2024-04-20 12:10:24, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003585 2026 bp mRNA linear PRI 20-JUN-2013 DEFINITION Homo sapiens double C2-like domains, beta (DOC2B), mRNA. ACCESSION NM_003585 VERSION NM_003585.4 GI:513788267 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2026) AUTHORS Yao,J., Gaffaney,J.D., Kwon,S.E. and Chapman,E.R. TITLE Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter release JOURNAL Cell 147 (3), 666-677 (2011) PUBMED 22036572 REMARK GeneRIF: Study analyzed Doc2alpha and Doc2beta and found that Doc2 responds to changes in [Ca2+], with markedly slower kinetics as compared to the cytosolic domain of syt I (syt), and operates on a timescale consistent with asynchronous neurotransmitter release. REFERENCE 2 (bases 1 to 2026) AUTHORS Troyer,J.L., Nelson,G.W., Lautenberger,J.A., Chinn,L., McIntosh,C., Johnson,R.C., Sezgin,E., Kessing,B., Malasky,M., Hendrickson,S.L., Li,G., Pontius,J., Tang,M., An,P., Winkler,C.A., Limou,S., Le Clerc,S., Delaneau,O., Zagury,J.F., Schuitemaker,H., van Manen,D., Bream,J.H., Gomperts,E.D., Buchbinder,S., Goedert,J.J., Kirk,G.D. and O'Brien,S.J. TITLE Genome-wide association study implicates PARD3B-based AIDS restriction JOURNAL J. Infect. Dis. 203 (10), 1491-1502 (2011) PUBMED 21502085 REFERENCE 3 (bases 1 to 2026) AUTHORS Cardoso,C., Leventer,R.J., Ward,H.L., Toyo-Oka,K., Chung,J., Gross,A., Martin,C.L., Allanson,J., Pilz,D.T., Olney,A.H., Mutchinick,O.M., Hirotsune,S., Wynshaw-Boris,A., Dobyns,W.B. and Ledbetter,D.H. TITLE Refinement of a 400-kb critical region allows genotypic differentiation between isolated lissencephaly, Miller-Dieker syndrome, and other phenotypes secondary to deletions of 17p13.3 JOURNAL Am. J. Hum. Genet. 72 (4), 918-930 (2003) PUBMED 12621583 REFERENCE 4 (bases 1 to 2026) AUTHORS Duncan,R.R., Betz,A., Shipston,M.J., Brose,N. and Chow,R.H. TITLE Transient, phorbol ester-induced DOC2-Munc13 interactions in vivo JOURNAL J. Biol. Chem. 274 (39), 27347-27350 (1999) PUBMED 10488064 REMARK Erratum:[J Biol Chem 2000 Jan 21;275(3):2246] REFERENCE 5 (bases 1 to 2026) AUTHORS Nagano,F., Orita,S., Sasaki,T., Naito,A., Sakaguchi,G., Maeda,M., Watanabe,T., Kominami,E., Uchiyama,Y. and Takai,Y. TITLE Interaction of Doc2 with tctex-1, a light chain of cytoplasmic dynein. Implication in dynein-dependent vesicle transport JOURNAL J. Biol. Chem. 273 (46), 30065-30068 (1998) PUBMED 9804756 REFERENCE 6 (bases 1 to 2026) AUTHORS Orita,S., Naito,A., Sakaguchi,G., Maeda,M., Igarashi,H., Sasaki,T. and Takai,Y. TITLE Physical and functional interactions of Doc2 and Munc13 in Ca2+-dependent exocytotic machinery JOURNAL J. Biol. Chem. 272 (26), 16081-16084 (1997) PUBMED 9195900 REFERENCE 7 (bases 1 to 2026) AUTHORS Verhage,M., de Vries,K.J., Roshol,H., Burbach,J.P., Gispen,W.H. and Sudhof,T.C. TITLE DOC2 proteins in rat brain: complementary distribution and proposed function as vesicular adapter proteins in early stages of secretion JOURNAL Neuron 18 (3), 453-461 (1997) PUBMED 9115738 REFERENCE 8 (bases 1 to 2026) AUTHORS Kojima,T., Fukuda,M., Aruga,J. and Mikoshiba,K. TITLE Calcium-dependent phospholipid binding to the C2A domain of a ubiquitous form of double C2 protein (Doc2 beta) JOURNAL J. Biochem. 120 (3), 671-676 (1996) PUBMED 8902635 REFERENCE 9 (bases 1 to 2026) AUTHORS Sakaguchi,G., Orita,S., Maeda,M., Igarashi,H. and Takai,Y. TITLE Molecular cloning of an isoform of Doc2 having two C2-like domains JOURNAL Biochem. Biophys. Res. Commun. 217 (3), 1053-1061 (1995) PUBMED 8554557 REFERENCE 10 (bases 1 to 2026) AUTHORS Orita,S., Sasaki,T., Naito,A., Komuro,R., Ohtsuka,T., Maeda,M., Suzuki,H., Igarashi,H. and Takai,Y. TITLE Doc2: a novel brain protein having two repeated C2-like domains JOURNAL Biochem. Biophys. Res. Commun. 206 (2), 439-448 (1995) PUBMED 7826360 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from D70830.1 and AI478508.1. On Jun 20, 2013 this sequence version replaced gi:295054131. Summary: There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2B is expressed ubiquitously and is suggested to be involved in Ca(2+)-dependent intracellular vesicle trafficking in various types of cells. [provided by RefSeq, Jul 2008]. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-890 D70830.1 10-899 891-896 AI478508.1 409-414 897-1702 D70830.1 906-1711 1703-2023 D70830.1 1713-2033 2024-2026 D70830.1 2037-2039 FEATURES Location/Qualifiers source 1..2026 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="17" /map="17p13.3" gene 1..2026 /gene="DOC2B" /gene_synonym="DOC2BL" /note="double C2-like domains, beta" /db_xref="GeneID:8447" /db_xref="HGNC:2986" /db_xref="MIM:604568" exon 1..524 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" misc_feature 86..88 /gene="DOC2B" /gene_synonym="DOC2BL" /note="upstream in-frame stop codon" STS 102..1440 /gene="DOC2B" /gene_synonym="DOC2BL" /db_xref="UniSTS:481194" CDS 152..1390 /gene="DOC2B" /gene_synonym="DOC2BL" /note="doc2-beta" /codon_start=1 /product="double C2-like domain-containing protein beta" /protein_id="NP_003576.2" /db_xref="GI:295054132" /db_xref="GeneID:8447" /db_xref="HGNC:2986" /db_xref="MIM:604568" /translation="
MTLRRRGEKATISIQEHMAIDVCPGPIRPIKQISDYFPRFPRGLPPDAGPRAAAPPDAPARPAVAGAGRRSPSDGAREDDEDVDQLFGAYGSSPGPSPGPSPARPPAKPPEDEPDADGYESDDCTALGTLDFSLLYDQENNALHCTITKAKGLKPMDHNGLADPYVKLHLLPGASKANKLRTKTLRNTLNPTWNETLTYYGITDEDMIRKTLRISVCDEDKFRHNEFIGETRVPLKKLKPNHTKTFSICLEKQLPVDKTEDKSLEERGRILISLKYSSQKQGLLVGIVRCAHLAAMDANGYSDPYVKTYLRPDVDKKSKHKTAVKKKTLNPEFNEEFCYEIKHGDLAKKSLEVTVWDYDIGKSNDFIGGVVLGIHAKGERLKHWFDCLKNKDKRIERWHTLTSELPGAVLSD
" misc_feature 152..421 /gene="DOC2B" /gene_synonym="DOC2BL" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14184.1); Region: Mediates interaction with DYNLT1" misc_feature 152..259 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14184.1); Region: Negatively regulates targeting to plasma membrane (By similarity)" misc_feature 530..901 /gene="DOC2B" /gene_synonym="DOC2BL" /note="C2 domain first repeat present in Rabphilin and Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035" /db_xref="CDD:176000" misc_feature order(620..622,638..640,803..805,809..811,827..829) /gene="DOC2B" /gene_synonym="DOC2BL" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176000" misc_feature 920..1276 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q14184.1); Region: Mediates interaction with STXBP3 (By similarity)" misc_feature 956..1354 /gene="DOC2B" /gene_synonym="DOC2BL" /note="C2 domain second repeat present in Rabphilin and Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384" /db_xref="CDD:176030" misc_feature order(1040..1042,1058..1060,1220..1222,1226..1228, 1244..1246) /gene="DOC2B" /gene_synonym="DOC2BL" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176030" exon 525..604 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" exon 605..679 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" exon 680..789 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" exon 790..916 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" exon 917..1074 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" exon 1075..1156 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" exon 1157..1253 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" exon 1254..2026 /gene="DOC2B" /gene_synonym="DOC2BL" /inference="alignment:Splign:1.39.8" STS 1401..1649 /gene="DOC2B" /gene_synonym="DOC2BL" /standard_name="RH80768" /db_xref="UniSTS:87013" STS 1679..1873 /gene="DOC2B" /gene_synonym="DOC2BL" /standard_name="STS-D70830" /db_xref="UniSTS:73663" ORIGIN
gcggagcgggcagcggccaagtcagggccgtccgggggcgcggccggcgatgcccgcagcccccgccgcgccccgccgggcctgctgagccgcccccgggccggggtcgcgccgggccgggccgcgcccggggcggggcggcgctgcctgcatgaccctccggcggcgcggggagaaggcgaccatcagcatccaggagcatatggccatcgacgtgtgccccggccccatccgtcccatcaagcagatctccgactacttcccccgcttcccgcggggcctgcccccggacgccgggccccgagccgctgcacccccggacgcccccgcgcgcccggctgtggccggtgccggccgccgcagcccctccgacggcgcccgcgaggacgacgaggatgtggaccagctcttcggagcctacggctccagcccgggccccagcccgggtcccagccccgcgcggccgccagccaagccgccggaggacgagccggacgccgacggctacgagtcggacgactgcactgccctgggcacgctggacttcagcctgctgtatgaccaggagaacaacgccctccactgcaccatcaccaaggccaagggcctgaagccaatggaccacaatgggctggcagacccctacgtcaagctgcacctgctgccaggagccagtaaggcaaataagctcagaacaaaaactctccgtaacactctgaaccccacatggaacgagaccctcacttactacgggatcacagatgaagacatgatccgcaagaccctgcggatctctgtgtgtgacgaggacaaattccggcacaatgagttcatcggggagacacgtgtgcccctgaagaagctgaaacccaaccacaccaagaccttcagcatctgcctggagaagcagctgccggtggacaagactgaagacaagtccctggaggagcggggccgcatcctcatctccctcaagtacagctcacagaagcaaggcctgctggtaggcatcgtgcggtgcgcccacctggccgccatggacgccaacggctactcggacccctacgtgaaaacatacctgaggccagatgtggacaagaaatccaaacataagacagcggtgaagaaaaaaaccctgaacccggagtttaatgaggagttctgttacgagatcaagcatggggacctggccaagaagtccctggaggtcaccgtttgggattacgacattggaaaatccaacgatttcattggtggtgtggttctgggcatccacgccaagggggagcgcctgaagcactggtttgactgcctgaagaacaaggacaagcgcatcgagcgctggcacacgctcaccagcgagctcccaggggctgtgctcagcgactgacgcccacccgccactgctacccctgccgccacctgcgcccagcacggccggccccgggcttccccagcagccaccaaggcctgtggcccccacactgggggagatccagaacccctgcttggacacagagccactgcagtccccgctcggaggatgtggagggctcagccactctgggacggggagggcaaggagctggggtggggggctctcagctctctggggcccaagaggccggtggtggaaagagacctcagcacctgcccaggggaaggggacacgcccatctgggagcaaagacccttctagaggccagccccggctgagaggacaggagtgtgggggcgccttggcggacagtgggaacagaggagggaggtggtgagcagacagacaggtggaggatgggaccttgaagactggctgctccagcccaagaaagcctaactgcatccctcatctccttcgctgctggacagatggaagaagcgggcctgccggccgaaagtctgccagagttcccggaggctcctgatgatgggtaaattggcacatgcttcactcaatgattccacaagccctgggggtgaatgagacacagggcctgccctcagggagttcccatctagtcaggaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:8447 -> Molecular function: GO:0005215 [transporter activity] evidence: IEA GeneID:8447 -> Molecular function: GO:0005544 [calcium-dependent phospholipid binding] evidence: ISS GeneID:8447 -> Molecular function: GO:0019905 [syntaxin binding] evidence: IEA GeneID:8447 -> Biological process: GO:0008104 [protein localization] evidence: ISS GeneID:8447 -> Biological process: GO:0031340 [positive regulation of vesicle fusion] evidence: ISS GeneID:8447 -> Biological process: GO:0032024 [positive regulation of insulin secretion] evidence: ISS GeneID:8447 -> Biological process: GO:0045956 [positive regulation of calcium ion-dependent exocytosis] evidence: ISS GeneID:8447 -> Biological process: GO:0048791 [calcium ion-dependent exocytosis of neurotransmitter] evidence: ISS GeneID:8447 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS GeneID:8447 -> Cellular component: GO:0005886 [plasma membrane] evidence: ISS GeneID:8447 -> Cellular component: GO:0008021 [synaptic vesicle] evidence: IEA GeneID:8447 -> Cellular component: GO:0015630 [microtubule cytoskeleton] evidence: IDA GeneID:8447 -> Cellular component: GO:0031201 [SNARE complex] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.