GGRNA Home | Help | Advanced search

2024-04-20 19:20:06, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001244190            5801 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens KIAA0586 (KIAA0586), transcript variant 2, mRNA.
ACCESSION   NM_001244190
VERSION     NM_001244190.1  GI:346644662
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5801)
  AUTHORS   Yin,Y., Bangs,F., Paton,I.R., Prescott,A., James,J., Davey,M.G.,
            Whitley,P., Genikhovich,G., Technau,U., Burt,D.W. and Tickle,C.
  TITLE     The Talpid3 gene (KIAA0586) encodes a centrosomal protein that is
            essential for primary cilia formation
  JOURNAL   Development 136 (4), 655-664 (2009)
   PUBMED   19144723
REFERENCE   2  (bases 1 to 5801)
  AUTHORS   Davey,M.G., Paton,I.R., Yin,Y., Schmidt,M., Bangs,F.K.,
            Morrice,D.R., Smith,T.G., Buxton,P., Stamataki,D., Tanaka,M.,
            Munsterberg,A.E., Briscoe,J., Tickle,C. and Burt,D.W.
  TITLE     The chicken talpid3 gene encodes a novel protein essential for
            Hedgehog signaling
  JOURNAL   Genes Dev. 20 (10), 1365-1377 (2006)
   PUBMED   16702409
  REMARK    GeneRIF: The chicken ortholog functions in regulation of the Gli
            repressor and activator proteins in the Hedgehog signaling pathway.
REFERENCE   3  (bases 1 to 5801)
  AUTHORS   Wood,R., Chumbler,F. and Wiegand,R.
  TITLE     Incorporation of dietary cis and trans isomers of octadecenoate in
            lipid classes of liver and hepatoma
  JOURNAL   J. Biol. Chem. 252 (6), 1965-1970 (1977)
   PUBMED   191447
  REMARK    GeneRIF: The chicken ortholog encodes a centrosomal protein
            containing a highly conserved region necessary for ciliogenesis,
            neural tube patterning, and Hedgehog signaling.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK302836.1, AB011158.1, AY359881.1, AL139021.6, AI378482.1 and
            CN281643.1.
            
            Transcript Variant: This variant (2) lacks an alternate segment in
            the 5' coding region, uses a downstream start codon, and lacks
            several alternate in-frame exons, compared to variant 1. This
            results in a shorter protein (isoform 2), compared to isoform 1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB011158.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-17                AK302836.1         1-17
            18-1364             AB011158.1         1-1347
            1365-2773           AY359881.1         1245-2653
            2774-2774           AL139021.6         134344-134344
            2775-3412           AY359881.1         2655-3292
            3413-5081           AB011158.1         3396-5064
            5082-5328           AI378482.1         1-247               c
            5329-5801           CN281643.1         1-473               c
FEATURES             Location/Qualifiers
     source          1..5801
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q23.1"
     gene            1..5801
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="KIAA0586"
                     /db_xref="GeneID:9786"
                     /db_xref="HGNC:19960"
                     /db_xref="MIM:610178"
     exon            1..253
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       10..11
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:370910907"
     variation       24..25
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:370158049"
     variation       30
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:118123619"
     misc_feature    160..162
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="upstream in-frame stop codon"
     exon            254..445
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       261
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199554737"
     variation       282
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372215354"
     CDS             292..4893
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="isoform 2 is encoded by transcript variant 2;
                     ortholog of chicken talpid{3}; protein TALPID3"
                     /codon_start=1
                     /product="protein TALPID3 isoform 2"
                     /protein_id="NP_001231119.1"
                     /db_xref="GI:346644663"
                     /db_xref="CCDS:CCDS58321.1"
                     /db_xref="GeneID:9786"
                     /db_xref="HGNC:19960"
                     /db_xref="MIM:610178"
                     /translation="
MPVKRLREVVSQNHGDHLVLLKDELPCVPPALSANKRLPVGTGTSLNGTSRGSSDLTSARNCYQPLLENPMVSESDFSKDVAVQVLPLDKIEENNKQKANDIFISQYTMGQKDALRTVLKQKAQSMPVFKEVKVHLLEDAGIEKDAVTQETRISPSGIDSATTVAAATAAAIATAAPLIKVQSDLEAKVNSVTELLSKLQETDKHLQRVTEQQTSIQRKQEKLHCHDHEKQMNVFMEQHIRHLEKLQQQQIDIQTHFISAALKTSSFQPVSMPSSRAVEKYSVKPEHPNLGSCNPSLYNTFASKQAPLKEVEDTSFDKQKSPLETPAPRRFAPVPVSRDDELSKRENLLEEKENMEVSCHRGNVRLLEQILNNNDSLTRKSESSNTTSLTRSKIGWTPEKTNRFPSCEELETTKVTMQKSDDVLHDLGQKEKETNSMVQPKESLSMLKLPDLPQNSVKLQTTNTTRSVLKDAEKILRGVQNNKKVLEENLEAIIRAKDGAAMYSLINALSTNREMSEKIRIRKTVDEWIKTISAEIQDELSRTDYEQKRFDQKNQRTKKGQNMTKDIRTNTQDKTVNKSVIPRKHSQKQIEEHFRNLPMRGMPASSLQKERKEGLLKATTVIQDEDYMLQVYGKPVYQGHRSTLKKGPYLRFNSPSPKSRPQRPKVIERVKGTKVKSIRTQTDFYATKPKKMDSKMKHSVPVLPHGDQQYLFSPSREMPTFSGTLEGHLIPMAILLGQTQSNSDTMPPAGVIVSKPHPVTVTTSIPPSSRKVETGVKKPNIAIVEMKSEKKDPPQLTVQVLPSVDIDSISNSSADVLSPLSSPKEASLPPVQTWIKTPEIMKVDEEEVKFPGTNFDEIIDVIQEEEKCDEIPDSEPILEFNRSVKADSTKYNGPPFPPVASTFQPTADILDKVIERKETLENSLIQWVEQEIMSRIISGLFPVQQQIAPSISVSVSETSEPLTSDIVEGTSSGALQLFVDAGVPVNSNVIKHFVNEALAETIAVMLGDREAKKQGPVATGVSGDASTNETYLPARVCTPLPTPQPTPPCSPSSPAKECVLVKTPDSSPCDSDHDMAFPVKEICAEKGDDMPAIMLVNTPTVTPTTTPPPAAAVFTPTLSDISIDKLKVSSPELPKPWGDGDLPLEEENPNSPQEELHPRAIVMSVAKDEEPESMDFPAQPPPPEPVPFMPFPAGTKAPSPSQMPGSDSSTLESTLSVTVTETETLDKPISEGEILFSCGQKLAPKILEDIGLYLTNLNDSLSSTLHDAVEMEDDPPSEGQVIRMSHKKFHADAILSFAKQNQESAVSQQAVYHSEDLENSVGELSEGQRPQLTAAAENILMGHSLYMQPPVTNTQSLDQQCDPKPLSRQFDTVSGSIYEDSCASHGPMSLGELELEPNSKLVLPTTLLTAQENDVNLPVAAEDFSQYQLKQNQDVKQVEHKPSQSYLRVRNKSDIAPSQQQVSPGDMDRTQIELNPYLTCVFSGGKAVPLSASQMPPAKMSVMLPSVNLEDCSQSLSLSTMQEDMESSGADTF
"
     misc_feature    1690..1953
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BVV6.4);
                     Region: Required for centrosomal localization (By
                     similarity)"
     variation       310
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202124602"
     variation       346
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186659284"
     variation       363
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190089844"
     variation       413
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201315284"
     variation       417
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372659413"
     variation       428
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183168709"
     exon            446..516
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       448
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147119902"
     variation       461
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201393625"
     variation       483
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370677508"
     variation       503
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74055693"
     exon            517..586
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       532
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189943424"
     variation       557
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376005040"
     variation       575
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373836349"
     exon            587..656
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       593
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376113173"
     variation       609
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368352741"
     variation       613
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183240083"
     variation       641
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200627657"
     exon            657..831
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       668
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735931"
     variation       728
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11622776"
     variation       778
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374972438"
     variation       822
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369143869"
     exon            832..1053
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       838
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375374719"
     variation       846
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61738360"
     variation       866
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199837404"
     variation       889
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201097695"
     variation       944
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193056942"
     variation       969
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373333959"
     variation       976
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376338487"
     variation       1029
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370332963"
     variation       1031
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376289224"
     exon            1054..1207
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1058
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368574051"
     variation       1096
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371179268"
     variation       1115
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186378072"
     variation       1184
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191232589"
     exon            1208..1375
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1220
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144456198"
     variation       1302
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148006211"
     variation       1314
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376048205"
     variation       1323
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199623501"
     variation       1326
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200094677"
     variation       1330
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371365932"
     variation       1343
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:59248588"
     variation       1355
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369845308"
     variation       1365
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748971"
     exon            1376..1499
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1389
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370408761"
     variation       1476
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10135645"
     variation       1483
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377325998"
     variation       1486
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147844088"
     exon            1500..1608
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1505
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187783779"
     variation       1515
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190675549"
     variation       1582
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371477725"
     exon            1609..1829
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1639
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376681702"
     variation       1653
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200446131"
     variation       1669
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78468862"
     variation       1685
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61745119"
     variation       1690
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375472516"
     variation       1691
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369211190"
     variation       1768
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61745095"
     variation       1816
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:61742715"
     exon            1830..1902
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1899
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374601841"
     exon            1903..2130
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2031
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371990780"
     variation       2125
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191704222"
     exon            2131..2305
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2149
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375173927"
     variation       2163
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376649351"
     variation       2208
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199777168"
     variation       2233
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370560098"
     variation       2236
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202025419"
     variation       2256
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185266107"
     variation       2278
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190081177"
     exon            2306..2500
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2323
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200735064"
     variation       2338
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371583234"
     variation       2369
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373601253"
     variation       2391
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78009437"
     variation       2409
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368904420"
     variation       2447
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372160214"
     variation       2473
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192490416"
     exon            2501..2688
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2504
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369552863"
     variation       2541
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200937470"
     variation       2600
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372212501"
     variation       2615
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376797336"
     variation       2618
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78460691"
     variation       2632
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369070060"
     variation       2642
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369850927"
     variation       2671
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201629494"
     variation       2683
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373130060"
     exon            2689..2799
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2695
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370111393"
     variation       2732
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200219991"
     variation       2749
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113040775"
     variation       2757
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377409718"
     variation       2774
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1748986"
     variation       2777
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200490147"
     variation       2779
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377023593"
     exon            2800..2880
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2803
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367573993"
     variation       2804
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45478500"
     variation       2830
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372915104"
     variation       2835
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374585380"
     variation       2841
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368361783"
     variation       2876
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377015806"
     variation       2877
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367998141"
     exon            2881..3071
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2981
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139493302"
     variation       2982
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368984896"
     variation       2984
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202051871"
     variation       3052
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61974537"
     exon            3072..3190
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3077
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181400417"
     variation       3078
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373201020"
     variation       3090
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374762003"
     variation       3130
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376119494"
     variation       3154
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368808852"
     variation       3158
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3783696"
     variation       3189
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370778483"
     exon            3191..3390
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3230
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368583200"
     variation       3249
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199537542"
     variation       3284
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375690080"
     variation       3288
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368251704"
     variation       3292
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141771152"
     variation       3293
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372259984"
     variation       3299
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182274649"
     variation       3306
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201263653"
     variation       3350
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77860620"
     variation       3356
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367811307"
     variation       3375
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371456681"
     variation       3381
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374691292"
     variation       3389
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369859399"
     exon            3391..3550
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3412
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1617510"
     variation       3429
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369590767"
     variation       3493
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373431045"
     variation       3512
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187091758"
     variation       3523
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77810875"
     variation       3529
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140565291"
     variation       3538
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374459469"
     exon            3551..3773
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3614
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377332917"
     variation       3620
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201898983"
     variation       3653
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200148591"
     variation       3693..3694
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:368765650"
     variation       3696
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199517530"
     variation       3710
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3929708"
     variation       3713
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200085678"
     exon            3774..4027
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3799
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200722491"
     variation       3802
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368136238"
     variation       3810
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371957302"
     variation       3826
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373763986"
     variation       3847
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376675866"
     variation       3850
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199743989"
     variation       3870
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367676896"
     variation       3890
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201709033"
     variation       3891
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375360391"
     variation       3909
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201202020"
     variation       3934
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143158234"
     variation       3944
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201702546"
     variation       3959
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369318614"
     variation       3961
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201889432"
     variation       3965
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190271845"
     variation       3975
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377467641"
     variation       4020
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199982600"
     exon            4028..4104
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4032
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374590484"
     variation       4051
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377000129"
     variation       4087
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371424977"
     variation       4095
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113191202"
     variation       4096
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374292446"
     variation       4102
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377275619"
     exon            4105..4236
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4107
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188676684"
     variation       4108
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181413894"
     variation       4137..4138
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35666852"
     variation       4166
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3783697"
     variation       4171
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376234883"
     variation       4226
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201929144"
     variation       4234
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373649439"
     exon            4237..4414
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4293
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61729923"
     variation       4359
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200906427"
     variation       4371
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148016417"
     variation       4380
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369759253"
     variation       4383
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372138430"
     variation       4406
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376795880"
     variation       4408
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369067010"
     variation       4412
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373357386"
     exon            4415..4569
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4444
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140874828"
     variation       4452
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369935221"
     variation       4457
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192561585"
     variation       4551
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144692893"
     variation       4552
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202235093"
     variation       4561
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200405048"
     exon            4570..4675
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4571
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200127338"
     variation       4572
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139175231"
     exon            4676..4741
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4682
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374096160"
     variation       4707
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11611"
     variation       4718
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370303493"
     exon            4742..5792
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     STS             4756..5045
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="WI-20905"
                     /db_xref="UniSTS:31105"
     variation       4765
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140026883"
     variation       4799
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377020452"
     variation       4806
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45568037"
     variation       4818
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371910625"
     variation       4819
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375085808"
     STS             4829..4961
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="RH15628"
                     /db_xref="UniSTS:59832"
     STS             4845..4969
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="D14S696E"
                     /db_xref="UniSTS:151575"
     variation       4869
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188723128"
     variation       4873..4877
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="tcggg"
                     /db_xref="dbSNP:199504537"
     variation       4875
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61745066"
     variation       4890
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373503925"
     variation       4895
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376691503"
     variation       4970
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375948139"
     variation       4998
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74607305"
     variation       5120
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370422091"
     variation       5172
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369997201"
     variation       5236
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139596781"
     variation       5242
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374397560"
     variation       5243
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149751065"
     STS             5296..5434
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="G30978"
                     /db_xref="UniSTS:64038"
     variation       5321
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145442381"
     variation       5335
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545286"
     variation       5338
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139072701"
     variation       5384
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181452208"
     variation       5413
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185323978"
     variation       5553
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74058013"
     variation       5589
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144014186"
ORIGIN      
aatttacctaatcccacgtccctaacggtcttcggaagcgaagcagtgtcaacagtccctggtaaacacaagtagtattacaagtcgggagctcttcaagtcttggatgagactgtagagcggtcttgtgcggcaatgtgctaccttaaaataaataaataaataaacccctgttatgtccggagtttgtttccacccggagaggaatggaagagcaccagagagcgcttagctttctggttggatgttttgggctctgaggtcagcttggagaagaaaaaaaagattaagatgccagtgaagagacttcgtgaggtagtttctcaaaatcatggagatcatttggttttgctgaaagatgagttgccctgtgttcctccggcattgtctgcaaataaacgtcttcctgttggaacggggactagtttgaatggaacatcacgtggttcatcagacttaacttctgctagaaattgttaccagcctctattagaaaatcccatggtgtcagaaagtgatttttctaaagacgttgcagtgcaagtgttgcctttggataaaatagaagagaacaacaagcaaaaagcaaatgacatcttcatttctcagtatacaatgggacagaaagatgctctaagaacagttttaaagcaaaaagctcaaagcatgcctgtttttaaggaagtaaaggtacatctgttagaagatgcaggcatagagaaggatgctgttactcaggagactagaatttcacccagtggaattgattcagctacaaccgtggctgcagcaactgctgctgccattgcaaccgcagctccgttgataaaggtgcagagtgatttggaagcaaaagtcaattctgttacagaattacttagtaaattacaggagactgataaacacctgcaacgtgttacagagcagcaaacaagcattcagaggaaacaagagaaattacattgtcatgatcacgaaaagcaaatgaatgtgtttatggagcagcacataaggcatcttgaaaagttacaacaacaacaaatagatattcagactcattttattagtgctgcactcaagactagtagttttcagcctgttagtatgccctcctccagagcagtggaaaagtattccgtaaaaccagaacaccctaatcttggtagctgtaatccatctttatataacacatttgcttccaaacaagcacctttaaaagaagttgaagatacgagttttgataaacagaaatctcctttggagacaccagcacctcgcagatttgctcctgtacctgtttcaagggatgatgaactatcaaagagggaaaatcttttggaagaaaaagaaaatatggaagtgtcgtgtcacagaggaaatgtaagactattggaacaaattttgaataataatgattctttgacaagaaaaagtgaatcatcaaacaccacctcactaactaggtcaaaaataggatggactcctgagaaaacaaacagatttccttcctgtgaagagctagaaacaactaaagtgactatgcagaagtctgatgatgttcttcatgaccttggccaaaaagagaaagaaacaaatagcatggtccagccaaaagaatctctgagtatgttgaagcttccagatcttccacagaattctgttaagcttcaaacaaccaatacaacaagatctgtattgaaagatgctgagaagattttgagaggagtacaaaacaataaaaaagtacttgaagaaaacctggaagctattattcgtgcaaaagatggagctgccatgtattcgcttatcaatgctttatctaccaacagagagatgtcagagaaaattaggatcagaaagacagtggatgaatggattaaaactatttctgcagaaattcaggatgaactgtcaagaacagattatgaacaaaaaagatttgatcagaagaatcagagaaccaagaaaggtcagaatatgactaaagatattagaaccaacacacaagataaaactgtcaacaaatctgtaattccaagaaaacattctcaaaagcaaatagaagagcattttagaaatctacctatgaggggcatgcctgcttcaagtttacagaaagagagaaaggaagggcttttgaaagcaaccacagtaatacaagatgaagattatatgttacaagtctatggaaagccagtttatcagggccatcgaagcactcttaaaaaaggaccatatctcagatttaattctccatctcctaagtccagaccacagagaccaaaagtaatagaacgagttaaaggcactaaggtaaagtcaataagaacacagactgacttctatgcaacaaaacctaagaagatggattctaaaatgaaacattctgttcctgtgttacctcatggcgatcagcaatatttgttcagcccaagtagagaaatgcctactttttcaggtacattggaaggtcatctgattcctatggcaattcttttaggacaaacccaaagtaatagtgataccatgccacctgctggagtgattgtcagcaagccacaccctgtaactgtgactacttctattcctccatcatctcgaaaagtagaaactggagtaaagaaacctaacatagccattgtagaaatgaagtcagaaaaaaaggatcctcctcagcttactgtgcaggtattacccagtgtagatattgacagcatttcaaatagtagtgctgatgtcctttcacctctgtctagccccaaagaagcatctcttcctcctgtgcaaacttggataaagactccagaaattatgaaggtagatgaagaagaggtgaagtttccaggaactaactttgatgaaataatcgatgtcatacaggaagaagaaaaatgtgatgaaattccagactctgaaccaattctggagtttaacagaagtgttaaagctgattctacaaaatataatggtcctccatttccgccagttgcttctacttttcagcccactgctgatattctggataaagtaattgagagaaaagaaacactggaaaatagcttaattcaatgggtagagcaagaaataatgtcaagaattatctctgggctctttccagtccagcaacagattgcacctagtatcagtgtttcagtcagtgagacaagtgaaccactgacttctgacattgtggaaggaacaagcagtggcgccctccagctttttgttgatgctggtgttcctgtgaactcaaatgtgattaaacattttgttaacgaagctcttgctgagaccattgctgtcatgctgggtgacagagaagcaaagaagcaaggtcctgttgctacaggtgtttctggggatgcttcaacaaatgaaacatatttgccggcaagagtgtgcaccccactgcctaccccacagcctacgcctccttgctcaccttcatcacctgctaaggagtgtgttttggtaaagactccagattcttctccctgtgattcggatcatgatatggcttttcctgtgaaagaaatatgtgctgaaaaaggagatgatatgcctgccatcatgcttgttaatactccaacagttacccctactactacacctcctccagcggcggcagtttttaccccaactttgtcagatatttccattgataaattgaaggtatcaagcccagagcttcccaagccatggggtgatggagacctgccactggaagaagagaaccctaactcacctcaagaagaacttcatccaagagctattgtaatgtctgtggctaaggatgaagaaccagagagtatggatttccctgctcagcctccacctccagagccagttccctttatgccatttcctgccggcaccaaggccccttccccctcacagatgccaggttctgattcatcaacactggagagcacattgagtgttactgtcactgaaactgaaactttagataaacccatctctgaaggagagattttatttagctgtggtcaaaaattggcccccaagattttagaagatataggactgtacctgacaaaccttaatgatagcttatccagcactctgcatgatgccgttgaaatggaggatgatcctcctagtgaagggcaagtgattaggatgtcccataaaaaatttcatgcagatgcaattctttcttttgctaaacaaaaccaggagtcagcagtttcccagcaagcagtctatcattcagaggacttggaaaacagtgtgggtgaacttagtgaaggacaaagaccccagctaacagcggcagcagagaacatcttaatgggacattctctctatatgcagccacctgtcactaatacacagtctttggatcaacaatgtgatcctaaaccattatctcggcaatttgacacagtttcaggtagtatttatgaagattcatgtgctagtcatggtccaatgagtttgggagaattggagttggagccaaattctaagctggttcttcccacaacacttctgacagcacaagaaaatgatgttaatttaccagtagccgctgaagatttttcccagtaccaactaaagcaaaatcaggatgttaagcaagttgaacacaaaccatcacaaagttacctacgtgttagaaataaatctgatattgcaccttcacagcaacaagtttcaccaggtgatatggatcggacacaaattgagcttaatccgtacctcacatgtgtattttcaggtgggaaagcagtgccactctccgcttcacagatgccccctgccaagatgtcagtgatgctgccgtcagtgaacctcgaggactgctctcagtctctgagtctcagcacaatgcaggaggacatggagtcttcgggggcagataccttctgaacgggaagagacagccagcacagtgtttatgccactggttttaaagtcattttaccttggcttaaaaccctctctcagactgtttggtttttgagcatattctgaaaaaaaaattccaatattttaaaataaaacaaaaagcataatttgggtatttaaagtttttaaataaaataagtataagtcattataagtctgattgtgagttgtttcttagaatcctgagatagcatagagtagtgaaagggcatggcttttgacatctaggcatttaatctataggtgtaattatctgtatgtatttataaaattatgtagctcaaggttattcattctaacatttttataacagcaaatagaaaaaatcaaatgtctatcaataatagactggttttaaagtgatggtacatcagtacaatggaatactatgtattacaaaaaaaaatttaaaaagtttattgatatggaataatctttgagatgcactgttaaagtgaaaaaagccatgtgcaaaatagtgtgtgaactatgcagttgttgaaattatttaaaatggggtggggaggaattcaaatgtatggtatgtcacatattcttacatgtatttgcttgtaaatatattatataaacaagaaactgctaagtttgtctccagggagtagaattgttggctgggtgataggagaggctaagtgataggaatcaaggataatcgtggttactatgtatttgaacttcagttgtgatagaaaaaaatcatcagtgagattaatttttatatgccttatgtataccatataaacctttataaacctgtgaaacatgtaactctattaccttttgcaacataaatacataaaattaaaggaaaataaaaagcattgcttcgtaatcagataaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9786 -> Biological process: GO:0007224 [smoothened signaling pathway] evidence: ISS
            GeneID:9786 -> Biological process: GO:0060271 [cilium morphogenesis] evidence: ISS
            GeneID:9786 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:9786 -> Cellular component: GO:0005813 [centrosome] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.