GGRNA Home | Help | Advanced search

2024-04-27 13:39:58, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_002953               3199 bp    mRNA    linear   PRI 16-JUN-2013
DEFINITION  Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 1
            (RPS6KA1), transcript variant 1, mRNA.
ACCESSION   NM_002953
VERSION     NM_002953.3  GI:56243479
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3199)
  AUTHORS   Zhang,X., Lavoie,G., Fort,L., Huttlin,E.L., Tcherkezian,J.,
            Galan,J.A., Gu,H., Gygi,S.P., Carreno,S. and Roux,P.P.
  TITLE     Gab2 phosphorylation by RSK inhibits Shp2 recruitment and cell
            motility
  JOURNAL   Mol. Cell. Biol. 33 (8), 1657-1670 (2013)
   PUBMED   23401857
  REMARK    GeneRIF: results indicate that RSK directly phosphorylates Gab2 on
            3 serine residues; findings show RSK-mediated Gab2 phosphorylation
            inhibits Shp2 recruitment, suggesting RSK mediates a
            negative-feedback loop that attenuates Gab2-dependent functions
            including cell motility
REFERENCE   2  (bases 1 to 3199)
  AUTHORS   Park,Y.S. and Cho,N.J.
  TITLE     EGFR and PKC are involved in the activation of ERK1/2 and p90 RSK
            and the subsequent proliferation of SNU-407 colon cancer cells by
            muscarinic acetylcholine receptors
  JOURNAL   Mol. Cell. Biochem. 370 (1-2), 191-198 (2012)
   PUBMED   22865467
  REMARK    GeneRIF: These data indicate that EGFR and PKC are involved in
            mAChR-mediated activation of ERK1/2 and RSK and the subsequent
            proliferation of SNU-407 colon cancer cells.
REFERENCE   3  (bases 1 to 3199)
  AUTHORS   Stratford,A.L., Reipas,K., Hu,K., Fotovati,A., Brough,R.,
            Frankum,J., Takhar,M., Watson,P., Ashworth,A., Lord,C.J.,
            Lasham,A., Print,C.G. and Dunn,S.E.
  TITLE     Targeting p90 ribosomal S6 kinase eliminates tumor-initiating cells
            by inactivating Y-box binding protein-1 in triple-negative breast
            cancers
  JOURNAL   Stem Cells 30 (7), 1338-1348 (2012)
   PUBMED   22674792
  REMARK    GeneRIF: Targeting p90 ribosomal S6 kinase eliminates
            tumor-initiating cells by inactivating Y-box binding protein-1 in
            triple-negative breast cancers.
REFERENCE   4  (bases 1 to 3199)
  AUTHORS   Li,D., Fu,T.M., Nan,J., Liu,C., Li,L.F. and Su,X.D.
  TITLE     Structural basis for the autoinhibition of the C-terminal kinase
            domain of human RSK1
  JOURNAL   Acta Crystallogr. D Biol. Crystallogr. 68 (PT 6), 680-685 (2012)
   PUBMED   22683790
  REMARK    GeneRIF: structure indicates that activation of RSK1 involves the
            removal of alpha-helix from the substrate-binding groove induced by
            ERK1/2 phosphorylation
REFERENCE   5  (bases 1 to 3199)
  AUTHORS   Li,R., Chen,D.F., Zhou,R., Jia,S.N., Yang,J.S., Clegg,J.S. and
            Yang,W.J.
  TITLE     Involvement of polo-like kinase 1 (Plk1) in mitotic arrest by
            inhibition of mitogen-activated protein kinase-extracellular
            signal-regulated kinase-ribosomal S6 kinase 1 (MEK-ERK-RSK1)
            cascade
  JOURNAL   J. Biol. Chem. 287 (19), 15923-15934 (2012)
   PUBMED   22427657
  REMARK    GeneRIF: Data indicate that Plk1 siRNA interference and
            overexpression increased phosphorylation of RSK1, suggesting that
            Plk1 inhibits RSK1.
REFERENCE   6  (bases 1 to 3199)
  AUTHORS   Moller,D.E., Xia,C.H., Tang,W., Zhu,A.X. and Jakubowski,M.
  TITLE     Human rsk isoforms: cloning and characterization of tissue-specific
            expression
  JOURNAL   Am. J. Physiol. 266 (2 PT 1), C351-C359 (1994)
   PUBMED   8141249
REFERENCE   7  (bases 1 to 3199)
  AUTHORS   Chen,R.H., Abate,C. and Blenis,J.
  TITLE     Phosphorylation of the c-Fos transrepression domain by
            mitogen-activated protein kinase and 90-kDa ribosomal S6 kinase
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 90 (23), 10952-10956 (1993)
   PUBMED   8248197
REFERENCE   8  (bases 1 to 3199)
  AUTHORS   Rivera,V.M., Miranti,C.K., Misra,R.P., Ginty,D.D., Chen,R.H.,
            Blenis,J. and Greenberg,M.E.
  TITLE     A growth factor-induced kinase phosphorylates the serum response
            factor at a site that regulates its DNA-binding activity
  JOURNAL   Mol. Cell. Biol. 13 (10), 6260-6273 (1993)
   PUBMED   8413226
REFERENCE   9  (bases 1 to 3199)
  AUTHORS   Tratner,I., Ofir,R. and Verma,I.M.
  TITLE     Alteration of a cyclic AMP-dependent protein kinase phosphorylation
            site in the c-Fos protein augments its transforming potential
  JOURNAL   Mol. Cell. Biol. 12 (3), 998-1006 (1992)
   PUBMED   1545828
REFERENCE   10 (bases 1 to 3199)
  AUTHORS   Chen,R.H., Sarnecki,C. and Blenis,J.
  TITLE     Nuclear localization and regulation of erk- and rsk-encoded protein
            kinases
  JOURNAL   Mol. Cell. Biol. 12 (3), 915-927 (1992)
   PUBMED   1545823
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BF982517.1, BC014966.1,
            BM836865.1, L07597.1 and AK092955.1.
            On Dec 3, 2004 this sequence version replaced gi:20149546.
            
            Summary: This gene encodes a member of the RSK (ribosomal S6
            kinase) family of serine/threonine kinases. This kinase contains 2
            nonidentical kinase catalytic domains and phosphorylates various
            substrates, including members of the mitogen-activated kinase
            (MAPK) signalling pathway. The activity of this protein has been
            implicated in controlling cell growth and differentiation.
            Alternate transcriptional splice variants, encoding different
            isoforms, have been characterized. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) represents the longer
            transcript but encodes the shorter isoform (a).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC014966.1, L07597.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-17                BF982517.1         19-35
            18-212              BC014966.1         11-205
            213-215             BM836865.1         202-204
            216-2412            BC014966.1         209-2405
            2413-2415           L07597.1           2296-2298
            2416-2767           BC014966.1         2409-2760
            2768-2770           L07597.1           2645-2647
            2771-3195           BC014966.1         2764-3188
            3196-3199           AK092955.1         3198-3201
FEATURES             Location/Qualifiers
     source          1..3199
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p"
     gene            1..3199
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="ribosomal protein S6 kinase, 90kDa, polypeptide 1"
                     /db_xref="GeneID:6195"
                     /db_xref="HGNC:10430"
                     /db_xref="HPRD:03402"
                     /db_xref="MIM:601684"
     exon            1..226
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       18
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11811005"
     variation       53
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113088608"
     misc_feature    146..148
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="upstream in-frame stop codon"
     CDS             164..2371
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /EC_number="2.7.11.1"
                     /note="isoform a is encoded by transcript variant 1;
                     ribosomal protein S6 kinase alpha 1; p90-RSK 1; ribosomal
                     protein S6 kinase alpha-1; S6K-alpha 1; dJ590P13.1
                     (ribosomal protein S6 kinase, 90kD, polypeptide 1); RSK-1;
                     p90S6K; p90RSK1; MAPKAPK-1a; S6K-alpha-1; MAPKAP kinase
                     1a; ribosomal S6 kinase 1; MAPK-activated protein kinase
                     1a; 90 kDa ribosomal protein S6 kinase 1; MAP
                     kinase-activated protein kinase 1a"
                     /codon_start=1
                     /product="ribosomal protein S6 kinase alpha-1 isoform a"
                     /protein_id="NP_002944.2"
                     /db_xref="GI:20149547"
                     /db_xref="CCDS:CCDS284.1"
                     /db_xref="GeneID:6195"
                     /db_xref="HGNC:10430"
                     /db_xref="HPRD:03402"
                     /db_xref="MIM:601684"
                     /translation="
MPLAQLKEPWPLMELVPLDPENGQTSGEEAGLQPSKDEGVLKEISITHHVKAGSEKADPSHFELLKVLGQGSFGKVFLVRKVTRPDSGHLYAMKVLKKATLKVRDRVRTKMERDILADVNHPFVVKLHYAFQTEGKLYLILDFLRGGDLFTRLSKEVMFTEEDVKFYLAELALGLDHLHSLGIIYRDLKPENILLDEEGHIKLTDFGLSKEAIDHEKKAYSFCGTVEYMAPEVVNRQGHSHSADWWSYGVLMFEMLTGSLPFQGKDRKETMTLILKAKLGMPQFLSTEAQSLLRALFKRNPANRLGSGPDGAEEIKRHVFYSTIDWNKLYRREIKPPFKPAVAQPDDTFYFDTEFTSRTPKDSPGIPPSAGAHQLFRGFSFVATGLMEDDGKPRAPQAPLHSVVQQLHGKNLVFSDGYVVKETIGVGSYSECKRCVHKATNMEYAVKVIDKSKRDPSEEIEILLRYGQHPNIITLKDVYDDGKHVYLVTELMRGGELLDKILRQKFFSEREASFVLHTIGKTVEYLHSQGVVHRDLKPSNILYVDESGNPECLRICDFGFAKQLRAENGLLMTPCYTANFVAPEVLKRQGYDEGCDIWSLGILLYTMLAGYTPFANGPSDTPEEILTRIGSGKFTLSGGNWNTVSETAKDLVSKMLHVDPHQRLTAKQVLQHPWVTQKDKLPQSQLSHQDLQLVKGAMAATYSALNSSKPTPQLKPIESSILAQRRVRKLPSTTL
"
     misc_feature    323..325
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15418.2); phosphorylation site"
     misc_feature    347..1123
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    356..1309
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="N-terminal catalytic domain of the Protein
                     Serine/Threonine Kinase, 90 kDa ribosomal protein S6
                     kinase; Region: STKc_RSK_N; cd05582"
                     /db_xref="CDD:173673"
     misc_feature    order(365..379,389..391,437..439,443..445,536..538,
                     584..589,593..595,605..607,611..613,722..724,728..730,
                     734..739,743..745,773..778,785..787,827..844,923..925,
                     941..943,950..952)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="active site"
                     /db_xref="CDD:173673"
     misc_feature    order(365..379,389..391,437..439,443..445,536..538,
                     587..595,605..607,722..724,728..730,734..739,743..745,
                     773..778)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173673"
     misc_feature    order(377..379,605..607,611..613,722..724,728..730,
                     734..736,785..787,827..844,923..925,941..943,950..952)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173673"
     misc_feature    623..625
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    order(773..808,812..844)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173673"
     misc_feature    824..826
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:05556"
     misc_feature    836..838
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03402"
     misc_feature    836..838
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1082..1084
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15418.2); phosphorylation site"
     misc_feature    1205..1207
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (Q15418.2); phosphorylation site"
     misc_feature    1238..1240
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (Q15418.2); phosphorylation site"
     misc_feature    1238..1240
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01496"
     misc_feature    1250..1252
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="turn motif phosphorylation site [posttranslational
                     modification]; other site"
                     /db_xref="CDD:173673"
     misc_feature    1250..1252
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15418.2); phosphorylation site"
     misc_feature    1250..1252
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01496"
     misc_feature    1268..1270
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15418.2); phosphorylation site"
     misc_feature    1289..1306
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="hydrophobic motif (HM); other site"
                     /db_xref="CDD:173673"
     misc_feature    1301..1303
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by autocatalysis; propagated from
                     UniProtKB/Swiss-Prot (Q15418.2); phosphorylation site"
     misc_feature    1301..1303
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03402"
     misc_feature    1415..2188
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    1433..2185
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl09925"
                     /db_xref="CDD:214163"
     misc_feature    order(1433..1447,1457..1459,1496..1498,1502..1504,
                     1580..1582,1628..1639,1649..1651,1655..1657,1766..1768,
                     1772..1774,1778..1783,1787..1789,1832..1834,1841..1843,
                     1889..1900)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(1433..1447,1457..1459,1496..1498,1502..1504,
                     1580..1582,1628..1639,1649..1651,1766..1768,1772..1774,
                     1778..1783,1787..1789,1832..1834)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(1445..1447,1649..1651,1655..1657,1766..1768,
                     1772..1774,1778..1780,1841..1843,1889..1900)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(1829..1849,1889..1900)
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     misc_feature    1880..1882
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (Q15418.2); phosphorylation site"
     misc_feature    1880..1882
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1892..1894
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03402"
     misc_feature    1892..1894
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2357..2359
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15418.2); phosphorylation site"
     misc_feature    2357..2359
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     variation       214
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11800553"
     exon            227..271
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       264
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201278235"
     variation       265
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17847444"
     exon            272..388
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       295
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202208797"
     variation       299
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113539136"
     variation       310
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200512418"
     variation       311
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139078872"
     variation       349
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371635262"
     variation       355
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370115968"
     variation       388
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:60319813"
     exon            389..470
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       409
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12028491"
     variation       412
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201385156"
     variation       433
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150535662"
     variation       463
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149695725"
     exon            471..551
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       474
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373103051"
     variation       523
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2229710"
     variation       547
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376032218"
     exon            552..631
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       607
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371581310"
     variation       617
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375857541"
     exon            632..738
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       643
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376383316"
     variation       658
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372793504"
     variation       670
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4970490"
     variation       679
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199789905"
     exon            739..776
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     exon            777..919
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       808
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141051128"
     variation       825
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:873152"
     variation       832
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147965368"
     variation       838
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367795872"
     variation       863
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141533618"
     variation       874
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:67370581"
     exon            920..990
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       934
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375217524"
     variation       955
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369496197"
     variation       980
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181351346"
     exon            991..1079
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1029
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138247663"
     exon            1080..1144
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1089
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:66696971"
     exon            1145..1247
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1167
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2229712"
     variation       1170
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201565442"
     variation       1174
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11546001"
     variation       1196
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200823090"
     variation       1223
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370536932"
     variation       1235
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138571702"
     variation       1236
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201153306"
     variation       1238
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372835609"
     exon            1248..1378
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1252
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143984856"
     variation       1265
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138168136"
     variation       1266
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374505864"
     variation       1293
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150753331"
     variation       1296
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373109074"
     variation       1316
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140901694"
     variation       1330
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371215242"
     variation       1333
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375770745"
     variation       1350
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201413022"
     variation       1358
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200693344"
     variation       1369
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150063775"
     exon            1379..1504
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1411
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149144046"
     variation       1417
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56018615"
     variation       1418
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373923998"
     variation       1438
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375786399"
     exon            1505..1594
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1526
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146829384"
     variation       1556
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372558260"
     variation       1561
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1064196"
     exon            1595..1753
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1615
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112552710"
     variation       1635
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369431738"
     variation       1667
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138370781"
     variation       1691
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144489369"
     variation       1696
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143525775"
     variation       1697
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199860173"
     variation       1719
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202075423"
     variation       1750
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369922928"
     exon            1754..1915
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1780
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373074678"
     variation       1789
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200312178"
     variation       1804
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11546000"
     variation       1813
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374126540"
     variation       1822
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116009402"
     variation       1909
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377161355"
     variation       1912
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202239545"
     exon            1916..1992
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1939
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146788594"
     variation       1969
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143490841"
     exon            1993..2110
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       1996
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374581897"
     variation       2000
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377725709"
     variation       2011
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371025431"
     variation       2018
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368086441"
     variation       2024
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112905695"
     variation       2046
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149093867"
     variation       2047
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140088113"
     variation       2048
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201508654"
     variation       2051
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369721857"
     exon            2111..2248
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       2134
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80024567"
     variation       2142
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368282746"
     variation       2171
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7417142"
     variation       2212
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145893180"
     exon            2249..3199
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /inference="alignment:Splign:1.39.8"
     variation       2265
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367842246"
     variation       2266
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201125214"
     variation       2272
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144389719"
     variation       2299
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2229713"
     variation       2377
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181744837"
     variation       2386
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145772599"
     variation       2387
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2229714"
     variation       2414
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:282179"
     variation       2418
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151125319"
     variation       2445
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141078619"
     variation       2484
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12121702"
     STS             2509..3189
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /standard_name="RPS6KA1_8600"
                     /db_xref="UniSTS:468658"
     variation       2554
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111709494"
     variation       2561
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372547001"
     variation       2577
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377553777"
     variation       2599
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12118436"
     variation       2680
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371766931"
     variation       2686
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41303623"
     variation       2696
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114390260"
     variation       2702
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137855096"
     variation       2764
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186868052"
     variation       2769
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11113"
     variation       2780
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:14071"
     STS             2843..3173
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /standard_name="SHGC-74446"
                     /db_xref="UniSTS:81238"
     STS             2861..2989
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /standard_name="G34845"
                     /db_xref="UniSTS:18551"
     variation       2868
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41303625"
     variation       2888
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117144131"
     variation       2936
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1804418"
     STS             2948..3097
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /standard_name="RH70250"
                     /db_xref="UniSTS:78250"
     variation       2998
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7726"
     variation       3099
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192064574"
     variation       3100
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376910879"
     polyA_signal    3177..3182
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
     polyA_site      3195
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
                     /experiment="experimental evidence, no additional details
                     recorded"
     polyA_site      3199
                     /gene="RPS6KA1"
                     /gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
ORIGIN      
gccgaagtgctagtgccgcggcggcggcggcggacggcccagccggagcgcgaggggctcgggggggcgcggcggttcgggtcgcagagccagggaccccaggacccgggaggcggcgcagccggggccgccggaggagcgcgggtgacctggcggcggcgagatgccgctcgcccagctcaaggagccctggccgctcatggagctagtgcctctggacccggagaatggacagacctcaggggaagaagctggacttcagccgtccaaggatgagggcgtcctcaaggagatctccatcacgcaccacgtcaaggctggctctgagaaggctgatccatcccatttcgagctcctcaaggttctgggccagggatcctttggcaaagtcttcctggtgcggaaagtcacccggcctgacagtgggcacctgtatgctatgaaggtgctgaagaaggcaacgctgaaagtacgtgaccgcgtccggaccaagatggagagagacatcctggctgatgtaaatcacccattcgtggtgaagctgcactatgccttccagaccgagggcaagctctatctcattctggacttcctgcgtggtggggacctcttcacccggctctcaaaagaggtgatgttcacggaggaggatgtgaagttttacctggccgagctggctctgggcctggatcacctgcacagcctgggtatcatttacagagacctcaagcctgagaacatccttctggatgaggagggccacatcaaactcactgactttggcctgagcaaagaggccattgaccacgagaagaaggcctattctttctgcgggacagtggagtacatggcccctgaggtcgtcaaccgccagggccactcccatagtgcggactggtggtcctatggggtgttgatgtttgagatgctgacgggctccctgcccttccaggggaaggaccggaaggagaccatgacactgattctgaaggcgaagctaggcatgccccagtttctgagcactgaagcccagagcctcttgcgggccctgttcaagcggaatcctgccaaccggctcggctccggccctgatggggcagaggaaatcaagcggcatgtcttctactccaccattgactggaataagctataccgtcgtgagatcaagccacccttcaagccagcagtggctcagcctgatgacaccttctactttgacaccgagttcacgtcccgcacacccaaggattccccaggcatcccccccagcgctggggcccatcagctgttccggggcttcagcttcgtggccaccggcctgatggaagacgacggcaagcctcgtgccccgcaggcacccctgcactcggtggtacagcaactccatgggaagaacctggtttttagtgacggctacgtggtaaaggagacaattggtgtgggctcctactctgagtgcaagcgctgtgtccacaaggccaccaacatggagtatgctgtcaaggtcattgataagagcaagcgggatccttcagaagagattgagattcttctgcggtatggccagcaccccaacatcatcactctgaaagatgtgtatgatgatggcaaacacgtgtacctggtgacagagctgatgcggggtggggagctgctggacaagatcctgcggcagaagttcttctcagagcgggaggccagctttgtcctgcacaccattggcaaaactgtggagtatctgcactcacagggggttgtgcacagggacctgaagcccagcaacatcctgtatgtggacgagtccgggaatcccgagtgcctgcgcatctgtgactttggttttgccaaacagctgcgggctgagaatgggctcctcatgacaccttgctacacagccaactttgtggcgcctgaggtgctgaagcgccagggctacgatgaaggctgcgacatctggagcctgggcattctgctgtacaccatgctggcaggatatactccatttgccaacggtcccagtgacacaccagaggaaatcctaacccggatcggcagtgggaagtttaccctcagtgggggaaattggaacacagtttcagagacagccaaggacctggtgtccaagatgctacacgtggatccccaccagcgcctcacagctaagcaggttctgcagcatccatgggtcacccagaaagacaagcttccccaaagccagctgtcccaccaggacctacagcttgtgaagggagccatggctgccacgtactccgcactcaacagctccaagcccaccccccagctgaagcccatcgagtcatccatcctggcccagcggcgagtgaggaagttgccatccaccaccctgtgaggcaccagggcattcgggccacagggcggtgctagcttgacacagtcagcatgcttcccagagggagcaggccggaaccacagggccagagggagctggaacccgaggggccggggaagctgccagcccagaacacccctaatgagggtgtgagaagtgccttctccttccccaggatggactcttctcggctcaggctctgctggtggaaagcgattcactgtataaacttttttttatgaaaaaaatggcatcaaccaccatggatttttacaagatccatttgcctttctgggagcagaaacagccattgcggccccaggaggggaactgagtcacgctggggctctctgagactctttagagcagctttgggatcccaccctggggacccccacgattggccacctgtagccatctgcacacacctccgagacagtccagtgtcacctctctcagagcatctggctgtttagcagaactcattctatccccaatcagctccttttccgttctgttctgctgggagttctagaaccacttcctgctacaggaggggtctcatgtcctgctggcttccagcttcaggcaccagcatccaccttggctctgccagtggatcccctgcggtcaggctgggcagccccagagagaggatgtggaaagcactttttggctgacttcatctggggttggcaacaggacagagttcacaggaggccagtgggcgggccatgagggacagggtcttttttcatttcttcctcagctggttactcagggttcatctgtccatggcctttctaataaactgttgagttgaagcac
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:6195 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IEA
            GeneID:6195 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:6195 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:6195 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:6195 -> Molecular function: GO:0043027 [cysteine-type endopeptidase inhibitor activity involved in apoptotic process] evidence: IDA
            GeneID:6195 -> Biological process: GO:0002224 [toll-like receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0002755 [MyD88-dependent toll-like receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0002756 [MyD88-independent toll-like receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
            GeneID:6195 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:6195 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
            GeneID:6195 -> Biological process: GO:0007411 [axon guidance] evidence: TAS
            GeneID:6195 -> Biological process: GO:0030307 [positive regulation of cell growth] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034134 [toll-like receptor 2 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034138 [toll-like receptor 3 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034142 [toll-like receptor 4 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034146 [toll-like receptor 5 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034162 [toll-like receptor 9 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0034166 [toll-like receptor 10 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0035666 [TRIF-dependent toll-like receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0038123 [toll-like receptor TLR1:TLR2 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0038124 [toll-like receptor TLR6:TLR2 signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IMP
            GeneID:6195 -> Biological process: GO:0043154 [negative regulation of cysteine-type endopeptidase activity involved in apoptotic process] evidence: IDA
            GeneID:6195 -> Biological process: GO:0043555 [regulation of translation in response to stress] evidence: TAS
            GeneID:6195 -> Biological process: GO:0043620 [regulation of DNA-dependent transcription in response to stress] evidence: TAS
            GeneID:6195 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
            GeneID:6195 -> Biological process: GO:0045597 [positive regulation of cell differentiation] evidence: TAS
            GeneID:6195 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IMP
            GeneID:6195 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS
            GeneID:6195 -> Biological process: GO:0051403 [stress-activated MAPK cascade] evidence: TAS
            GeneID:6195 -> Biological process: GO:2000491 [positive regulation of hepatic stellate cell activation] evidence: IMP
            GeneID:6195 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:6195 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:6195 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:6195 -> Cellular component: GO:0005819 [spindle] evidence: IEA
            GeneID:6195 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_002944 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.