2024-03-28 17:42:13, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001278056 1380 bp mRNA linear PRI 07-MAY-2013 DEFINITION Homo sapiens double homeobox protein 4-like (LOC100653046), mRNA. ACCESSION NM_001278056 VERSION NM_001278056.1 GI:489406923 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1380) AUTHORS Dixit,M., Ansseau,E., Tassin,A., Winokur,S., Shi,R., Qian,H., Sauvage,S., Matteotti,C., van Acker,A.M., Leo,O., Figlewicz,D., Barro,M., Laoudj-Chenivesse,D., Belayew,A., Coppee,F. and Chen,Y.W. TITLE DUX4, a candidate gene of facioscapulohumeral muscular dystrophy, encodes a transcriptional activator of PITX1 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 104 (46), 18157-18162 (2007) PUBMED 17984056 REFERENCE 2 (bases 1 to 1380) AUTHORS Clapp,J., Mitchell,L.M., Bolland,D.J., Fantes,J., Corcoran,A.E., Scotting,P.J., Armour,J.A. and Hewitt,J.E. TITLE Evolutionary conservation of a coding function for D4Z4, the tandem DNA repeat mutated in facioscapulohumeral muscular dystrophy JOURNAL Am. J. Hum. Genet. 81 (2), 264-279 (2007) PUBMED 17668377 REFERENCE 3 (bases 1 to 1380) AUTHORS Kowaljow,V., Marcowycz,A., Ansseau,E., Conde,C.B., Sauvage,S., Matteotti,C., Arias,C., Corona,E.D., Nunez,N.G., Leo,O., Wattiez,R., Figlewicz,D., Laoudj-Chenivesse,D., Belayew,A., Coppee,F. and Rosa,A.L. TITLE The DUX4 gene at the FSHD1A locus encodes a pro-apoptotic protein JOURNAL Neuromuscul. Disord. 17 (8), 611-623 (2007) PUBMED 17588759 REFERENCE 4 (bases 1 to 1380) AUTHORS Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A., Frants,R.R., Collen,D. and Belayew,A. TITLE Active genes in junk DNA? Characterization of DUX genes embedded within 3.3 kb repeated elements JOURNAL Gene 264 (1), 51-57 (2001) PUBMED 11245978 REFERENCE 5 (bases 1 to 1380) AUTHORS Lee,J.H., Goto,K., Matsuda,C. and Arahata,K. TITLE Characterization of a tandemly repeated 3.3-kb KpnI unit in the facioscapulohumeral muscular dystrophy (FSHD) gene region on chromosome 4q35 JOURNAL Muscle Nerve Suppl 2, S6-S13 (1995) PUBMED 7739628 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC215524.3. Sequence Note: This RefSeq record was created from genomic sequence data because no transcript was available for this gene. The genomic coordinates used for the transcript record were based on literature reports indicating transcription of the double homeobox protein 4-like gene copies, e.g., PMID:17588759. COMPLETENESS: complete on the 5' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1380 AC215524.3 29500-30879 c FEATURES Location/Qualifiers source 1..1380 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="4" /map="4" gene 1..1380 /gene="LOC100653046" /note="double homeobox protein 4-like" /db_xref="GeneID:100653046" exon 1..1380 /gene="LOC100653046" /inference="alignment:Splign:1.39.8" CDS 98..1372 /gene="LOC100653046" /note="double homeobox protein 4-like protein 4-like" /codon_start=1 /product="double homeobox protein 4-like" /protein_id="NP_001264985.1" /db_xref="GI:489406924" /db_xref="GeneID:100653046" /translation="
MALPTPSDSTLPAEARGRGRRRRLVWTPSQSEALRACFERNPYPGIATRERLAQAIGIPEPRVQIWFQNERSRQLRQHRRESRPWPGRRGPPEGRRKRTAVTGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHPGQGGRAPAQAGGLCSAAPGGGHPAPSWVAFAHTGAWGTGLPAPHVPCAPGALPQGAFVSQAARAAPALQPSQAAPAEGISQPAPARGDFAYAAPAPPDGALSHPQAPRWPPHPGKSREDRDPQRDGLPGPCAVAQPGPAQAGPQGQGVLAPPTSQGSPWWGWGRGPQVAGAAWEPQAGAAPPPQPAPPDASASARQGQMQGIPAPSQALQEPAPWSALPCGLLLDELLASPEFLQQAQPLLETEAPGELEASEEAASLEAPLSEEEYRALLEEL
" misc_feature 170..331 /gene="LOC100653046" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(170..172,290..292,299..304,311..313) /gene="LOC100653046" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature order(173..175,224..226,242..244,281..283,287..292, 299..304,308..316,320..325) /gene="LOC100653046" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 401..544 /gene="LOC100653046" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(449..451,467..469,506..508,512..517,524..529, 533..541) /gene="LOC100653046" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(515..517,524..529,536..538) /gene="LOC100653046" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" ORIGIN
acctgccgcagtgcacagtccggctgaggtgcacgggagcccgccggcctctctctgcccgcgtccgtccgtgaaattccggccggggctcaccgcgatggccctcccgacaccctcggacagcaccctccccgcggaagcccggggacgaggacggcgacggagactcgtttggaccccgagccaaagcgaggccctgcgagcctgctttgagcggaacccgtacccgggcatcgccaccagagaacggctggcccaggccatcggcattccggagcccagggtccagatttggtttcagaatgagaggtcacgccagctgaggcagcaccggcgggaatctcggccctggcccgggagacgcggcccgccagaaggccggcgaaagcggaccgccgtcaccggatcccagaccgccctgctcctccgagcctttgagaaggatcgctttccaggcatcgccgcccgggaggagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacagggtggcagggcgcccgcgcaggcaggcggcctgtgcagcgcggcccccggcgggggtcaccctgctccctcgtgggtcgccttcgcccacaccggcgcgtggggaacggggcttcccgcaccccacgtgccctgcgcgcctggggctctcccacagggggctttcgtgagccaggcagcgagggccgcccccgcgctgcagcccagccaggccgcgccggcagaggggatctcccaacctgccccggcgcgcggggatttcgcctacgccgccccggctcctccggacggggcgctctcccaccctcaggctcctcggtggcctccgcacccgggcaaaagccgggaggaccgggacccgcagcgcgacggcctgccgggcccctgcgcggtggcacagcctgggcccgctcaagcggggccgcagggccaaggggtgcttgcgccacccacgtcccaggggagtccgtggtggggctggggccggggtccccaggtcgccggggcggcgtgggaaccccaagccggggcagctccacctccccagcccgcgcccccggacgcctccgcctccgcgcggcaggggcagatgcaaggcatcccggcgccctcccaggcgctccaggagccggcgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcgagcccggagtttctgcagcaggcgcaacctctcctagaaacggaggccccgggggagctggaggcctcggaagaggccgcctcgctggaagcacccctcagcgaggaagaataccgggctctgctggaggagctttaggacgcggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.