GGRNA Home | Help | Advanced search

2024-04-27 03:36:17, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_003460               2266 bp    mRNA    linear   PRI 29-APR-2013
DEFINITION  Homo sapiens zona pellucida glycoprotein 2 (sperm receptor) (ZP2),
            mRNA.
ACCESSION   NM_003460
VERSION     NM_003460.1  GI:4508044
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2266)
  AUTHORS   Margalit,M., Paz,G., Yavetz,H., Yogev,L., Amit,A.,
            Hevlin-Schwartz,T., Gupta,S.K. and Kleiman,S.E.
  TITLE     Genetic and physiological study of morphologically abnormal human
            zona pellucida
  JOURNAL   Eur. J. Obstet. Gynecol. Reprod. Biol. 165 (1), 70-76 (2012)
   PUBMED   22889493
  REMARK    GeneRIF: observed sequence variations in exons of ZP2 gene in women
            with infertility of unknown origin who exhibit abnormal zona
            pellucida; sperm-ovum interactions appear relatively normal in
            these patients [CASE REPORTS]
REFERENCE   2  (bases 1 to 2266)
  AUTHORS   Gook,D.A., Edgar,D.H., Borg,J. and Martic,M.
  TITLE     Detection of zona pellucida proteins during human folliculogenesis
  JOURNAL   Hum. Reprod. 23 (2), 394-402 (2008)
   PUBMED   18033806
  REMARK    GeneRIF: ZP proteins were detected in both the oocyte and the
            granulosa cells as early as the primordial follicle stage in the
            human. The detection of ZP proteins in the quiescent primordial
            follicle suggests that these proteins have been present since
            oogenesis.
REFERENCE   3  (bases 1 to 2266)
  AUTHORS   Wu,C., Ma,M.H., Brown,K.R., Geisler,M., Li,L., Tzeng,E., Jia,C.Y.,
            Jurisica,I. and Li,S.S.
  TITLE     Systematic identification of SH3 domain-mediated human
            protein-protein interactions by peptide array target screening
  JOURNAL   Proteomics 7 (11), 1775-1785 (2007)
   PUBMED   17474147
REFERENCE   4  (bases 1 to 2266)
  AUTHORS   Caballero-Campo,P., Chirinos,M., Fan,X.J., Gonzalez-Gonzalez,M.E.,
            Galicia-Chavarria,M., Larrea,F. and Gerton,G.L.
  TITLE     Biological effects of recombinant human zona pellucida proteins on
            sperm function
  JOURNAL   Biol. Reprod. 74 (4), 760-768 (2006)
   PUBMED   16407501
  REMARK    GeneRIF: Exposure of sperm to ZP proteins promoted acrosomal
            exocytosis and changed motility patterns.
REFERENCE   5  (bases 1 to 2266)
  AUTHORS   Furlong,L.I., Harris,J.D. and Vazquez-Levin,M.H.
  TITLE     Binding of recombinant human proacrosin/acrosin to zona pellucida
            (ZP) glycoproteins. I. Studies with recombinant human ZPA, ZPB, and
            ZPC
  JOURNAL   Fertil. Steril. 83 (6), 1780-1790 (2005)
   PUBMED   15950651
  REMARK    GeneRIF: Of all zona pellucida (ZP) proteins, recombinant human ZPA
            demonstrates the highest binding activity toward acrosin
REFERENCE   6  (bases 1 to 2266)
  AUTHORS   Mori,T., Guo,M.W., Sato,E., Baba,T., Takasaki,S. and Mori,E.
  TITLE     Molecular and immunological approaches to mammalian fertilization
  JOURNAL   J. Reprod. Immunol. 47 (2), 139-158 (2000)
   PUBMED   10924747
  REMARK    Review article
REFERENCE   7  (bases 1 to 2266)
  AUTHORS   Rankin,T. and Dean,J.
  TITLE     The zona pellucida: using molecular genetics to study the mammalian
            egg coat
  JOURNAL   Rev. Reprod. 5 (2), 114-121 (2000)
   PUBMED   10864856
  REMARK    Review article
REFERENCE   8  (bases 1 to 2266)
  AUTHORS   Tsubamoto,H., Hasegawa,A., Nakata,Y., Naito,S., Yamasaki,N. and
            Koyama,K.
  TITLE     Expression of recombinant human zona pellucida protein 2 and its
            binding capacity to spermatozoa
  JOURNAL   Biol. Reprod. 61 (6), 1649-1654 (1999)
   PUBMED   10570015
REFERENCE   9  (bases 1 to 2266)
  AUTHORS   Loftus,B.J., Kim,U.J., Sneddon,V.P., Kalush,F., Brandon,R.,
            Fuhrmann,J., Mason,T., Crosby,M.L., Barnstead,M., Cronin,L.,
            Deslattes Mays,A., Cao,Y., Xu,R.X., Kang,H.L., Mitchell,S.,
            Eichler,E.E., Harris,P.C., Venter,J.C. and Adams,M.D.
  TITLE     Genome duplications and other features in 12 Mb of DNA sequence
            from human chromosome 16p and 16q
  JOURNAL   Genomics 60 (3), 295-308 (1999)
   PUBMED   10493829
REFERENCE   10 (bases 1 to 2266)
  AUTHORS   Liang,L.F. and Dean,J.
  TITLE     Conservation of mammalian secondary sperm receptor genes enables
            the promoter of the human gene to function in mouse oocytes
  JOURNAL   Dev. Biol. 156 (2), 399-408 (1993)
   PUBMED   8385033
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from M90366.1.
            
            Summary: The zona pellucida is an extracellular matrix that
            surrounds the oocyte and early embryo. It is composed primarily of
            three or four glycoproteins with various functions during
            fertilization and preimplantation development. The protein encoded
            by this gene is a structural component of the zona pellucida and
            functions in secondary binding and penetration of acrosome-reacted
            spermatozoa. The nascent protein contains a N-terminal signal
            peptide sequence, a conserved ZP domain, a consensus furin cleavage
            site, and a C-terminal transmembrane domain. It is hypothesized
            that furin cleavage results in release of the mature protein from
            the plasma membrane for subsequent incorporation into the zona
            pellucida matrix. However, the requirement for furin cleavage in
            this process remains controversial based on mouse studies.
            [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC096304.3, M90366.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..2266
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="16"
                     /map="16p12"
     gene            1..2266
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /note="zona pellucida glycoprotein 2 (sperm receptor)"
                     /db_xref="GeneID:7783"
                     /db_xref="HGNC:13188"
                     /db_xref="HPRD:01689"
                     /db_xref="MIM:182888"
     CDS             1..2238
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /note="zona pellucida protein A; zona pellucida
                     sperm-binding protein 2; zona pellucida glycoprotein ZP2"
                     /codon_start=1
                     /product="zona pellucida sperm-binding protein 2
                     preproprotein"
                     /protein_id="NP_003451.1"
                     /db_xref="GI:4508045"
                     /db_xref="CCDS:CCDS10596.1"
                     /db_xref="GeneID:7783"
                     /db_xref="HGNC:13188"
                     /db_xref="HPRD:01689"
                     /db_xref="MIM:182888"
                     /translation="
MACRQRGGSWSPSGWFNAGWSTYRSISLFFALVTSGNSIDVSQLVNPAFPGTVTCDEREITVEFPSSPGTKKWHASVVDPLGLDMPNCTYILDPEKLTLRATYDNCTRRVHGGHQMTIRVMNNSAALRHGAVMYQFFCPAMQVEETQGLSASTICQKDFMSFSLPRVFSGLADDSKGTKVQMGWSIEVGDGARAKTLTLPEAMKEGFSLLIDNHRMTFHVPFNATGVTHYVQGNSHLYMVSLKLTFISPGQKVIFSSQAICAPDPVTCNATHMTLTIPEFPGKLKSVSFENQNIDVSQLHDNGIDLEATNGMKLHFSKTLLKTKLSEKCLLHQFYLASLKLTFLLRPETVSMVIYPECLCESPVSIVTGELCTQDGFMDVEVYSYQTQPALDLGTLRVGNSSCQPVFEAQSQGLVRFHIPLNGCGTRYKFEDDKVVYENEIHALWTDFPPSKISRDSEFRMTVKCSYSRNDMLLNINVESLTPPVASVKLGPFTLILQSYPDNSYQQPYGENEYPLVRFLRQPIYMEVRVLNRDDPNIKLVLDDCWATSTMDPDSFPQWNVVVDGCAYDLDNYQTTFHPVGSSVTHPDHYQRFDMKAFAFVSEAHVLSSLVYFHCSALICNRLSPDSPLCSVTCPVSSRHRRATGATEAEKMTVSLPGPILLLSDDSSFRGVGSSDLKASGSSGEKSRSETGEEVGSRGAMDTKGHKTAGDVGSKAVAAVAAFAGVVATLGFIYYLYEKRTVSNH
"
     sig_peptide     1..114
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
     proprotein      115..2235
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /product="zona pellucida sperm-binding protein 2
                     proprotein"
     mat_peptide     115..1926
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /product="zona pellucida sperm-binding protein 2"
     misc_feature    514..519
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Cleavage (By similarity); propagated from
                     UniProtKB/Swiss-Prot (Q05996.1); cleavage site"
     misc_feature    517..519
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="proteolytic cleavage site; modified site"
     misc_feature    1114..1911
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /note="Zona pellucida (ZP) domain; Region: ZP; smart00241"
                     /db_xref="CDD:197598"
     misc_feature    2149..2208
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q05996.1);
                     transmembrane region"
     exon            1..62
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(6)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147698708"
     variation       complement(8)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377432051"
     STS             11..102
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /standard_name="G67892"
                     /db_xref="UniSTS:225614"
     variation       complement(13)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202135737"
     variation       complement(26)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377677791"
     variation       complement(53)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373646750"
     exon            63..151
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(66)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113112059"
     variation       complement(74)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188803389"
     variation       complement(107)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2075520"
     misc_feature    115..2235
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /note="zona pellucida glycoprotein 2 proprotein"
     variation       complement(140)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199927753"
     exon            152..235
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(165)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200172756"
     variation       complement(209)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370244702"
     variation       complement(218)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76073950"
     variation       complement(221)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367878569"
     variation       complement(222)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145538948"
     variation       complement(231)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139990782"
     exon            236..330
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(250)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369985819"
     variation       complement(258)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150656642"
     variation       complement(288)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141953642"
     variation       complement(300)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137922116"
     variation       complement(313)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376162002"
     exon            331..483
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(397)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200788515"
     variation       complement(437)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202010660"
     variation       complement(452)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376224677"
     variation       complement(460)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145329860"
     variation       complement(474)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:190651334"
     variation       complement(476)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141680915"
     exon            484..528
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(495)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35162028"
     variation       complement(496)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143028903"
     variation       complement(507)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376332681"
     variation       complement(519)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16971234"
     exon            529..693
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(543)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369507532"
     variation       complement(557)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375240682"
     variation       complement(632)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369378515"
     variation       complement(652)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145104390"
     variation       complement(656)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150342177"
     variation       complement(668)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141308223"
     exon            694..790
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(704)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372866511"
     variation       complement(712)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200100492"
     variation       complement(747)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2075526"
     variation       complement(775)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145441777"
     exon            791..972
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(845)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369091148"
     variation       complement(921)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113774442"
     variation       complement(929)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200654965"
     variation       complement(942)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373386450"
     exon            973..1099
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1002)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368441627"
     variation       complement(1037)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202065210"
     variation       complement(1048)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375882969"
     variation       complement(1089)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140032829"
     variation       complement(1090)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151236566"
     variation       complement(1097)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142277591"
     exon            1100..1287
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1122)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200645879"
     variation       complement(1137)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182866863"
     variation       complement(1140)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148788115"
     variation       complement(1151)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144403520"
     variation       complement(1224)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143091073"
     variation       complement(1235)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376331838"
     variation       complement(1243)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139683036"
     variation       complement(1255)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373653232"
     exon            1288..1379
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1306)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146378217"
     variation       complement(1317)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141585544"
     variation       complement(1337)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190038226"
     variation       complement(1338)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143012218"
     variation       complement(1341)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186370257"
     variation       complement(1342)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149014575"
     exon            1380..1504
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1385)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374388107"
     variation       complement(1398)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150078092"
     variation       complement(1407)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368803645"
     variation       complement(1430)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201054139"
     variation       complement(1462)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141639876"
     variation       complement(1477)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147988348"
     exon            1505..1694
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1511)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202104941"
     variation       complement(1529)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80015211"
     variation       complement(1536)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116035262"
     variation       complement(1546)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141482461"
     variation       complement(1554)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201385807"
     variation       complement(1555)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147824024"
     variation       complement(1576)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202174621"
     variation       complement(1586)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370008514"
     variation       complement(1588)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142537047"
     variation       complement(1592)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199896192"
     variation       complement(1593)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147707945"
     variation       complement(1641)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141607027"
     variation       complement(1658)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145769990"
     variation       complement(1680)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367625701"
     variation       complement(1687)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149764747"
     exon            1695..1830
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1702)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373582627"
     variation       complement(1741)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140925075"
     variation       complement(1756)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149277141"
     variation       complement(1816)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369511398"
     exon            1831..1927
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1865)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369576343"
     variation       complement(1871)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144503112"
     variation       complement(1880)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376154774"
     variation       complement(1898)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371254101"
     exon            1928..2011
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2000)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139759688"
     exon            2012..2095
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2016)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376462791"
     variation       complement(2017)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200912750"
     variation       complement(2027)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199787774"
     variation       complement(2042)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369785011"
     STS             2060..2190
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /standard_name="RH71391"
                     /db_xref="UniSTS:56457"
     variation       complement(2077..2078)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:139710200"
     variation       complement(2083)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375244239"
     variation       complement(2093)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190164659"
     exon            2096..2266
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(2102)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148629948"
     variation       complement(2104)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199978300"
     variation       complement(2132)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143939599"
     variation       complement(2146)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34159042"
     variation       complement(2179)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373110346"
     variation       complement(2183)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369803855"
     variation       complement(2211)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137896779"
     variation       complement(2228)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111820849"
     polyA_signal    2249..2255
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /experiment="experimental evidence, no additional details
                     recorded"
     polyA_site      2266
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /experiment="experimental evidence, no additional details
                     recorded"
     variation       complement(2266)
                     /gene="ZP2"
                     /gene_synonym="Zp-2; ZPA"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376654783"
ORIGIN      
atggcgtgcaggcagagaggaggctcttggagtccctcaggctggttcaatgcaggctggagcacctacaggtcgatttctctcttcttcgcccttgtgacttcagggaactccatagatgtttctcagttggtaaatcctgcctttccaggcactgtcacttgcgatgaaagggaaataacagtggagttcccaagcagtcctggcaccaagaaatggcatgcatctgtggtggatcctcttggtctcgacatgccgaactgcacttacatcctggacccagaaaagctcaccctgagggctacctatgataactgtaccaggagagtgcatggtggacaccagatgaccatcagagtcatgaacaacagtgctgccttaagacacggagctgtcatgtatcagttcttctgtccagctatgcaagtagaagagacccaggggctttcagcatctacaatctgccagaaggatttcatgtctttttccttgccacgggtcttctctggcttggctgacgacagtaaggggaccaaagttcagatgggatggagcattgaggttggtgatggtgcaagagccaaaactctgaccctgccagaggccatgaaggaaggcttcagcctcttgattgacaaccacaggatgaccttccatgtgccattcaatgccactggagtgactcactatgtgcaaggtaacagtcatctctacatggtgtctctgaagcttacatttatatctcctggacagaaggtgatcttctcttcacaagctatttgtgcaccagatcctgtgacctgcaatgccacacacatgactctcaccataccagagtttcctgggaagcttaagtctgtgagctttgaaaaccagaacattgatgtgagccagctgcatgacaatggaattgatctagaagcaacaaatggcatgaaattgcatttcagcaaaactctgctcaaaacgaaattatctgaaaaatgcctactccatcagttctacttagcttcactcaagctgacctttctccttcggccagagacagtatccatggtgatctatcctgagtgtctctgtgagtcacccgtttctatagttacaggggagctgtgcacccaggatgggtttatggacgtcgaggtctacagctaccaaacacaaccagctcttgacctgggtactctgagggtgggaaactcatcctgccagcctgtctttgaggctcagtctcaggggctggtacggttccacatacccctgaatggatgtggaacgagatataagttcgaagatgataaagtcgtctatgaaaacgaaatacatgctctctggacggattttcctccaagcaaaatatctagagacagtgagttcagaatgacagtgaagtgttcttatagcaggaatgacatgctactaaacatcaacgttgaaagccttactcctccagtggcctcagtgaagttgggtccatttaccttgatcctgcaaagctacccagataattcctaccaacaaccttatggggaaaacgagtaccctctagtgagattcctccgccaaccaatttacatggaagtgagagtcctaaacagggatgaccccaacatcaagctggtcttagatgactgctgggcgacgtccaccatggatccagactctttcccccagtggaacgttgtcgtggatggctgtgcatatgacctggacaactaccagaccaccttccatccagtcggctcctctgtgacccatcctgatcactatcagaggtttgacatgaaggcttttgcctttgtatcagaagcccacgtgctctctagcctggtctacttccactgcagtgccttaatctgtaatcgactctcccctgactccccactgtgttctgtgacctgccctgtgtcctctaggcacaggcgagccacaggggccactgaagcagagaaaatgacagtcagcctcccaggacccattctcctgttgtcagatgactcctcattcagaggtgtcggctcatctgatctaaaagcaagtgggagcagtggggagaagagtaggagtgaaacaggggaggaggttggctcacgaggtgctatggacaccaaagggcacaagactgctggagatgttggttccaaagctgtggctgctgtggctgcctttgcaggtgtggtggcaactctaggcttcatctactacctgtacgagaaaaggactgtgtcaaatcactaaatgggcttctaaataaagcagtcaaaat
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:7783 -> Molecular function: GO:0015026 [coreceptor activity] evidence: TAS
            GeneID:7783 -> Molecular function: GO:0032190 [acrosin binding] evidence: IPI
            GeneID:7783 -> Biological process: GO:0006828 [manganese ion transport] evidence: ISS
            GeneID:7783 -> Biological process: GO:0006886 [intracellular protein transport] evidence: ISS
            GeneID:7783 -> Biological process: GO:0007338 [single fertilization] evidence: TAS
            GeneID:7783 -> Biological process: GO:0007339 [binding of sperm to zona pellucida] evidence: ISS
            GeneID:7783 -> Biological process: GO:0007339 [binding of sperm to zona pellucida] evidence: TAS
            GeneID:7783 -> Biological process: GO:0032504 [multicellular organism reproduction] evidence: TAS
            GeneID:7783 -> Biological process: GO:0060046 [regulation of acrosome reaction] evidence: IDA
            GeneID:7783 -> Biological process: GO:0060468 [prevention of polyspermy] evidence: ISS
            GeneID:7783 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:7783 -> Cellular component: GO:0005578 [proteinaceous extracellular matrix] evidence: IEA
            GeneID:7783 -> Cellular component: GO:0005771 [multivesicular body] evidence: ISS
            GeneID:7783 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: ISS
            GeneID:7783 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: ISS
            GeneID:7783 -> Cellular component: GO:0005886 [plasma membrane] evidence: ISS
            GeneID:7783 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
            GeneID:7783 -> Cellular component: GO:0030141 [secretory granule] evidence: ISS
            GeneID:7783 -> Cellular component: GO:0031012 [extracellular matrix] evidence: ISS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.