2024-03-29 23:08:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001485 1335 bp mRNA linear PRI 18-APR-2013 DEFINITION Homo sapiens gastrulation brain homeobox 2 (GBX2), mRNA. ACCESSION NM_001485 VERSION NM_001485.2 GI:45593143 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1335) AUTHORS Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J., Snippe,H., Hibberd,M.L. and Seielstad,M. TITLE New genetic associations detected in a host response study to hepatitis B vaccine JOURNAL Genes Immun. 11 (3), 232-238 (2010) PUBMED 20237496 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 2 (bases 1 to 1335) AUTHORS Heimbucher,T., Murko,C., Bajoghli,B., Aghaallaei,N., Huber,A., Stebegg,R., Eberhard,D., Fink,M., Simeone,A. and Czerny,T. TITLE Gbx2 and Otx2 interact with the WD40 domain of Groucho/Tle corepressors JOURNAL Mol. Cell. Biol. 27 (1), 340-351 (2007) PUBMED 17060451 REMARK GeneRIF: Gbx2 and Otx2 interact with the WD40 domain of Groucho/Tle corepressors REFERENCE 3 (bases 1 to 1335) AUTHORS Glinsky,G.V., Berezovska,O. and Glinskii,A.B. TITLE Microarray analysis identifies a death-from-cancer signature predicting therapy failure in patients with multiple types of cancer JOURNAL J. Clin. Invest. 115 (6), 1503-1521 (2005) PUBMED 15931389 REMARK GeneRIF: Altered expression is associated with therapy failure and death in patients with multiple types of cancer. REFERENCE 4 (bases 1 to 1335) AUTHORS Hillier,L.W., Graves,T.A., Fulton,R.S., Fulton,L.A., Pepin,K.H., Minx,P., Wagner-McPherson,C., Layman,D., Wylie,K., Sekhon,M., Becker,M.C., Fewell,G.A., Delehaunty,K.D., Miner,T.L., Nash,W.E., Kremitzki,C., Oddy,L., Du,H., Sun,H., Bradshaw-Cordum,H., Ali,J., Carter,J., Cordes,M., Harris,A., Isak,A., van Brunt,A., Nguyen,C., Du,F., Courtney,L., Kalicki,J., Ozersky,P., Abbott,S., Armstrong,J., Belter,E.A., Caruso,L., Cedroni,M., Cotton,M., Davidson,T., Desai,A., Elliott,G., Erb,T., Fronick,C., Gaige,T., Haakenson,W., Haglund,K., Holmes,A., Harkins,R., Kim,K., Kruchowski,S.S., Strong,C.M., Grewal,N., Goyea,E., Hou,S., Levy,A., Martinka,S., Mead,K., McLellan,M.D., Meyer,R., Randall-Maher,J., Tomlinson,C., Dauphin-Kohlberg,S., Kozlowicz-Reilly,A., Shah,N., Swearengen-Shahid,S., Snider,J., Strong,J.T., Thompson,J., Yoakum,M., Leonard,S., Pearman,C., Trani,L., Radionenko,M., Waligorski,J.E., Wang,C., Rock,S.M., Tin-Wollam,A.M., Maupin,R., Latreille,P., Wendl,M.C., Yang,S.P., Pohl,C., Wallis,J.W., Spieth,J., Bieri,T.A., Berkowicz,N., Nelson,J.O., Osborne,J., Ding,L., Meyer,R., Sabo,A., Shotland,Y., Sinha,P., Wohldmann,P.E., Cook,L.L., Hickenbotham,M.T., Eldred,J., Williams,D., Jones,T.A., She,X., Ciccarelli,F.D., Izaurralde,E., Taylor,J., Schmutz,J., Myers,R.M., Cox,D.R., Huang,X., McPherson,J.D., Mardis,E.R., Clifton,S.W., Warren,W.C., Chinwalla,A.T., Eddy,S.R., Marra,M.A., Ovcharenko,I., Furey,T.S., Miller,W., Eichler,E.E., Bork,P., Suyama,M., Torrents,D., Waterston,R.H. and Wilson,R.K. TITLE Generation and annotation of the DNA sequences of human chromosomes 2 and 4 JOURNAL Nature 434 (7034), 724-731 (2005) PUBMED 15815621 REFERENCE 5 (bases 1 to 1335) AUTHORS Gao,A.C., Lou,W. and Isaacs,J.T. TITLE Enhanced GBX2 expression stimulates growth of human prostate cancer cells via transcriptional up-regulation of the interleukin 6 gene JOURNAL Clin. Cancer Res. 6 (2), 493-497 (2000) PUBMED 10690529 REFERENCE 6 (bases 1 to 1335) AUTHORS Gao,A.C., Lou,W. and Isaacs,J.T. TITLE Down-regulation of homeobox gene GBX2 expression inhibits human prostate cancer clonogenic ability and tumorigenicity JOURNAL Cancer Res. 58 (7), 1391-1394 (1998) PUBMED 9537237 REFERENCE 7 (bases 1 to 1335) AUTHORS Kowenz-Leutz,E., Herr,P., Niss,K. and Leutz,A. TITLE The homeobox gene GBX2, a target of the myb oncogene, mediates autocrine growth and monocyte differentiation JOURNAL Cell 91 (2), 185-195 (1997) PUBMED 9346236 REFERENCE 8 (bases 1 to 1335) AUTHORS Lin,X., Swaroop,A., Vaccarino,F.M., Murtha,M.T., Haas,M., Ji,X., Ruddle,F.H. and Leckman,J.F. TITLE Characterization and sequence analysis of the human homeobox-containing gene GBX2 JOURNAL Genomics 31 (3), 335-342 (1996) PUBMED 8838315 REFERENCE 9 (bases 1 to 1335) AUTHORS Matsui,T., Hirai,M., Hirano,M. and Kurosawa,Y. TITLE The HOX complex neighbored by the EVX gene, as well as two other homeobox-containing genes, the GBX-class and the EN-class, are located on the same chromosomes 2 and 7 in humans JOURNAL FEBS Lett. 336 (1), 107-110 (1993) PUBMED 7903253 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AF118452.1 and BF115559.1. On Mar 19, 2004 this sequence version replaced gi:4503940. ##Evidence-Data-START## Transcript exon combination :: BC137449.1, DR760752.1 [ECO:0000332] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1147 AF118452.1 1-1147 1148-1335 BF115559.1 1-188 c FEATURES Location/Qualifiers source 1..1335 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="2" /map="2q37.2" gene 1..1335 /gene="GBX2" /note="gastrulation brain homeobox 2" /db_xref="GeneID:2637" /db_xref="HGNC:4186" /db_xref="HPRD:03087" /db_xref="MIM:601135" STS 1..1125 /gene="GBX2" /db_xref="UniSTS:482687" exon 1..561 /gene="GBX2" /inference="alignment:Splign:1.39.8" CDS 39..1085 /gene="GBX2" /note="gastrulation brain homeo box 2; gastrulation and brain-specific homeobox protein 2" /codon_start=1 /product="homeobox protein GBX-2" /protein_id="NP_001476.2" /db_xref="GI:45593144" /db_xref="CCDS:CCDS2515.1" /db_xref="GeneID:2637" /db_xref="HGNC:4186" /db_xref="HPRD:03087" /db_xref="MIM:601135" /translation="
MSAAFPPSLMMMQRPLGSSTAFSIDSLIGSPPQPSPGHFVYTGYPMFMPYRPVVLPPPPPPPPALPQAALQPALPPAHPHHQIPSLPTGFCSSLAQGMALTSTLMATLPGGFSASPQHQEAAAARKFAPQPLPGGGNFDKAEALQADAEDGKGFLAKEGSLLAFSAAETVQASLVGAVRGQGKDESKVEDDPKGKEESFSLESDVDYSSDDNLTGQAAHKEEDPGHALEETPPSSGAAGSTTSTGKNRRRRTAFTSEQLLELEKEFHCKKYLSLTERSQIAHALKLSEVQVKIWFQNRRAKWKRVKAGNANSKTGEPSRNPKIVVPIPVHVSRFAIRSQHQQLEQARP
" misc_feature 780..956 /gene="GBX2" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(780..794,798..800,849..851,867..869,906..908, 912..917,924..929,933..941,945..950) /gene="GBX2" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(786..788,795..797,915..917,924..929,936..938) /gene="GBX2" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" STS 39..1085 /gene="GBX2" /db_xref="UniSTS:480910" variation 557 /gene="GBX2" /replace="c" /replace="g" /db_xref="dbSNP:112186240" exon 562..1335 /gene="GBX2" /inference="alignment:Splign:1.39.8" STS 585..1239 /gene="GBX2" /standard_name="GBX2_4093" /db_xref="UniSTS:462895" ORIGIN
gacttttcgcctctcgctggcctctaccgagcgcgtctatgagcgcagcgttcccgccgtcgctgatgatgatgcagcgcccgctggggagtagcaccgccttcagcatagactcgctgatcggcagcccgccgcagcccagccccggccatttcgtctacaccggctaccccatgttcatgccctaccggccggtagtgctgccgccgccgccgccgccgccgcccgcgctgccccaggccgcgctgcagccagcgctgccgcccgcacaccctcaccaccagatccccagcctgcccacaggcttctgctccagcctggcgcagggcatggcgctcacctctacgctcatggccacgctccccggcggcttctccgcgtcgccccagcaccaggaggcggcagcggcccgcaagttcgcgccgcagccgctgcccggcggcggtaacttcgacaaggcggaggcgctgcaggctgacgcggaggacggcaaaggcttcctggccaaagagggctcgctgctcgccttctccgcggccgagacggtgcaggcttcgctcgtcggggctgtccgagggcaagggaaagacgagtcaaaggtggaagacgacccgaagggcaaggaggagagcttctcgctggagagcgatgtggactacagctcggatgacaatctgactggccaggcagctcacaaggaggaagacccgggccacgcgctggaggagaccccgccgagcagcggcgccgcgggcagcaccacgtctacgggcaagaaccggcggcggcggactgccttcaccagcgagcagctgctggagctagagaaggagttccactgcaaaaagtacctctccttgaccgagcgctcgcagatcgcccacgccctcaaactcagcgaggtgcaggtgaaaatctggttccagaaccgacgggccaagtggaaacgggtgaaggcaggcaatgccaattccaagacaggggagccctcccggaaccctaagatcgtcgtccccatccctgtccacgtcagcaggttcgctatcagaagtcagcatcagcagctagaacaggcccggccctgagggtccagaagggccagggcctggcacccacctggagaagcccccgcacccgagggaacccatggtggactccactgtgtttgaagcaacaaagtcacagcccagctgtggccatcccaagcaaattgagaatatattcactaaatgggcttaaaagactgcttttgaaggggcttacagccacaccagaagacacgctaaatatttattatactatcctactttgtacataaatatctctatagactgg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2637 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:2637 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:2637 -> Biological process: GO:0001569 [patterning of blood vessels] evidence: IEA GeneID:2637 -> Biological process: GO:0001755 [neural crest cell migration] evidence: IEA GeneID:2637 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:2637 -> Biological process: GO:0007399 [nervous system development] evidence: TAS GeneID:2637 -> Biological process: GO:0007411 [axon guidance] evidence: IEA GeneID:2637 -> Biological process: GO:0021549 [cerebellum development] evidence: IEA GeneID:2637 -> Biological process: GO:0021555 [midbrain-hindbrain boundary morphogenesis] evidence: IEA GeneID:2637 -> Biological process: GO:0021568 [rhombomere 2 development] evidence: IEA GeneID:2637 -> Biological process: GO:0021794 [thalamus development] evidence: IEA GeneID:2637 -> Biological process: GO:0021884 [forebrain neuron development] evidence: IEA GeneID:2637 -> Biological process: GO:0021930 [cerebellar granule cell precursor proliferation] evidence: IEA GeneID:2637 -> Biological process: GO:0042472 [inner ear morphogenesis] evidence: IEA GeneID:2637 -> Biological process: GO:0048483 [autonomic nervous system development] evidence: IEA GeneID:2637 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.