Home |
Help |
Advanced search
2024-04-20 15:38:12, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003098 2345 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens syntrophin, alpha 1 (SNTA1), mRNA.
ACCESSION NM_003098
VERSION NM_003098.2 GI:18765742
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2345)
AUTHORS Harisseh,R., Chatelier,A., Magaud,C., Deliot,N. and Constantin,B.
TITLE Involvement of TRPV2 and SOCE in calcium influx disorder in DMD
primary human myotubes with a specific contribution of
alpha1-syntrophin and PLC/PKC in SOCE regulation
JOURNAL Am. J. Physiol., Cell Physiol. 304 (9), C881-C894 (2013)
PUBMED 23426965
REMARK GeneRIF: Calcium homeostasis mishandling in Duchenne muscular
dystrophy myotubes depends on store operated calcium entry under
the influence alpha1-syntrophin regulation as well as
TRPV2-dependant cation influx.
REFERENCE 2 (bases 1 to 2345)
AUTHORS Hu,R.M., Tan,B.H., Orland,K.M., Valdivia,C.R., Peterson,A., Pu,J.
and Makielski,J.C.
TITLE Digenic inheritance novel mutations in SCN5a and SNTA1 increase
late I(Na) contributing to LQT syndrome
JOURNAL Am. J. Physiol. Heart Circ. Physiol. 304 (7), H994-H1001 (2013)
PUBMED 23376825
REMARK GeneRIF: The combined mutations of A261V-SNTA1 plus R800L-SCN5A
increase the INa current late/peak ratio and time constants of
current decay.
REFERENCE 3 (bases 1 to 2345)
AUTHORS Bhat,H.F., Baba,R.A., Bashir,M., Saeed,S., Kirmani,D., Wani,M.M.,
Wani,N.A., Wani,K.A. and Khanday,F.A.
TITLE Alpha-1-syntrophin protein is differentially expressed in human
cancers
JOURNAL Biomarkers 16 (1), 31-36 (2011)
PUBMED 21091386
REMARK GeneRIF: In contrast to stomach, lung, colon and rectal cancers,
SNTA1 protein was found to be downregulated in esophageal cancers
and upregulated in breast cancer.
REFERENCE 4 (bases 1 to 2345)
AUTHORS Lanciotti,A., Brignone,M.S., Camerini,S., Serafini,B., Macchia,G.,
Raggi,C., Molinari,P., Crescenzi,M., Musumeci,M., Sargiacomo,M.,
Aloisi,F., Petrucci,T.C. and Ambrosini,E.
TITLE MLC1 trafficking and membrane expression in astrocytes: role of
caveolin-1 and phosphorylation
JOURNAL Neurobiol. Dis. 37 (3), 581-595 (2010)
PUBMED 19931615
REFERENCE 5 (bases 1 to 2345)
AUTHORS Cheng,J., Van Norstrand,D.W., Medeiros-Domingo,A., Valdivia,C.,
Tan,B.H., Ye,B., Kroboth,S., Vatta,M., Tester,D.J., January,C.T.,
Makielski,J.C. and Ackerman,M.J.
TITLE Alpha1-syntrophin mutations identified in sudden infant death
syndrome cause an increase in late cardiac sodium current
JOURNAL Circ Arrhythm Electrophysiol 2 (6), 667-676 (2009)
PUBMED 20009079
REMARK GeneRIF: Alpha1-syntrophin mutations identified in sudden infant
death syndrome cause an increase in late cardiac sodium current.
GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 6 (bases 1 to 2345)
AUTHORS Iwata,Y., Pan,Y., Yoshida,T., Hanada,H. and Shigekawa,M.
TITLE Alpha1-syntrophin has distinct binding sites for actin and
calmodulin
JOURNAL FEBS Lett. 423 (2), 173-177 (1998)
PUBMED 9512352
REFERENCE 7 (bases 1 to 2345)
AUTHORS Gee,S.H., Madhavan,R., Levinson,S.R., Caldwell,J.H., Sealock,R. and
Froehner,S.C.
TITLE Interaction of muscle and brain sodium channels with multiple
members of the syntrophin family of dystrophin-associated proteins
JOURNAL J. Neurosci. 18 (1), 128-137 (1998)
PUBMED 9412493
REFERENCE 8 (bases 1 to 2345)
AUTHORS Castello,A., Brocheriou,V., Chafey,P., Kahn,A. and Gilgenkrantz,H.
TITLE Characterization of the dystrophin-syntrophin interaction using the
two-hybrid system in yeast
JOURNAL FEBS Lett. 383 (1-2), 124-128 (1996)
PUBMED 8612778
REFERENCE 9 (bases 1 to 2345)
AUTHORS Ahn,A.H., Freener,C.A., Gussoni,E., Yoshida,M., Ozawa,E. and
Kunkel,L.M.
TITLE The three human syntrophin genes are expressed in diverse tissues,
have distinct chromosomal locations, and each bind to dystrophin
and its relatives
JOURNAL J. Biol. Chem. 271 (5), 2724-2730 (1996)
PUBMED 8576247
REFERENCE 10 (bases 1 to 2345)
AUTHORS Yang,B., Jung,D., Rafael,J.A., Chamberlain,J.S. and Campbell,K.P.
TITLE Identification of alpha-syntrophin binding to syntrophin triplet,
dystrophin, and utrophin
JOURNAL J. Biol. Chem. 270 (10), 4975-4978 (1995)
PUBMED 7890602
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from U40571.1 and AU118614.1.
This sequence is a reference standard in the RefSeqGene project.
On Feb 19, 2002 this sequence version replaced gi:4507136.
Summary: Syntrophins are cytoplasmic peripheral membrane scaffold
proteins that are components of the dystrophin-associated protein
complex. This gene is a member of the syntrophin gene family and
encodes the most common syntrophin isoform found in cardiac
tissues. The N-terminal PDZ domain of this syntrophin protein
interacts with the C-terminus of the pore-forming alpha subunit
(SCN5A) of the cardiac sodium channel Nav1.5. This protein also
associates cardiac sodium channels with the nitric oxide
synthase-PMCA4b (plasma membrane Ca-ATPase subtype 4b) complex in
cardiomyocytes. This gene is a susceptibility locus for Long-QT
syndrome (LQT) - an inherited disorder associated with sudden
cardiac death from arrhythmia - and sudden infant death syndrome
(SIDS). This protein also associates with dystrophin and
dystrophin-related proteins at the neuromuscular junction and
alters intracellular calcium ion levels in muscle tissue. [provided
by RefSeq, Jan 2013].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC026215.2, U40571.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..2345
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="20"
/map="20q11.2"
gene 1..2345
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/note="syntrophin, alpha 1"
/db_xref="GeneID:6640"
/db_xref="HGNC:11167"
/db_xref="HPRD:03009"
/db_xref="MIM:601017"
exon 1..582
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="alignment:Splign:1.39.8"
misc_feature 117..119
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/note="upstream in-frame stop codon"
CDS 273..1790
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/note="pro-TGF-alpha cytoplasmic domain-interacting
protein 1; acidic alpha 1 syntrophin; syntrophin-1; 59 kDa
dystrophin-associated protein A1 acidic component 1;
syntrophin, alpha 1 (dystrophin-associated protein A1,
59kDa, acidic component)"
/codon_start=1
/product="alpha-1-syntrophin"
/protein_id="NP_003089.1"
/db_xref="GI:4507137"
/db_xref="CCDS:CCDS13220.1"
/db_xref="GeneID:6640"
/db_xref="HGNC:11167"
/db_xref="HPRD:03009"
/db_xref="MIM:601017"
/translation="
MASGRRAPRTGLLELRAGAGSGAGGERWQRVLLSLAEDVLTVSPADGDPGPEPGAPREQEPAQLNGAAEPGAGPPQLPEALLLQRRRVTVRKADAGGLGISIKGGRENKMPILISKIFKGLAADQTEALFVGDAILSVNGEDLSSATHDEAVQVLKKTGKEVVLEVKYMKDVSPYFKNSTGGTSVGWDSPPASPLQRQPSSPGPTPRNFSEAKHMSLKMAYVSKRCTPNDPEPRYLEICSADGQDTLFLRAKDEASARSWATAIQAQVNTLTPRVKDELQALLAATSTAGSQDIKQIGWLTEQLPSGGTAPTLALLTEKELLLYLSLPETREALSRPARTAPLIATRLVHSGPSKGSVPYDAELSFALRTGTRHGVDTHLFSVESPQELAAWTRQLVDGCHRAAEGVQEVSTACTWNGRPCSLSVHIDKGFTLWAAEPGAARAVLLRQPFEKLQMSSDDGASLLFLDFGGAEGEIQLDLHSCPKTIVFIIHSFLSAKVTRLGLLA
"
misc_feature 528..773
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/note="PDZ domain found in a variety of Eumetazoan
signaling molecules, often in tandem arrangements. May be
responsible for specific protein-protein interactions, as
most PDZ domains bind C-terminal polypeptides, and binding
to internal (non-C-terminal)...; Region: PDZ_signaling;
cd00992"
/db_xref="CDD:29049"
misc_feature order(561..572,576..578,723..728,735..740)
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/note="protein binding site [polypeptide binding]; other
site"
/db_xref="CDD:29049"
misc_feature 837..839
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13424.1); phosphorylation site"
misc_feature 837..839
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 849..851
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13424.1); phosphorylation site"
misc_feature 849..851
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03868"
misc_feature 873..875
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03868"
misc_feature 1161..1469
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/note="Pleckstrin homology-like domain; Region: PH-like;
cl00273"
/db_xref="CDD:206947"
misc_feature order(1161..1181,1215..1235,1242..1262,1311..1322,
1365..1379,1404..1418,1443..1469)
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/note="PH-like core; other site"
/db_xref="CDD:176275"
misc_feature 1719..1787
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q13424.1);
Region: Calmodulin-binding (By similarity)"
exon 583..768
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="alignment:Splign:1.39.8"
exon 769..973
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="alignment:Splign:1.39.8"
variation 827
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:34995247"
variation 949
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:34479952"
exon 974..1181
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="alignment:Splign:1.39.8"
variation 1100
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:35938843"
exon 1182..1312
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="alignment:Splign:1.39.8"
exon 1313..1509
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="alignment:Splign:1.39.8"
variation 1362
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046815"
exon 1510..1697
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="alignment:Splign:1.39.8"
exon 1698..2340
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/inference="alignment:Splign:1.39.8"
variation 1760
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:34901081"
variation 2072
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:3171370"
STS 2145..2297
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/standard_name="RH41835"
/db_xref="UniSTS:24593"
STS 2161..2307
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/standard_name="A006C20"
/db_xref="UniSTS:59624"
STS 2161..2307
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/standard_name="G32321"
/db_xref="UniSTS:116914"
STS 2181..2330
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/standard_name="D20S724"
/db_xref="UniSTS:53376"
variation 2243
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:3177492"
polyA_signal 2301..2306
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
polyA_site 2340
/gene="SNTA1"
/gene_synonym="dJ1187J4.5; LQT12; SNT1; TACIP1"
/experiment="experimental evidence, no additional details
recorded"
ORIGIN
cccttctgacccaccccgctaggtagtcccacacggcggccctcggctcccgggccccgccccggcctcctgcatttgcccgaggccccctccccagcactggccacaccccagggtagccccgcccccagagctcctcccccagcggccggggtagggtggcggctggcccagccgggcccccgctgccctctgccctgggcgcttggtcggagcgggctgggcaaagcgggacagggcgagcgcggcggcccgggggctcggaggcgaagatggcgtccggcaggcgcgccccgcgcaccgggctgctggagctgcgcgccggggcgggctcgggggccggcggcgagcgatggcagcgggtgctgctgagtctggcggaggacgtgctgaccgtgagccccgccgacggcgaccctggtcccgagcccggcgctccgcgggagcaggagcccgcgcagctcaacggcgccgcggagccgggcgccgggcccccgcagctgccagaggcgctactgctccagcggcgccgcgtgacggtgcgcaaggccgacgccggtgggctgggcatcagcatcaaaggcggccgggagaacaagatgcctattctcatttccaagatcttcaagggattggcagctgaccagacagaggccctttttgtgggggatgccatcctgtctgtgaatggggaagacttgtcctctgctacccatgatgaggcggtgcaggtcctcaagaagacaggcaaggaggtggtgctggaggtcaagtatatgaaggacgtctcaccgtatttcaagaactctactggtgggacctcggtcggctgggactcacctcctgcctcaccccttcagcggcagccttcctcccctggccccacaccccggaacttcagcgaggccaaacacatgtccttgaagatggcatatgtctcgaagaggtgcacccccaatgacccggagcccaggtatctggagatctgctcggcagatggtcaagacaccctcttcctgagggccaaggatgaggctagtgcgaggtcgtgggcgactgccatccaagcccaggtcaatactctgacgccgcgggtcaaggatgagctgcaggcactgttggcagccaccagcacagctgggagccaggacatcaagcagattggctggctaactgagcagctgcccagtgggggcacagcccccaccctggccctgctaactgaaaaggaactgctcctctacttgtctctccccgagacccgcgaggccctgagccggccagcccgtactgccccactcatcgccaccagactggtgcactcaggcccctccaagggctcagtgccctacgatgcagagctctcttttgccctgcgcacgggcacgcgtcacggtgtggacactcacctgttcagcgtggagtcaccgcaggagctggctgcctggacccgccagcttgtggatggctgtcaccgggccgccgagggtgtgcaggaggtgtctacagcctgcacgtggaatgggcgtccctgcagcctgtctgtgcacatcgacaagggcttcacactgtgggcggctgagccaggtgcagcccgagctgtgctcctgcgacagcccttcgagaagctgcagatgtcttcagatgacggtgccagtctccttttcctggattttggaggtgctgaaggcgagatccagctggacctgcactcgtgtcccaaaaccatagtcttcatcatccactccttcctgtcggccaaagtcacccgcctcgggctgttggcctagaagtcgccggatgcactagccctgaagaggggtgtccatgacatggcctgagctgggcctccaccgactgcctgctcacccctgggctgagggaagggagaggagaggaacaagggcctccgaaaccccaaccctgagggagactggattggtcttggggcccaggacccagacgcaggacagagtggactctgcctgtgatggggtggccttcctgctgcccccctccaccagtgccttttgcagagagatattttgtgtacacagaagccattccgagtctgggacctgcccctgtgcggatcctgaccccagccaacagctgagctgccgggcctcctcgaggcccctaagccacccccagaggtcccatctgaagctggagtaccctggggtcagcagcaagagaaagaagaggagattttctgtttgtttttcccctcagccctgccaccgtggggagtctggtttttctcttcatcctgtctctctcctccttactcttggataaataaacagcctgtgagcacacaggcagcccggcccagtgaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6640 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
GeneID:6640 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:6640 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IEA
GeneID:6640 -> Molecular function: GO:0005543 [phospholipid binding] evidence: IEA
GeneID:6640 -> Biological process: GO:0003117 [regulation of vasoconstriction by circulating norepinephrine] evidence: IEA
GeneID:6640 -> Biological process: GO:0006936 [muscle contraction] evidence: TAS
GeneID:6640 -> Biological process: GO:0007528 [neuromuscular junction development] evidence: IEA
GeneID:6640 -> Cellular component: GO:0005622 [intracellular] evidence: IDA
GeneID:6640 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:6640 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:6640 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
GeneID:6640 -> Cellular component: GO:0042383 [sarcolemma] evidence: IEA
GeneID:6640 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.