation       6290
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116048270"
     variation       6292
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:118140142"
     variation       6353
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78792275"
     variation       6370
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115608999"
     variation       6376
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116763133"
     variation       6387
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3195872"
     variation       6445
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192388392"
     variation       6520
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149235665"
     variation       6526
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114815446"
     variation       6570..6571
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34471182"
     variation       6570
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185697954"
     variation       6594
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116634913"
     variation       6703
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377525495"
     variation       6704
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370596511"
     variation       6722
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:114357368"
     variation       6772
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114593480"
     variation       6783
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144446176"
     variation       6784
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188214336"
     variation       6947
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148415547"
     variation       6999
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193193470"
     variation       7018
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368531355"
     variation       7021
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184746023"
     variation       7061
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17150469"
     variation       7079
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2409596"
     variation       7132
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145121823"
     variation       7142
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147597841"
     variation       7167
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140483356"
     variation       7256
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188779270"
     variation       7300
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144437591"
     variation       7308
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:112322359"
     variation       7358
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180799507"
     variation       7425
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183652924"
     variation       7618
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188361580"
     variation       7619
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181956215"
     variation       7642
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187655543"
     variation       7654
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201104900"
     STS             7679..7832
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /standard_name="RH18302"
                     /db_xref="UniSTS:28435"
     variation       7719
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:151213611"
     variation       7814
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140399431"
     variation       7822
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4841214"
     variation       7837
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371423115"
     variation       7891
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75341924"
     variation       7895
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191574548"
     variation       7913
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58961347"
     variation       7932
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370798146"
     variation       7963
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78542077"
     variation       8000
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150390777"
     variation       8033
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368148633"
     variation       8043
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111263638"
     variation       8050
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111986298"
     variation       8051
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4841215"
     variation       8111
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182099738"
     variation       8165
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185411653"
     variation       8352
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189978989"
     variation       8408
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141256018"
     variation       8423
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182608419"
     variation       8432
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76060156"
     variation       8555
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:114524248"
     variation       8597
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115264421"
     variation       8750
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186472689"
     variation       8793
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191063611"
     variation       8827
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183827189"
     variation       8899
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34235298"
     variation       8918
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189242183"
     variation       8930
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116015687"
     variation       8947
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192856043"
     variation       9059
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055328"
     variation       9097
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7840300"
     variation       9113
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12548832"
     variation       9165
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377297433"
     variation       9172
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1133783"
     variation       9263
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187553060"
     variation       9265
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10191"
     variation       9287
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145044629"
     variation       9288
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138890559"
     STS             9335..9539
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /standard_name="HSC2QE062"
                     /db_xref="UniSTS:13182"
     variation       9363
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142113862"
     variation       9368
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143771738"
     variation       9372
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148155663"
     STS             9373..9561
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /standard_name="A005X23"
                     /db_xref="UniSTS:4933"
     STS             9373..9561
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /standard_name="G20573"
                     /db_xref="UniSTS:4932"
     variation       9398
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116326675"
     variation       9439
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191674330"
     variation       9453
                     /gene="TNKS"
                     /gene_synonym="ARTD5; PARP-5a; PARP5A; PARPL; pART5; TIN1;
                     TINF1; TNKS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371823423"
ORIGIN      
cgaagatggcggcgtcgcgtcgctctcagcatcatcaccaccatcatcaacaacagctccagcccgccccaggggcttcagcgccgccgccgccacctcctcccccactcagccctggcctggccccggggaccaccccagcctctcccacggccagcggcctggcccccttcgcctccccgcggcacggcctagcgctgccggagggggatggcagtcgggatccgcccgacaggccccgatccccggacccggttgacggtaccagctgttgcagtaccaccagcacaatctgtaccgtcgccgccgctcccgtggtcccagcggtttctacttcatctgccgctggggtcgctcccaacccagccggcagtggcagtaacaattcaccgtcgtcctcttcttccccgacttcttcctcatcttcctctccatcctcccctggatcgagcttggcggagagccccgaggcggccggagttagcagcacagcaccactggggcctggggcagcaggacctgggacaggggtcccagcagtgagcggggccctacgggaactgctggaggcctgtcgcaatggggacgtgtcccgggtaaagaggctggtggacgcggcaaacgtaaatgcaaaggacatggccggccggaagtcttctcccctgcacttcgctgcaggttttggaaggaaggatgttgtagaacacttactacagatgggtgctaatgtccacgctcgtgatgatggaggtctcatcccgcttcataatgcctgttcttttggccatgctgaggttgtgagtctgttattgtgccaaggagctgatccaaatgccagggataactggaactatacacctctgcatgaagctgctattaaagggaagatcgatgtgtgcattgtgctgctgcagcacggagctgacccaaacattcggaacactgatgggaaatcagccctggacctggcagatccttcagcaaaagctgtccttacaggtgaatacaagaaagacgaactcctagaagctgctaggagtggtaatgaagaaaaactaatggctttactgactcctctaaatgtgaattgccatgcaagtgatgggcgaaagtcgactcctttacatctagcagcgggctacaacagagttcgaatagttcagcttcttcttcagcatggtgctgatgttcatgcaaaagacaaaggtggacttgtgcctcttcataatgcatgttcatatggacattatgaagtcacagaactgctactaaagcatggagcttgtgttaatgccatggatctctggcagtttactccactgcacgaggctgcttccaagaaccgtgtagaagtctgctctttgttacttagccatggcgctgatcctacattagtcaactgccatggcaaaagtgctgtggatatggctccaactccggagcttagggagagattgacttatgaatttaaaggtcattctttactacaagcagccagagaagcagacttagctaaagttaaaaaaacactcgctctggaaatcattaatttcaaacaaccgcagtctcatgaaacagcactgcactgtgctgtggcctctctgcatcccaaacgtaaacaagtgacagaattgttacttagaaaaggagcaaatgttaatgaaaaaaataaagatttcatgactcccctgcatgttgcagccgaaagagcccataatgatgtcatggaagttctgcataagcatggcgccaagatgaatgcactggacacccttggtcagactgctttgcatagagccgccctagcaggccacctgcagacctgccgcctcctgctgagttacggctctgacccctccatcatctccttacaaggcttcacagcagcacagatgggcaatgaagcagtgcagcagattctgagtgagagtacacctatacgtacttctgatgttgattatcgactcttagaggcatctaaagctggagacttggaaactgtgaagcaactttgcagctctcaaaatgtgaattgtagagacttagagggccggcattccacgcccttacacttcgcagcaggctacaaccgcgtgtctgttgtagagtacctgctacaccacggtgccgatgtccatgccaaagacaagggtggcttggtgccccttcataatgcctgttcatatggacactatgaggtggctgagcttttagtaaggcatggggcttctgtcaatgtggcggacttatggaaatttacccctctccatgaagcagcagctaaaggaaagtatgaaatctgcaagctccttttaaaacatggagcagatccaactaaaaagaacagagatggaaatacacctttggatttggtaaaggaaggagacacagatattcaggacttactgagaggggatgctgctttgttggatgctgccaagaagggctgcctggcaagagtgcagaagctctgtaccccagagaatatcaactgcagagacacccagggcagaaattcaacccctctgcacctggcagcaggctataataacctggaagtagctgaatatcttctagagcatggagctgatgttaatgcccaggacaagggtggtttaattcctcttcataatgcggcatcttatgggcatgttgacatagcggctttattgataaaatacaacacgtgtgtaaatgcaacagataagtgggcgtttactcccctccatgaagcagcccagaaaggaaggacgcagctgtgcgccctcctcctagcgcatggtgcagaccccaccatgaagaaccaggaaggccagacgcctctggatctggcaacagctgacgatatcagagctttgctgatagatgccatgcccccagaggccttacctacctgttttaaacctcaggctactgtagtgagtgcctctctgatctcaccagcatccaccccctcctgcctctcggctgccagcagcatagacaacctcactggccctttagcagagttggccgtaggaggagcctccaatgcaggggatggcgccgcgggaacagaaaggaaggaaggagaagttgctggtcttgacatgaatatcagccaatttctaaaaagccttggccttgaacaccttcgggatatctttgaaacagaacagattacactagatgtgttggctgatatgggtcatgaagagttgaaagaaataggcatcaatgcatatgggcaccgccacaaattaatcaaaggagtagaaagactcttaggtggacaacaaggcaccaatccttatttgacttttcactgtgttaatcagggaacgattttgctggatcttgctccagaagataaagaatatcagtcagtggaagaagagatgcaaagtactattcgagaacacagagatggtggtaatgctggcggcatcttcaacagatacaatgtcattcgaattcaaaaagttgtcaacaagaagttgagggagcggttctgccaccgacagaaggaagtgtctgaggagaatcacaaccatcacaatgagcgcatgttgtttcatggttctcctttcattaatgccattattcataaagggtttgatgagcgacatgcatacataggaggaatgtttggggccgggatttattttgctgaaaactcctcaaaaagcaaccaatatgtttatggaattggaggaggaacaggctgccctacacacaaggacaggtcatgctatatatgtcacagacaaatgctcttctgtagagtgacccttgggaaatcctttctgcagtttagcaccatgaaaatggcccacgcgcctccagggcaccactcagtcattggtagaccgagcgtcaatgggctggcatatgctgaatatgtcatctacagaggagaacaggcatacccagagtatcttatcacttaccagatcatgaagccagaagccccttcccagaccgcaacagccgcagagcagaagacctagtgaatgcctgctggtgaaggccagatcagatttcaacctgggactggattacagaggattgtttctaataacaacatcaatattctagaagtccctgacagcctagaaataagctgtttgtcttctataaagcattgctatagtgatgaatagtatgagtaactgatacatactcaactgctactgttccctttgaggaaatgtttacaggggcggccttttaacatatctcaggctcattttcattgcaattatccatttctaaaacaagattgcttcgatctagacttggaaatggaaaataagaaaaccaatgctttttcaaatgttcacaattcacacactacatttgttttgttatgcatgacgtgtctataacaaatatacacatacgacaggcaacaagcttgtttttgatttgccagacatgcatcattggctattgtttgtttgttttttgtttttttgtgttttttgggttactttgaaaatgagccagagccttcttgaggatattttgcacaaagtcacgctgacaaaatcattagcagtgcaacccaagcttctggctgagcaagattcagtttccactttttaaaatttttttattttgctctgtagctgcacttctcgttatcataaattgagatgaaaaggaaaaaacatcaagttttagtacctttttatgaattggcctatcttacaagagaagggcacaaacaccaacctgacttaggaacgcctaaattcagagaagtcaaagccggtgaaggccacttgctctttccaacacaagcctgccacagaggtcttcgggacagtactggagatgcaggttgacacgggcttgagttccaaggtgaaaaaactggggaggctgtgaaggaagagctgcattaaggagggtgaggagcgtgtggttctgtatcatggcagccccaatggatccaggggatgcctccaaaaaatacatgcttcccttcccttaatctgtactgttgggattgttacccctccaaattagctgccttatttcaaaagtcagtgaaattactgcacttgatgagggtcacaaaaataccacttgattgtttctttagttgagaatgctgggattcagactcgaatagtggatagatacacacaaatgcaaggacttttttgtttactccagatttggggtttattttgagtggcatgcttcaaatagttcataaagatccttgcattaaatttctgaaccatttcttcaaacttcttagtgtgtttagacaaggagaacaaaaattgaaaccaaagccctttctgttattttttcaatgaaggtgagaaagaaataccatacaattttctttgtgaaattactgtttattttcatcaacatttaccaagtgccattgacatttataaaaaaaaatgatcctttatagttcttacacttgcccttttcaccttaactgaatatgaattgagtgcactaacttatttacttgatatactgtgcatctactctgctttgaagcgaaagaaatataaacacgaggaggaataggaaagacagtgtgacacaaacttgccattgcaattcaaagccctgaaaacgatgggtttaatgcaaggtgattaagctgtgacctcctttaatctcctgaagcaaaataaaatggttacatgcaaaacttctagaaatagactcttaaaatatatacattttgctttgattttggcttcaacccagtgctggaactaggcatccagactagtttgaatgtttgtagctgaatttttatgggtcctcaaaattaaatcgagaattagcctcagttgttgcttcttttgaagtttcagtgacccaagctgggtgtttgtgtcttggctacttgtttaatagcactagaattccaggtgaagctttgagagttgatattcattaagagggctttttttccccttctttccttctcttttgctgtaacaaagggttgaagaaattgccatctgtgtagttttcagtagctgtcaagtgtgtcttacttaccttcccccagacgtagtttaaaatggtaaacacagctgtgatttttagttaagtaaaagagttaatatgatatagatatggaaagctttatggcttcattaaaaagataaaccactacctaactgtggttgtatgttgtttccatcatactaactagatgaatggatgcgccagttttcatcttggtccttacacttgagaagttaaactgtggttcagtatttaaactgccagtgttatacgtctcatgctctgtgtgccaggtgaaggtactgtgtaaggaagacatttgcggtgcttcttgtcctataatgattcaagtatatagtagttcttgaaagagtgtgcatatattactcatctgcttaagagagtgggttaatggatatatcagaggagccaaatacatttttttcagaacttgaaaaccaaaggtcatcatgagtgcactcaaaagttaggacaagtttattacatttgggattttcatctgtagccgtatgaagaaccctttccaatataaaagcatggcattaaattaggctgaagtcttttattttttgtatatgtactatatagaaatactagcaagttaggatcatccaatatggcctaccccgaaatggcccctctgtttccctaaccacatggaagaaagaatctgaacgtctccaccggctctacccgagttccaaaactaaagggcttctccagacctgatggttccagtttacctgctgttggcctgctggatacttgactcaggcataaattaagtgccctggtcccgaactttctccctgtatttgacctccttccctctttcctaaattactagtctggaattaaaattagctccagcaatgacctttgactccattcattttctcctcatcttgggtcttaaaaaaggagaccagatacctcctagcttttgtatcacaaccaggaatgggtattaggcctcatgcgctttgctcagaacactgccgctttgttaacaaatgacagcatggaacccagagttttgattcgatgcaaaataacagcagtgcaaccaggattcttgttttccttttccttcttggagtttggaatttctagcttttcaagcagcataagtagaatcaacattaggatgttttcatgaaatagcatccttatacttctttgagcttgatgttagtggctagactgatttccctttgctctcaaaatacaaagtgcattgaagtatacagagaaatgcctgaatatggcaagcaaataatgtagattaacattctattattgtatccgttttacaaaaaataaaattttgatatatgccggagaacggcattagaatgcaataagttgtctaggtttttctgtttcagtgtctctcccaatggcacgaagggttattgggcattgtccccacccccgcctttttaacatgtgcactatctggattcctgtaaatggccttgcaaacagaagtggtgtgtattttcaagcacctttcccccattgtatccgaatccctcttgtgtgatatctgtgacaaatagccttcttcttgtgttttctgttggactaattgtctcacgtaaagctatagaccttactaatttggcaggtattcaaaactgccattaagataggatttcatgtcagatacgtatttaaagagtaaagtcaaatttgtttaatgtcagatcagtgacagaagtgaaaagaaagtaattgtgaaagtgatgtttgagctattgtacacatctagcatatggaaagcaaatgcactcgaaaactactattctagaacatgaggcttcttcagcaacttgtgcactctgccattaataaattaaatttttcccctctagaaagccttaactatggcggaaactttttaaccttttatattttaataaataaaacattgtagtcccatttcttagtgtttgaaaggtgtgtcagtgagtcggccatgtctccatgtgtttcagacctgttcatcttattttatgatggtatatttcataagtaatattcccttacatgcaatggagctgattaaaattaatccatttcaatttctccatattggaacttcctcagctaccagatttctggtttggagaagtgctggaaagatttcaaagcctattcagttgtgtatgtggggatacgacagcaactgtgataccttgtagaatatgagtgatatgcaagctgtgttttttaattgttttaaaatgtaaattatggttatgctaaagtgaaaacctagaggaagctaatgattttatatactttgcacgaccaaatatggtcgtagtatgacgagttttatacattgccagagagttctgcctcctctgaaataacattcgcactgtagattgcatttcggcttttcctcctttcacattcttttttgctttacacttcacgtcttcgcacctgccctacctcccatcctttcaaagaggtttctttcacgttccagaattcagattgttctgtgatttcttttacatcagtctacccatttctgcaggcagccctgaaagcccttgtgttgattcagagtgtttgcagagaaatgcagttgaaccctggtagtggggtgtccctcacacacccgcgcacccctcccaaagttcaggatgaaaggctagaaaacccattcaaagttaggaaagaacacagatctttgaggccgatagcctagacctagaagatgaccttgagtatgtaaacattgtctccgtgacacaaaacactgaaactcttcatgtgcatataacacctgcttctgctcccattgtttcaagctcatcttatctttgtagtagtaatgtttgtctttgatacctacaaactaaaaaggtacttttatcaaggtttctcaaaacatttacaaaaccagctttgagaaaatgttatgttgcctggcaacagcactcggagtagtaattgtgttttctcattgtgatgttggtctgtgtgagcaaccagtgtagtgactctttggttcattattcgtgttgtttttatttttagtctctgtgtgacccaacagtggcaggggttacaaccccctctcctttcttttttgtatttatctatttgtaggattgtcagatcaagtacaagatgcccagttaagtttgaatttcagagaaacaatttcacgttaagaatgtttcatgcaatatttggcatatatttacagtaaaagcattcattatttgtctgaaattcaaatttaactgagcatgctggtttttctcattgtttggtttttctaaatctggcaatcctacagctgtggtcatgggaaatcacctacagcatgttaaagtcctctagtcatcatctcgtcacctgaaatggaagtcctttttccctcaccctccacttctttccaaaggagggcatcaaggaacttaacctgcctgcctggtgggtttctatttaagacatctttgtgattatatttaacctgcaattgtgctttggcttaatgtctagctcactgtacttgtaaatgattaatattcaataaaaccatttttaaagta
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:8658 -> Molecular function: GO:0003950 [NAD+ ADP-ribosyltransferase activity] evidence: IDA
            GeneID:8658 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:8658 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IDA
            GeneID:8658 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: IDA
            GeneID:8658 -> Biological process: GO:0006471 [protein ADP-ribosylation] evidence: IDA
            GeneID:8658 -> Biological process: GO:0007052 [mitotic spindle organization] evidence: TAS
            GeneID:8658 -> Biological process: GO:0007067 [mitosis] evidence: IEA
            GeneID:8658 -> Biological process: GO:0015031 [protein transport] evidence: IEA
            GeneID:8658 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IEA
            GeneID:8658 -> Biological process: GO:0018105 [peptidyl-serine phosphorylation] evidence: IDA
            GeneID:8658 -> Biological process: GO:0018107 [peptidyl-threonine phosphorylation] evidence: IDA
            GeneID:8658 -> Biological process: GO:0032210 [regulation of telomere maintenance via telomerase] evidence: IC
            GeneID:8658 -> Biological process: GO:0032212 [positive regulation of telomere maintenance via telomerase] evidence: IDA
            GeneID:8658 -> Biological process: GO:0032212 [positive regulation of telomere maintenance via telomerase] evidence: IMP
            GeneID:8658 -> Biological process: GO:0043392 [negative regulation of DNA binding] evidence: IDA
            GeneID:8658 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:8658 -> Biological process: GO:0051028 [mRNA transport] evidence: IEA
            GeneID:8658 -> Biological process: GO:0051225 [spindle assembly] evidence: TAS
            GeneID:8658 -> Biological process: GO:0051301 [cell division] evidence: IEA
            GeneID:8658 -> Biological process: GO:0070198 [protein localization to chromosome, telomeric region] evidence: IMP
            GeneID:8658 -> Biological process: GO:0070212 [protein poly-ADP-ribosylation] evidence: IDA
            GeneID:8658 -> Biological process: GO:0070213 [protein auto-ADP-ribosylation] evidence: IDA
            GeneID:8658 -> Biological process: GO:0090263 [positive regulation of canonical Wnt receptor signaling pathway] evidence: IMP
            GeneID:8658 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA
            GeneID:8658 -> Cellular component: GO:0000242 [pericentriolar material] evidence: TAS
            GeneID:8658 -> Cellular component: GO:0000775 [chromosome, centromeric region] evidence: IEA
            GeneID:8658 -> Cellular component: GO:0000781 [chromosome, telomeric region] evidence: IDA
            GeneID:8658 -> Cellular component: GO:0000784 [nuclear chromosome, telomeric region] evidence: IDA
            GeneID:8658 -> Cellular component: GO:0000922 [spindle pole] evidence: IEA
            GeneID:8658 -> Cellular component: GO:0005643 [nuclear pore] evidence: TAS
            GeneID:8658 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
            GeneID:8658 -> Cellular component: GO:0031965 [nuclear membrane] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_003738 -> EC 2.4.2.30

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.